Complete sequence of a new bipartite begomovirus infecting Sida sp. in Northeastern Brazil.

In Brazil, non-cultivated plants, especially weeds, are infected with a diversity of begomoviruses and often show striking golden mosaic symptoms. In the present study, leaves showing these symptoms were collected from Sida sp. plants in Guadalupe, Piaui State, Northeastern Brazil, in 2015 and 2016. PCR tests with degenerate primers revealed the presence of begomovirus DNA-A and DNA-B components. Restriction enzyme digestion of rolling circle-amplified DNA revealed fragments totaling ~5.2 kb, indicating infection by a bipartite begomovirus. The DNA-A and DNA-B components have a genome organization typical of New World (NW) bipartite begomoviruses and a common region of 220 nucleotides (nt) with 96% identity, indicating these are cognate components. Comparisons performed with the DNA-A sequence revealed the highest nt sequence identity (84%) with that of sida angular mosaic virus (SiAMV), whereas those performed with the DNA-B sequence revealed highest identity (77%) with that of sida chlorotic vein virus (SiCVV). In phylogenetic analyses, the DNA-A sequence was placed in a strongly supported clade with SiAMV and SiCVV from Piaui, whereas the DNA-B sequence was placed in a clade with SiCVV and corchorus mottle virus. Based on the current ICTV criteria for the demarcation of begomovirus species (<91% nt sequence identity for the DNA-A component), this is a member of a new species for which the name "Sida yellow golden mosaic virus" is proposed.

Characterization of tomato leaf curl purple vein virus, a new monopartite New World begomovirus infecting tomato in Northeast Brazil.

A new begomovirus species was identified from tomato plants with upward leaf curling and purple vein symptoms, which was first identified in the Piaui state of Northeast (NE) Brazil in 2014. Tomato leaf samples were collected in 2014 and 2016, and PCR with degenerate primers revealed begomovirus infection. Rolling circle amplification and restriction enzyme digestion indicated a single genomic DNA of ~ 2.6 kb. Cloning and sequencing revealed a genome organization similar to DNA-A components of New World (NW) bipartite begomoviruses, with no DNA-B. The complete nucleotide sequence had the highest identity (80%) with the DNA-A of Macroptilium yellow spot virus (MacYSV), and phylogenetic analyses showed it is a NW begomovirus that clusters with MacYSV and Blainvillea yellow spot virus, also from NE Brazil. Tomato plants agroinoculated with a dimeric clone of this genomic DNA developed upward leaf curling and purple vein symptoms, indistinguishable from those observed in the field. Based on agroinoculation, this virus has a narrow host range, mainly within the family Solanaceae. Co-inoculation experiments with tomato severe rugose virus and tomato mottle leaf curl virus, the two predominant begomoviruses infecting tomato in Brazil, revealed a synergistic interaction among these begomoviruses. The name Tomato leaf curl purple vein virus (ToLCPVV) is proposed for this new begomovirus.

Recent Emergence of the Mild Strain of Tomato yellow leaf curl virus as a Cause of Tomato Yellow Leaf Curl Disease of Processing Tomatoes (Solanum lycopersicon) in the Dominican Republic.

In the early 1990s, the monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) was introduced into the Dominican Republic (DO), and molecular characterization revealed it was an isolate of TYLCV-Israel (TYLCV-IL[DO]) (3,5). In 2006, a study of the variability of TYLCV in DO revealed that TYLCV-IL[DO] was associated with all samples of tomato yellow leaf curl (TYLC) tested and, thus, that the virus had been genetically stable for >15 years (2). However, in 2010 and 2011, 2 of 10 and 11 of 18 samples of TYLC, respectively, were negative for TYLCV infection based upon PCR with the TYLCV-specific primer pair, 2560v (5'-GAGAACAATTGGGATATG-3')/1480c (5'-AATCATGGATTCACGCAC-3'), which directs the amplification of a ~1.7 kb fragment. In 2011, two such samples from the Azua Valley were tested by PCR with the 1470v (5'-AGTGATGAGTTCCCCTGTGC-3')/UPC2 primer pair (1), and sequence analysis of the ~0.4 kb fragment amplified from both samples revealed infection with the mild strain of TYLCV (TYLCV-Mld). A primer specific for TYLCV-Mld was designed (2070v, 5'-AAACGGAGAAATATATAAGGAGCC-3'), and PCR with the 2070v/1480c primer pair directed the amplification of the expected ~2.1 kb fragment from all 11 TYLC samples collected in 2011 that were PCR-negative for TYLCV-IL[DO] infection. Sequence analyses confirmed these were TYLCV-Mld fragments. The complete TYLCV-Mld genome was amplified from two samples from the Azua Valley with Templiphi, the amplified DNA products digested with Sal I, and the resulting ~2.8 kb fragments ligated into Sal I-digested pGEM-11. The complete sequences of these isolates were 2,791 nt and 99% identical to each other and 98% identical to sequences of TYLCV-Mld isolates. The TYLCV-Mld isolates from the DO were designated TYLCV-Mld:DO:TY5:01:2011 (KJ913682) and TYLCV-Mld:DO:TY5:02:2011 (KJ913683). A multimeric clone of TYLCV-Mld:DO:TY5:01:2011 was generated in the binary vector pCAMBIA1300 by cloning a 2.2 kb Sal I-EcoRI fragment containing the intergenic region to generate a 0.8-mer (pCTYMld0.8), and then the full-length Sal I fragment was cloned into the Sal I site of pCTYMld0.8 to generate a 1.8-mer (pCTYMldDO-01-1.8). Tomato plants agroinoculated with Agrobacterium tumefaciens carrying pCTYMldDO-01-1.8 developed severe TYLC disease symptoms 10 to 14 days after inoculation, whereas plants inoculated with a strain carrying the empty vector did not develop symptoms. Samples of processing tomatoes with TYLC were collected in 2012 to 2014 in the DO and tested for TYLCV-IL[DO] and TYLCV-Mld by PCR with the 2560v/1480c and 2070v/1480c primers pairs, respectively; these samples had infections of 93% (13/14), 86% (18/21), and 61% (11/18) with TYLCV-Mld; 29% (4/14), 19% (4/21), and 56% (10/18) with TYLCV-IL[DO]; and 21% (3/14), 5% (1/21), and 28% (5/18) with both viruses, respectively. These results reveal that there has been a striking population shift in the begomovirus causing TYLC in the DO, with TYLCV-Mld becoming predominant. This may reflect selection pressure(s) favoring a small pre-existing population of TYLCV-Mld, such as new tomato varieties, or a recent introduction event, such as that described in Venezuela (4). References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1994. (2) R. L. Gilbertson et al. Page 279 in: Tomato yellow leaf curl virus disease. Springer, 2007. (3) M. K. Nahkla et al. Plant Dis. 78:926, 1994. (4) G. Romay et al. Australasian Plant Dis. Notes, in press, 2014. (5) R. Salati et al. Phytopathology 92:487, 2002.

First Report of Curly Top Disease of Basil Caused by Beet severe curly top virus in California.

In August 2012, symptoms of stunted growth and leaf epinasty, crumpling, and yellowing, were observed in basil plants (Ocimum basilicum) grown in a shadehouse in Calipatria in the Imperial Valley of California. Populations of the beet leafhopper (Circulifer tenellus) carrying curtoviruses (genus Curtovirus, family Geminiviridae) were detected in the Imperial Valley in May 2012. Together, this suggested a curtovirus etiology for this virus-like disease of basil. Total DNA extracts were prepared from leaves of nine representative symptomatic plants (BA1 through 9) and used in the PCR with the general curtovirus primer pair, BGv377 and BGc1509 (1,2). This primer pair directed the amplification of the expected ~1.1 kb DNA fragments from extracts prepared from all nine plants, and not from equivalent extracts from symptomless plants. The sequences of 1.1 kb fragments amplified from four plants (BA1 through 4) were determined, and BLAST analyses revealed 99% nucleotide sequence identities among these sequences, and 98% identities with the homologous region (V2/CP) of Beet severe curly top virus-Cfh (BSCTV-Cfh; GenBank Accession No. U02311). A second primer pair (BGv981 5'-AACGGTCAGGCTATGCCGTCTAC-3' and BGc479 5'-GAAAGACCTCGCCTTCTTCTAGGG-3') was designed to amplify the remainder of the viral genome. The expected size ~2.4 kb fragments were amplified from the extracts of the BA1 through 9 plants, and the fragments from the BA1 and 2 plants were cloned into the pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. Using the sequences of the overlapping PCR-amplified fragments, the complete viral genome sequences of the BA1 and BA2 isolates were determined. The BA1 and BA2 sequences were 2,934 bp and were 99% identical to each other and to the sequence of BSCTV-Cfh (3). To confirm the infectivity of BSCTV in basil, the BSCTV-Cfh infectious clone, which originated from California, was used for agroinoculation and leafhopper transmission experiments in basil plants (cvs. Sweet aroma and Genovese). Basil plants agroinoculated with the BSCTV-Cfh clone developed stunted growth and leaf crumpling and curling symptoms, similar to symptoms observed in the symptomatic plants from the Imperial Valley. The presence of viral DNA in symptomatic plants was confirmed by PCR with the BGv377/BGc1509 primer pair. Basil plants inoculated with an empty vector control did not develop symptoms, nor was curtovirus DNA amplified from these plants by PCR. Beet leafhoppers were given a 48-h acquisition access period on BSCTV-Cfh-infected sugarbeet plants, followed by a 48-h inoculation access period on healthy basil plants. These plants developed curly top symptoms approximately 21 days after inoculation, indicating that BSCTV was transmitted to basil by the beet leafhopper. Together, these results establish that the cause of the disease symptoms in basil in the Imperial Valley of California was BSCTV. This is the first report of curly top disease in basil, which is the second member of the mint family (Lamiaceae) known to be infected by a curtovirus. The stunted growth induced in basil by BSCTV has the potential to cause yield and economic loss, particularly in open field or screenhouse production when beet leafhopper populations are high. References: (1) L-F. Chen et al. Plant Dis. 94:99, 2010. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (3) D. C. Stenger. Mol. Plant-Micro. Interact. 7:154, 1994.

First Report of Tomato chlorotic spot virus in Processing Tomatoes in the Dominican Republic.

Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5'ATGTCTAAGGTCAAGCTCACC3' and NR5'TTATGCAACACCTGAAATTTTGGC3'), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.

First Report of Bacterial Wilt Caused by Ralstonia solanacearum in Ghana, West Africa.

Tomato and pepper plants exhibiting wilt symptoms were collected from fields in seven villages in Northern (Vea, Tono, Pwalugu), Ashanti (Agogo, Akumadan), and Brong Ahafo (Tanoso, Tuobodom) regions of western Ghana in November 2012. The plants were wilted without leaf yellowing or necrosis. Disease incidence was generally low, with less than 20% symptomatic plants observed. Most of the plants collected produced visible bacterial ooze in water in the field. Ooze was plated on 2,3,5-triphenyltetrazolium chloride-amended (TZC) medium. Isolated colonies were fluidal, irregularly round, white with pink centers, gram-negative, and oxidase positive. One strain from each of seven fields was selected for further study. All strains induced a hypersensitive reaction on tobacco. Randomly selected strains SM855-12 and SM857-12 tested positive in R. solanacearum ImmunoStrip assays (Agdia Inc., IN). An end-point PCR assay with primer set 759/760 (3) generated an R. solanacearum-specific 280-bp amplicon for all seven strains. Two of these strains were biovar I and the remaining five were biovar III based on utilization of cellobiose, lactose, maltose, dulcitol, mannitol, and sorbitol. A phylotype-specific multiplex PCR assay that recognizes four geographically linked monophyletic groups within R. solanacearum (1) indicated that one strain (SM855-12) was phylotype III (African origin), whereas the other six were phylotype I (Asian origin). All strains were subjected to repetitive sequence-based PCR (Rep-PCR) with BOXA1R and REP1R/REP2 primers (4). Strain SM855-12 was grouped with the phylotype III reference strain UW 368 and the remaining six strains were grouped with the phylotype I reference strain GMI 1000. A pathogenicity test was performed with bacterial wilt-susceptible tomato line OH7814. Inoculum was prepared from 48-h cultures of strains SM855-12, SM856-12, and SM858-12 grown on casamino acid peptone glucose (CPG) medium at 30°C. Roots of ten 4-week-old tomato plants per strain were drench-inoculated with 5 ml of a 108 CFU/ml bacterial suspension after wounding with a sterile scalpel. Non-inoculated control plants were drenched with 5 ml distilled water after root wounding. Plants were kept in a greenhouse at 25 to 30°C. By 12 days after inoculation, 80 to 100% of inoculated plants were wilted, whereas no symptoms appeared in non-inoculated plants. Bacteria re-isolated from wilted plants were confirmed to be R. solanacearum using techniques mentioned above. Although an association of bacterial wilt with tomato/pepper was mentioned previously (2), to our knowledge, this is the first documented report of bacterial wilt caused by R. solanacearum in Ghana. The presence of Asian strains (phylotype I) may be the result of one or more accidental introductions. Awareness of this disease in Ghana will lead to deployment of management strategies including use of resistant varieties and grafting desirable varieties onto disease-resistant rootstocks. References: (1) M. Fegan and P. Prior. Page 449 in Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. C. Allen et al., eds. American Phytopathological Society, St. Paul, MN, 2005. (2) K. A. Oduro. Plant Protection and Regulatory Services Directorate of MOFA, Accra, Ghana, 2000. (3) N. Opina et al. Asia Pac. J. Mol. Biol. Biotechnol. 5:19, 1977. (4) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

First Report of Columnea latent viroid (CLVd) in Tomato in Mali.

During surveys of tomato (Solanum lycopersicum) fields in Niono, Mali, conducted in March 2011, unusual disease symptoms, including stunted growth, epinasty, and chlorosis of leaves and necrosis of leaf veins and stems were observed in multiple fields. The incidence of these symptoms was low (~1 to 5%), but they were distinct from those associated with known diseases in the region. A representative leaf sample with these symptoms was applied to filter paper (FTA cards, Whatman), and DNA and RNA extracts were prepared according to manufacturer instructions. RT-PCR tests for Tomato spotted wilt virus, Tobacco streak virus, Tomato necrotic spot virus, Tobacco/tomato mosaic viruses, Cucumber mosaic virus, Alfalfa mosaic virus, torradoviruses, and potyviruses, and PCR tests for begomoviruses, phytoplasmas, and 'Candidatus Liberibacter' infection were also negative. However, virus-like symptoms developed in all 16 tomato seedlings (cv. Early Pak 7) 7 to 10 days after mechanical (sap) inoculation with inoculum prepared from the FTA sample. No symptoms developed in mock-inoculated control plants (n = 3). Symptoms induced included stunted growth and severe epinasty of leaves, followed by necrosis of leaf veins, petioles, and stems. These symptoms were similar to those observed in plants in Mali. When RNA extracts prepared from leaves of these symptomatic plants were mechanically inoculated onto 24 tomato seedlings, similar symptoms developed in all plants, suggesting the causal agent might be a viroid. RT-PCR tests with RNA from symptomatic tomato leaves and universal (3) and various specific Pospiviroid primer pairs were negative. However, equivalent RT-PCR tests conducted with the pCLV4/pCLVR4 primer pair specific for Columnea latent viroid (CLVd) (2) generated a DNA fragment of the expected size (~370 bp). The sequence of this DNA fragment (GenBank Accession No. JQ362419) was 99% identical with those of CLVd isolates from the Netherlands (AY373446 and AY372396). In host range studies, the CLVd isolate from Mali induced symptoms in all 48 mechanically-inoculated tomato plants, whereas no symptoms developed (up to 90 days after inoculation) in inoculated Chenopodium quinoa, C. amaranticolor, Nicotiana benthamiana, N. tabacum (cvs. Havana, Glurk and Turkish), N. glutinosa, Datura stramonium, common bean (cvs. Topcrop and Pinto bean), pumpkin (cv. Small Sugar), pepper (Capsicum annuum, cv. Yolo Wonder) and cucumber (cvs. Emparator and Poinsett 76) plants (results of three independent experiments with six plants per experiment). Symptomless infections were detected in pepper (24 of 30), N. benthamiana (25 of 25), and N. tabacum cv. Turkish (11 of 24) plants by RT-PCR with the pCLV4/pCLVR4 primer pair. To our knowledge, this is the first report of CLVd infecting tomato in Mali. RT-PCR tests of seeds collected from CLVd-infected tomato, pepper, and N. benthamiana plants also detected CLVd (1). Thus, it is possible that CLVd was introduced into Mali in association with seed. References: (1) O. Batuman and R. L. Gilbertson. Phytopathology 102:S4.9, 2012. (2) R. L. Spieker. Arch. Virol. 141:1823, 1996. (3) J. T. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

Genetic diversity in curtoviruses: a highly divergent strain of Beet mild curly top virus associated with an outbreak of curly top disease in pepper in Mexico.

A full-length curtovirus genome was PCR-amplified and cloned from peppers in Mexico with symptoms of curly top disease. The cloned DNA of this isolate, MX-P24, replicated in Nicotiana tabacum protoplasts and was infectious in N. benthamiana plants. Sequence analysis revealed that the MX-P24 isolate had a typical curtovirus genome organization and was most similar to beet mild curly top virus (BMCTV). However, sequence identities were at the threshold value for establishment of a new curtovirus species. To further investigate the biological properties of MX-P24, an agroinoculation system was generated. Agroinoculated shepherd's purse plants developed typical curly top symptoms, and virus from these plants was transmissible by the beet leafhopper (Circulifer tenellus). The host range of MX-P24 was similar to that of BMCTV, with curly top symptoms induced in common bean, pepper, pumpkin, shepherd's purse and tomato plants and mild or no symptoms induced in sugar beet plants. Together, these results indicate that MX-P24 is a highly divergent strain of BMCTV associated with an outbreak of curly top disease in peppers in Mexico.

Tomato chocolate spot virus, a member of a new torradovirus species that causes a necrosis-associated disease of tomato in Guatemala.

Tomatoes in Guatemala have been affected by a new disease, locally known as "mancha de chocolate" (chocolate spot). The disease is characterized by distinct necrotic spots on leaves, stems and petioles that eventually expand and cause a dieback of apical tissues. Samples from symptomatic plants tested negative for infection by tomato spotted wilt virus, tobacco streak virus, tobacco etch virus and other known tomato-infecting viruses. A virus-like agent was sap-transmitted from diseased tissue to Nicotiana benthamiana and, when graft-transmitted to tomato, this agent induced chocolate spot symptoms. This virus-like agent also was sap-transmitted to Datura stramonium and Nicotiana glutinosa, but not to a range of non-solanaceous indicator plants. Icosahedral virions approximately 28-30 nm in diameter were purified from symptomatic N. benthamiana plants. When rub-inoculated onto leaves of N. benthamiana plants, these virions induced symptoms indistinguishable from those in N. benthamiana plants infected with the sap-transmissible virus associated with chocolate spot disease. Tomatoes inoculated with sap or grafted with shoots from N. benthamiana plants infected with purified virions developed typical chocolate spot symptoms, consistent with this virus being the causal agent of the disease. Analysis of nucleic acids associated with purified virions of the chocolate-spot-associated virus, revealed a genome composed of two single-stranded RNAs of approximately 7.5 and approximately 5.1 kb. Sequence analysis of these RNAs revealed a genome organization similar to recently described torradoviruses, a new group of picorna-like viruses causing necrosis-associated diseases of tomatoes in Europe [tomato torrado virus (ToTV)] and Mexico [tomato apex necrosis virus (ToANV) and tomato marchitez virus (ToMarV)]. Thus, the approximately 7.5 kb and approximately 5.1 kb RNAs of the chocolate-spot-associated virus corresponded to the torradovirus RNA1 and RNA2, respectively; however, sequence comparisons revealed 64-83% identities with RNA1 and RNA2 sequences of ToTV, ToANV and ToMarV. Together, these results indicate that the chocolate-spot-associated virus is a member of a distinct torradovirus species and, thus, another member of the recently established genus Torradovirus in the family Secoviridae. The name tomato chocolate spot virus is proposed.

First Report of Tomato yellow leaf curl virus Infecting Tomato, Tomatillo, and Peppers in Guatemala.

In Guatemala and other Central American countries, whitefly-transmitted geminiviruses (begomoviruses) cause economically important diseases of tomato (Solanum lycopersicum) and pepper (Capsicum annuum). Disease symptoms include stunted and distorted growth and leaf curling, crumpling, light green to yellow mosaic, purpling, and vein swelling. In Guatemala, at least eight bipartite begomovirus species infect tomato or peppers (1), but their role and relative importance is unclear. As part of an Integrated Pest Management strategy to manage these diseases, surveys for begomovirus symptoms in pepper and tomato have been conducted in the Salama Valley, Sanarate, and other locations since 2003, and begomoviruses were identified by squash blot hybridization, PCR and DNA sequencing. Beginning in 2006, a new type of symptom, stunted upright growth and upcurled leaves with yellowing of the margins and interveinal areas, was observed in tomato and tomatillo plants in the Salama Valley and Sanarate. These symptoms were similar to those induced by the exotic monopartite begomovirus Tomato yellow leaf curl virus (TYLCV). Evidence that TYLCV caused these symptoms came from positive results in high stringency squash blot hybridization tests with a TYLCV probe, and amplification of the expected size of ~0.3- and 2.8-kb fragments in PCR tests with TYLCV capsid protein (CP) gene and full-length component primer pairs, respectively (3). Sequence analyses of PCR-amplified CP fragments and portions of full-length fragments revealed 97 to 99% identity with isolates of TYLCV-Israel (TYLCV-IL). The complete nucleotide sequence of an isolate from the Salama Valley (GenBank Accession No. GU355941) was >99% identical to those of TYLCV-IL isolates from the Dominican Republic, Florida, and Cuba and ~97% identical to those of isolates from Mexico and California. Thus, this TYLCV-IL isolate (TYLCV-IL[GT:06]) was probably introduced from the Caribbean Region. To further characterize begomoviruses in the Salama Valley, leaf samples were collected from 44 and 118 tomato plants showing symptoms of begomovirus infection in March 2006 and 2007, respectively, and from 106 symptomatic pepper plants in March 2007. Begomovirus infection was confirmed in 42 of 44 and 93 of 118 of the tomato samples and 100 of 106 of the pepper samples based on PCR amplification of the expected size of ~0.6- and 1.1-kb DNA fragments with the begomovirus degenerate primers pairs AV494/AC1048 and PAL1v1978/PAR1c496, respectively (2,4). Sequence analyses of cloned PCR-amplified fragments revealed that 3 of the 44 and 16 of the 118 tomato samples collected in 2006 and 2007, respectively, and 9 of the 106 pepper samples were infected with TYLCV based on >97% identity with TYLCV-IL. In all samples, TYLCV was present in mixed infections with other begomoviruses. The introduction of TYLCV adds to the already high level of genetic complexity of bipartite begomovirus infection of tomatoes and peppers in Guatemala and will undoubtedly complicate disease management efforts. References: (1) M. K. Nakhla et al. Acta Hortic. 695:277, 2005. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) R. Salati et al. Phytopathology 92:487, 2002. (4) S. D. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

Quantitative Resistance to Bean dwarf mosaic virus in Common Bean Is Associated with the Bct Gene for Resistance to Beet curly top virus.

The dominant resistance gene, Bct, in common bean (Phaseolus vulgaris) confers qualitative resistance to Beet curly top virus, a leafhopper-transmitted geminivirus in the genus Curtovirus. To determine whether this gene confers resistance to other geminiviruses, bean plants of a recombinant inbred population were sap-inoculated with Bean dwarf mosaic virus (BDMV), a whitefly-transmitted bipartite begomovirus in the genus Begomovirus. Results indicated that Bct (or tightly linked gene) is associated with quantitative resistance to BDMV; thus, the Bct locus is associated with resistance to a bean-infecting begomovirus and curtovirus. The difference in the nature of the resistance to these geminiviruses may indicate a role for minor genes in begomovirus resistance or differences in the virus-host interaction. The Bct locus, whether it acts alone or represents a cluster of tightly linked genes, will be useful in breeding for broad-spectrum begomovirus resistance in common bean.

An Outbreak of a Necrosis Disease of Tomato in California in 2008 was Caused by a New Ilarvirus Species Related to Parietaria mottle virus.

During the 2008 early-summer growing season, virus-like necrosis symptoms, most similar to those induced by Tobacco streak virus (TSV), were observed in leaves, stems, and petioles of processing tomato plants in the Central Valley of California. Symptoms were observed in numerous fields in Merced, San Joaquin, and Yolo counties, though the incidence of the disease in most fields was not high (not more than 5% but over 20% in some areas). Antibody-based tests of representative samples of the disease for infection with Tomato spotted wilt virus, TSV, and Tomato apex necrosis virus, which cause similar symptoms, were negative. A putative virus-like agent was sap- and graft-transmitted to tomato plants and induced necrotic spots in leaves and stem and petiole necrosis symptoms that were similar to those observed in the field. Eventually, these plants recovered from these symptoms. In sap-transmission experiments, the virus-like agent induced systemic symptoms in Chenopodium quinoa and C. amaranticolor (stunted growth and leaf curl and necrosis), Nicotiana benthamiana (necrotic leaf and stem lesions), N. tabacum cvs. Havana and Turkish (stunted growth and necrotic etching and ringspots followed by recovery for cv. Havana but not for cv. Turkish), and Datura stramonium (mild mottle and ringspots in newly emerged leaves followed by recovery); no symptoms were observed in inoculated common bean (cv. Topcrop), pumpkin (cv. Small Sugar), pepper, and N. glutinosa plants. Virus minipurification was performed with leaves from noninfected and infected D. stramonium plants, and polyacrylamide gel electrophoresis analyses revealed a protein band of ~29 kDa in infected but not noninfected plants. This protein was purified and subjected to liquid chromatography-mass/mass spectrometry analysis. Four peptides, obtained from the trypsin-digested protein, each had the highest match (score of 118) with the capsid protein (CP) of Parietaria mottle virus (PMoV), an ilarvirus that induces leaf and stem necrosis in tomatoes in Europe (1). Using sequences of PMoV and other ilarviruses, a single primer was designed from the 3' nontranslated region and paired with primers designed from conserved regions of ilarvirus RNAs 1, 2, and 3. In reverse transcription-PCR analyses, these primer pairs directed the amplification of the expected-sized fragments for ilarvirus RNAs 1, 2, and 3 from RNA extracts prepared from leaves with the unusual necrosis symptoms. Sequence analyses confirmed these were ilarvirus fragments. Partial RNA 1, 2, and 3 sequences were 81, 84, and 82% identical, respectively, with those of PMoV and 80, 77, and 69% identical, respectively, with those of TSV. The amino acid sequence of the CP gene (GenBank Accession No. FJ236810) was 86 and 61% identical to those of PMoV and TSV, respectively. Together, these results indicate the necrosis disease of tomato is caused by a new ilarvirus species, tentatively named Tomato necrotic spot virus, although further studies are needed to confirm this. The mode of transmission of this new ilarvirus to tomatoes in the field is unknown, but it may involve thrips feeding on infected pollen, a known method of transmission for TSV (2). References: (1) L. Galipienso et al. Plant Pathol. 54:29, 2005. (2) R. Sdoodee and D. S. Teakle. Plant Pathol. 36:377, 1987.

Recovery from Cucurbit leaf crumple virus (family Geminiviridae, genus Begomovirus) infection is an adaptive antiviral response associated with changes in viral small RNAs.

A strong recovery response occurs in cantaloupe (Cucumis melo) and watermelon (Citrullus lanatus) infected with the bipartite begomovirus Cucurbit leaf crumple virus (CuLCrV). This response is characterized by initially severe symptoms, which gradually become attenuated (almost symptomless). An inverse relationship was detected between viral DNA levels and recovery, indicating that recovered tissues had reduced viral titers. Recovered tissues also were resistant to reinfection with CuLCrV; i.e., recovered leaves reinoculated with the virus did not develop symptoms or have an increased level of viral DNA. In contrast, infection of CuLCrV-recovered leaves with the RNA virus, Cucumber mosaic virus (CMV), disrupted recovery, resulting in the development of severe disease symptoms (more severe than those induced by CMV or CuLCrV alone) and increased CuLCrV DNA levels. Small RNAs with homology to CuLCrV DNA were detected in recovered and nonrecovered tissues; as well as in phloem exudates from infected, but not uninfected plants. Levels of these small RNAs were positively correlated with viral titer; thus, recovered tissues had lower levels than symptomatic tissues. In addition, viral DNA from a host that undergoes strong recovery (watermelon) was more highly methylated compared with that from a host that undergoes limited recovery (zucchini). Furthermore, inoculation of CuLCrV-infected zucchini with a construct expressing an inverted repeat of the CuLCrV common region enhanced recovery and reduced viral symptoms and viral DNA levels in newly emerged leaves. Taken together, these results suggest that recovery from CuLCrV infection is an adaptive antiviral defense mechanism, most likely mediated by gene silencing.

First Report of Impatiens necrotic spot virus Infecting Lettuce in California.

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

Biology and Molecular Characterization of Cucurbit leaf crumple virus, an Emergent Cucurbit-Infecting Begomovirus in the Imperial Valley of California.

Cucurbit leaf crumple virus (CuLCrV) is an emergent and potentially economically important bipartite begomovirus first identified in volunteer watermelon plants in the Imperial Valley of southern California in 1998. Field surveys indicated that CuLCrV has become established in the Imperial Valley; and field plot studies revealed that CuLCrV primarily infects cucurbits, including cantaloupe, squash, and watermelon. Full-length DNA-A and DNA-B clones of an Imperial Valley isolate of CuLCrV were obtained by polymerase chain reaction (PCR) with overlapping primers. These clones were infectious in various cucurbits and common bean (cv. Topcrop); symptoms included stunted growth and leaf crumple, curl, and chlorosis. CuLCrV was not sap-transmissible, and immunolocalization and DNA in situ hybridization studies revealed that it is phloem-limited. A CuLCrV agroinoculation system was generated, and host range studies revealed differential susceptibility in cucurbits, with squash, watermelon, cantaloupe, and honeydew melon being most to least susceptible, respectively. Germplasm screening studies identified a number of resistant cantaloupe and honeydew melon cultivars. The genome organization of this CuLCrV isolate (CuLCrV-CA) is similar to other bipartite begomoviruses, and phylogenetic analysis placed CuLCrV in the Squash leaf curl virus (SLCV) cluster of New World bipartite begomoviruses. A CuLCrV-specific PCR test was developed which allows for differentiation from other begomoviruses, including SLCV.

The N-terminus of the Begomovirus nuclear shuttle protein (BV1) determines virulence or avirulence in Phaseolus vulgaris.

The BV1 gene of the bipartite Begomovirus genome encodes a nuclear shuttle protein (NSP) that is also an avirulence determinant in common bean. The function of the NSP of two common bean-infecting bipartite begomoviruses, Bean dwarf mosaic virus (BDMV) and Bean golden yellow mosaic virus (BGYMV), was investigated using a series of hybrid DNA-B components expressing chimeric BDMV and BGYMV NSP, and genotypes of the two major common bean gene pools: Andean (cv. Topcrop) and Middle American (cvs. Alpine and UI 114). BDMV DNA-A coinoculated with HBDBG4 (BDMV DNA-B expressing the BGYMV NSP) and HBDBG9 (BDMV DNA-B expressing a chimeric NSP with the N-terminal 1 to 42 amino acids from BGYMV) overcame the BDMV resistance of UI 114. This established that the BDMV NSP is an avirulence determinant in UI 114, and mapped the domain involved in this response to the N-terminus, which is a variable surface-exposed region. BDMV DNA-A coinoculated with HBDBG10, expressing a chimeric NSP with amino acids 43 to 92 from BGYMV, was not infectious, revealing an essential virus-specific domain. In the BGYMV background, the BDMV NSP was a virulence factor in the Andean cv. Topcrop, whereas it was an avirulence factor in the Middle American cultivars, particularly in the absence of the BGYMV NSP. The capsid protein (CP) also played a gene pool-specific role in viral infectivity; it was dispensable for infectivity in the Andean cv. Topcrop, but was required for infectivity of BDMV, BGYMV, and certain hybrid viruses in the Middle American cultivars. Redundancy of the CP and NSP, which are nuclear proteins involved directly or indirectly in viral movement, provides a masking effect that may allow the virus to avoid host defense responses.

First Report of Cucurbit yellow stunting disorder virus in California and Arizona, in Association with Cucurbit leaf crumple virus and Squash leaf curl virus.

In August and September of 2006, melon plants (Cucumis melo L.) near Niland in California's Imperial Valley and near Yuma, AZ began exhibiting interveinal chlorosis and leaf mottling and spotting, symptoms resembling those resulting from infection by viruses of the genus Crinivirus, family Closteroviridae (4). Some plants also exhibited leaf crumpling and curling, symptoms characteristic of begomovirus (genus Begomovirus, family Geminiviridae) infection. Leaves of plants had large populations of silverleaf whitefly (Bemisia tabaci biotype B), a known vector of begomoviruses and some criniviruses. Leaf samples were collected from four plants from California and 13 plants from three separate fields in Arizona. Total RNA was extracted using RNeasy kits (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR using degenerate primers specific to the conserved polymerase region of a diverse group of criniviruses (3). The expected 500-bp RT-PCR product was amplified from RNA obtained from all the symptomatic melons, whereas no fragment was obtained from RNA extracted from leaves of healthy controls. The 500-bp fragment from four plants from California and five plants from Arizona was sequenced and found to be identical for all nine isolates (GenBank Accession No. EF121768). The sequenced region of the California and Arizona Cucurbit yellow stunting disorder virus (CYSDV) isolates was identical to that from a CYSDV isolate from Texas (GenBank Accession No. AY242077) and shared 99% identity with a CYSDV isolate from Spain (GenBank Accession No. AJ537493). Subsequent RT-PCR analysis of RNA from these nine plants, with primers specific to the capsid protein (CYScp1F 5' GCACGGTGACCAAAAGAAG 3' and CYScp1R 5' GAA-CATTCCAAAACTGCGG 3') and HSP70h (CYShspF 5' TGATGTATG-ACTTCGGAGGAGGAAC 3' and CYShspR 5' TCAGCGGACAAA-CCACCTTTC 3') genes of CYSDV, was used to further confirm virus identity. The expected fragments, 202 and 175 bp, respectively, were amplified from all nine samples, but not from healthy controls. DNA extracts also were prepared from these nine melon samples from California and Arizona, and PCR assays were conducted for the begomoviruses Cucurbit leaf crumple virus (CuLCrV) and Squash leaf curl virus (SLCV) (2). The four plants from California showed crumpling, curling, and yellowing symptoms; all were infected with SLCV and one with CuLCrV. The five plants from Arizona showed mostly yellowing symptoms; five were infected with SLCV and two with CuLCrV. These results demonstrate begomovirus and crinivirus co-infection. The economic impact of mixed infections with CYSDV and begomoviruses remains to be determined. Incidence of CYSDV in melon was directly correlated with incidence of its vector, B. tabaci. Host range information has demonstrated that the primary hosts of CYSDV are members of the Cucurbitaceae (1). A number of experimental hosts have been documented; however, the extensive vegetable production in the southwestern United States warrants further study on the potential for the establishment of local reservoirs in both crop and weed species in the area. The virus causes economic losses worldwide for curcurbit production. References: (1) A. Celix et al. Phytopathology 86:1370, 1996. (2) R. Gilbertson. Ann. Rep. CA Melon Res. Board, 2001. (3) R. Martin et al. Acta Hortic. 656:137, 2004. (4) G. Wisler et al. Plant Dis. 82:270. 1998.

First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California.

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5'-GGATCCACTTCTAAATGAATTTCCTG-3' and TYBamHI2c: 5'-GGATCCCACATAGTGCAAGACAAAC-3'), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

Evaluation of Cotton Germ Plasm for Resistance to the Whitefly and Cotton Leaf Crumple (CLCr) Disease and Etiology of CLCr in California's Imperial Valley.

Cotton (Gossypium hirsutum) entries were evaluated for resistance to the whitefly (Bemisia tabaci biotype B) and cotton leaf crumple (CLCr) disease during the 1999 to 2001 growing seasons in the Imperial Valley of California. Entries were evaluated for densities of whitefly adults and nymphs, and for CLCr, by visual rating and squash/dot blot hybridization analyses. Differences in whitefly densities were detected among entries, but none were highly resistant, nor was there any correlation with CLCr disease severity. Entries AP 4103 and AP 6101 had relatively low whitefly densities and were highly susceptible (high CLCr disease severity ratings and viral titers), whereas NK 2387C and DPX 1883 also had low whitefly densities but were highly resistant (no symptoms or detectable viral titers). Other entries showed moderate CLCr resistance, which was independent of whitefly density. Geminivirus DNA-A and DNA-B components were consistently detected in cotton leaves with CLCr symptoms by polymerase chain reaction (PCR) with degenerate begomovirus primers, and full-length DNA-A and DNA-B clones were obtained. Cotton seedlings inoculated with these cloned DNAs by particle bombardment developed CLCr symptoms, and progeny virus was whitefly-transmissible. Sequence analysis revealed that these clones comprised the genome of a California isolate of the bipartite begomovirus Cotton leaf crumple virus (CLCrV-CA). Thus, CLCr disease in the Imperial Valley is caused by CLCrV-CA, and cotton entries with high levels of resistance were identified.

Toward an integrated linkage map of common bean. III. Mapping genetic factors controlling host-bacteria interactions.

Restriction fragment length polymorphism (RFLP)-based genetic linkage maps allow us to dissect the genetic control of quantitative traits (QT) by locating individual quantitative trait loci (QTLs) on the linkage map and determining their type of gene action and the magnitude of their contribution to the phenotype of the QT. We have performed such an analysis for two traits in common bean, involving interactions between the plant host and bacteria, namely Rhizobium nodule number (NN) and resistance to common bacterial blight (CBB) caused by Xanthomonas campestris pv. phaseoli. Analyses were conducted in the progeny of a cross between BAT93 (fewer nodules; moderately resistant to CBB) and Jalo EEP558 (more nodules; susceptible to CBB). An RFLP-based linkage map for common bean based on 152 markers had previously been derived in the F2 of this cross. Seventy F2-derived F3 families were inoculated in separate greenhouse experiments with Rhizobium tropici strain UMR1899 or X. c. pv. phaseoli isolate isolate W18. Regression and interval mapping analyses were used to identify genomic regions involved in the genetic control of these traits. These two methods identified the same genomic regions for each trait, with a few exceptions. For each trait, at least four putative QTLs were identified, which accounted for approximately 50% and 75% of the phenotypic variation in NN and CBB resistance, respectively. A chromosome region on linkage group D7 carried factor(s) influencing both traits. In all other cases, the putative QTLs affecting NN and CBB were located in different linkage groups or in the same linkage group, but far apart (more than 50 cM). Both BAT93 and Jalo EEP558 contributed alleles associated with higher NN, whereas CBB resistance was always associated with BAT93 alleles. Further investigations are needed to determine whether the QTLs for NN and CBB on linkage group D7 represent linked genes or the same gene with pleiotropic effects. Identification of the QTLs raises the possibility of initiating map-based cloning and marker-assisted selection for these traits.