Transcriptome analysis and functional verification reveal the roles of copper in resistance to potato virus Y infection in tobacco.

Potato virus Y (PVY) is one of the most important pathogens in the genus Potyvirus that seriously harms agricultural production. Copper (Cu), as a micronutrient, is closely related to plant immune response. In this study, we found that foliar application of Cu could inhibit PVY infection to some extent, especially at 7 days post inoculation (dpi). To explore the effect of Cu on PVY infection, transcriptome sequencing analysis was performed on PVY-infected tobacco with or without Cu application. Several key pathways regulated by Cu were identified, including plant-pathogen interaction, inorganic ion transport and metabolism, and photosynthesis. Moreover, the results of virus-induced gene silencing (VIGS) assays revealed that NbMLP423, NbPIP2, NbFd and NbEXPA played positive roles in resistance to PVY infection in Nicotiana benthamiana. In addition, transgenic tobacco plants overexpressing NtEXPA11 showed increased resistance to PVY infection. These results contribute to clarify the role and regulatory mechanism of Cu against PVY infection, and provide candidate genes for disease resistance breeding.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Building a Robust Chromatin Immunoprecipitation Method with Substantially Improved Efficiency.

Chromatin immunoprecipitation (ChIP) is the gold-standard method for detection of interactions between proteins and chromatin and is a powerful tool for identification of epigenetic modifications. Although ChIP protocols for plant species have been developed, many specific features of plants, especially woody plants, still hinder the efficiency of immunoprecipitation, resulting in inefficient ChIP enrichment and an active demand for a highly efficient ChIP protocol. In this study, using birch (Betula platyphylla) and Arabidopsis (Arabidopsis thaliana) as the research materials, we identified five factors closely associated with ChIP efficiency, including crosslinking, concentration of chromatin using centrifugal filters, use of a different immunoprecipitation buffer, rescue of DNA with proteinase K, and use of Suc to increase immunoprecipitation efficiency. Optimization of any these factors can significantly improve ChIP efficiency. Considering these factors together, we developed a robust ChIP protocol that achieved a 14-fold improvement in ChIP enrichment for birch and a >6-fold improvement for Arabidopsis compared to the standard ChIP method. As this ChIP method works well in both birch and Arabidopsis, it should also be suitable for other woody and herbaceous species. In addition, this ChIP method enables detection of low-abundance transcription factor-DNA interactions and may extend the application of ChIP in the plant kingdom.

Synthesis, in vitro and in vivo biological evaluation of novel graveolinine derivatives as potential anti-Alzheimer agents.

A novel series of graveolinine derivatives were synthesized and evaluated as potential anti-Alzheimer agents. Compound 5f exhibited the best inhibitory activity for acetylcholinesterase (AChE) and had surprisingly potent inhibitory activity for butyrylcholinesterase (BuChE), with IC50 values of 0.72 µM and 0.16 µM, respectively. The results from Lineweaver-Burk plot and molecular modeling study indicated non-competitive inhibition of AChE by compound 5f. In addition, these derivatives showed potent self-induced ß-amyloid (Aß) aggregation inhibition. Moreover, 5f didn't show obvious toxicity against PC12 and HepG2 cells at 50 µM. Finally, in vivo studies confirmed that 5f significantly ameliorates the cognitive performances of scopolamine-treated ICR mice. Therefore, these graveolinine derivatives should be thoroughly and systematically studied for the treatment of Alzheimer's disease.

BplMYB46 from Betula platyphylla Can Form Homodimers and Heterodimers and Is Involved in Salt and Osmotic Stresses.

MYB proteins play important roles in the regulation of plant growth, development, and stress responses. Overexpression of BplMYB46 from Betula platyphylla improved plant salt and osmotic tolerances. In the present study, the interaction of eight avian myeloblastosis viral oncogene homolog (MYB) transcription factors with BplMYB46 was investigated using the yeast two-hybrid system, which showed that BplMYB46 could form homodimers and heterodimers with BplMYB6, BplMYB8, BplMYB11, BplMYB12, and BplMYB13. Relative beta-glucuronidase activity and chromatin immunoprecipitation assays showed that the interaction between BplMYB46 and the five MYBs increased the binding of BplMYB46 to the MYBCORE motif. A subcellular localization study showed that these MYBs were all located in the nucleus. Real-time fluorescence quantitative PCR results indicated that the expressions of BplMYB46 and the five MYB genes could be induced by salt and osmotic stress, and the BplMYB46 and BplMYB13 exhibited the most similar expression patterns. BplMYB46 and BplMYB13 co-overexpression in tobacco using transient transformation technology improved tobacco's tolerance to salt and osmotic stresses compared with overexpressing BplMYB13 or BplMYB46 alone. Taken together, these results demonstrated that BplMYB46 could interact with five other MYBs to form heterodimers that activate the transcription of target genes via an enhanced binding ability to the MYBCORE motif to mediate reactive oxygen species scavenging in response to salt and osmotic stresses.

Identification of novel cis-elements bound by BplMYB46 involved in abiotic stress responses and secondary wall deposition.

Transcription factors (TFs) play vital roles in various biological processes by binding to cis-acting elements to control expressions of their target genes. The MYB TF BplMYB46, from Betula platyphylla, is involved in abiotic stress responses and secondary wall deposition. In the present study, we used a TF-centered yeast one-hybrid technology (TF-centered Y1H) to identify the cis-acting elements bound by BplMYB46. We screened a short-insert random library and identified three cis-elements bound by BplMYB46: an E-box (CA(A/T/C)(A/G/C)TG) and two novel motifs, a TC-box (T(G/A)TCG(C/G)) and a GT-box (A(G/T)T(A/C)GT(T/G)C). Chromatin immunoprecipitation (ChIP) and effector-reporter coexpression assays in Nicotiana tabacum confirmed binding of BplMYB46 to the TC-box, GT-box, and E-box motifs in the promoters of the phenylalanine ammonia lyase (PAL), peroxidase (POD), and superoxide dismutase (SOD) genes, which function in abiotic stress tolerance and secondary wall biosynthesis. This finding improves our understanding of potential regulatory mechanisms in the response to abiotic stress and secondary wall deposition of BplMYB46 in B. platyphylla.

Expression of the MYB transcription factor gene BplMYB46 affects abiotic stress tolerance and secondary cell wall deposition in Betula platyphylla.

Plant MYB transcription factors control diverse biological processes, such as differentiation, development and abiotic stress responses. In this study, we characterized BplMYB46, an MYB gene from Betula platyphylla (birch) that is involved in both abiotic stress tolerance and secondary wall biosynthesis. BplMYB46 can act as a transcriptional activator in yeast and tobacco. We generated transgenic birch plants with overexpressing or silencing of BplMYB46 and subjected them to gain- or loss-of-function analysis. The results suggest that BplMYB46 improves salt and osmotic tolerance by affecting the expression of genes including SOD, POD and P5CS to increase both reactive oxygen species scavenging and proline levels. In addition, BplMYB46 appears to be involved in controlling stomatal aperture to reduce water loss. Overexpression of BplMYB46 increases lignin deposition, secondary cell wall thickness and the expression of genes in secondary cell wall formation. Further analysis indicated that BplMYB46 binds to MYBCORE and AC-box motifs and may directly activate the expression of genes involved in abiotic stress responses and secondary cell wall biosynthesis whose promoters contain these motifs. The transgenic BplMYB46-overexpressing birch plants, which have improved salt and osmotic stress tolerance, higher lignin and cellulose content and lower hemicellulose content than the control, have potential applications in the forestry industry.

Exogenous GA3 Application Enhances Xylem Development and Induces the Expression of Secondary Wall Biosynthesis Related Genes in Betula platyphylla.

Gibberellin (GA) is a key signal molecule inducing differentiation of tracheary elements, fibers, and xylogenesis. However the molecular mechanisms underlying the effect of GA on xylem elongation and secondary wall development in tree species remain to be determined. In this study, Betula platyphylla (birch) seeds were treated with 300 ppm GA3 and/or 300 ppm paclobutrazol (PAC), seed germination was recorded, and transverse sections of hypocotyls were stained with toluidine blue; the two-month-old seedlings were treated with 50 µM GA3 and/or 50 µM PAC, transverse sections of seedling stems were stained using phloroglucinol-HCl, and secondary wall biosynthesis related genes expression was analyzed by real-time quantitative PCR. Results indicated that germination percentage, energy and time of seeds, hypocotyl height and seedling fresh weight were enhanced by GA3, and reduced by PAC; the xylem development was wider in GA3-treated plants than in the control; the expression of NAC and MYB transcription factors, CESA, PAL, and GA oxidase was up-regulated during GA3 treatment, suggesting their role in GA3-induced xylem development in the birch. Our results suggest that GA3 induces the expression of secondary wall biosynthesis related genes to trigger xylogenesis in the birch plants.

Investigation of single nucleotide polymorphisms based on the intronic sequences of the propylene alcohol dehydrogenase gene in Chinese tobacco genotypes.

A pair of primers was designed to amplify the propylene alcohol dehydrogenase gene sequence based on the cDNA sequence of the tobacco allyl-alcohol dehydrogenase gene. All introns were sequenced using traditional polymerase chain reaction (PCR) methods and T-A cloning. The sequences from common tobacco (Nicotiana tabaccum L.) and rustica tobacco (Nicotiana rustica L.) were analysed between the third intron and the fourth intron of the propylene alcohol dehydrogenase gene. The results showed that the alcohol dehydrogenase gene is a low-copy nuclear gene. The intron sequences have a combination of single nucleotide polymorphisms and length polymorphisms between common tobacco and rustica tobacco, which are suitable to identify the different germplasms. Furthermore, there are some single nucleotide polymorphism sites in the target sequence within common tobacco that can be used to distinguish intraspecific varieties.

Exploration of the Regulatory Pathways and Key Genes Involved in the Response to Saline-Alkali Stress in Betula platyphylla via RNA-Seq Analysis.

The pH of saline-alkali soil is high because of carbonate salts, and the deleterious effects of saline-alkali soil on the growth of plants are greater than those of saline soil. Few studies have examined the saline-alkali tolerance of Betula platyphylla at the molecular level. To clarify the regulatory mechanism underlying saline-alkali tolerance in B. platyphylla, RNA sequencing analysis of B. platyphylla seedlings treated with NaHCO3 was conducted. Differences in gene expression in the roots of B. platyphylla seedlings under saline-alkali stress (induced via NaHCO3) for 3 h and 6 h were characterized, and a total of 595 and 607 alkali stress-responsive genes were identified, respectively. Most differentially expressed genes were involved in stress, signal transduction, secondary metabolic process, regulation of jasmonic acid, and the abiotic stimulus signaling pathway. The single nucleotide polymorphism loci in the differentially expressed genes were associated with the alkaline-salt tolerance in birch germplasm. In addition, birch plants overexpressing WRKY70 and NAC9 were obtained using the A. tumefaciens-mediated transient transformation method, and these two genes were found to play key roles in saline-alkali tolerance. Additional study revealed that WRKY70 and NAC9 can increase resistance to saline-alkali stress by enhancing reactive oxygen species scavenging and inhibiting cell death in birch plants. The results of this study enhance our understanding of the saline-alkali stress tolerance of B. platyphylla at the molecular level, and provide several key genes that could be used in the breeding of birch plants in the future.

Transcriptomic and functional analyses reveal the molecular mechanisms underlying Fe-mediated tobacco resistance to potato virus Y infection.

Potato virus Y (PVY) mainly infects Solanaceous crops, resulting in considerable losses in the yield and quality. Iron (Fe) is involved in various biological processes in plants, but its roles in resistance to PVY infection has not been reported. In this study, foliar application of Fe could effectively inhibit early infection of PVY, and a full-length transcriptome and Illumina RNA sequencing was performed to investigate its modes of action in PVY-infected Nicotiana tabacum. The results showed that 18,074 alternative splicing variants, 3,654 fusion transcripts, 3,086 long non-coding RNAs and 14,403 differentially expressed genes (DEGs) were identified. Specifically, Fe application down-regulated the expression levels of the DEGs related to phospholipid hydrolysis, phospholipid signal, cell wall biosynthesis, transcription factors (TFs) and photosystem I composition, while those involved with photosynthetic electron transport chain (PETC) were up-regulated at 1 day post inoculation (dpi). At 3 dpi, these DEGs related to photosystem II composition, PETC, molecular chaperones, protein degradation and some TFs were up-regulated, while those associated with light-harvesting, phospholipid hydrolysis, cell wall biosynthesis were down-regulated. At 9 dpi, Fe application had little effects on resistance to PVY infection and transcript profiles. Functional analysis of these potentially critical DEGs was thereafter performed using virus-induced gene silencing approaches and the results showed that NbCat-6A positively regulates PVY infection, while the reduced expressions of NbWRKY26, NbnsLTP, NbFAD3 and NbHSP90 significantly promote PVY infection in N. benthamiana. Our results elucidated the regulatory network of Fe-mediated resistance to PVY infection in plants, and the functional candidate genes also provide important theoretical bases to further improve host resistance against PVY infection.

Transcriptome sequencing and functional verification revealed the roles of exogenous magnesium in tobacco anti-PVY infection.

Potato virus Y (PVY) infection causes necrosis and curling of leaves, which seriously affect the yield and quality of Solanaceous crops. The roles of nutrient elements in the regulation of plant resistance to virus infection has been widely reported, while the mechanisms are poorly studied. Previous studies in our laboratory have demonstrated that foliar spraying of MgSO4 could induce Nicotiana tabacum resistance to PVY by increasing the activity of defense-related enzymes. Consistent with the results, we found that exogenous magnesium (Mg) had a certain effect on N. tabacum anti-PVY infection. Meanwhile, Illumina RNA sequencing revealed that Mg induced resistance to PVY infection was mainly by regulating carbohydrate metabolism and transportation, nitrogen metabolism, Ca2+ signal transduction and oxidative phosphorylation. Moreover, we used virus-induced gene silencing assays to verify the function of homologs of five N. tabacum genes involved in above pathways in N. benthamiana. The results showed that NbTPS and NbGBE were conducive to PVY infection, while NbPPases and NbNR were related to resistance to PVY infection. These results suggested a novel strategy for resistance to PVY infection and provided a theoretical basis for virus-resistance breeding.

A novel strategy for improving watermelon resistance to cucumber green mottle mosaic virus by exogenous boron application.

The molecular mode controlling cucumber green mottle mosaic virus (CGMMV)-induced watermelon blood flesh disease (WBFD) is largely unknown. In this study, we have found that application of exogenous boron suppressed CGMMV infection in watermelon fruit and alleviated WBFD symptoms. Our transcriptome analysis showed that the most up-regulated differentially expressed genes (DEGs) were associated with polyamine and auxin biosynthesis, abscisic acid catabolism, defence-related pathways, cell wall modification, and energy and secondary metabolism, while the down-regulated DEGs were mostly involved in ethylene biosynthesis, cell wall catabolism, and plasma membrane functions. Our virus-induced gene silencing results showed that silencing of SPDS expression in watermelon resulted in a higher putrescine content and an inhibited CGMMV infection correlating with no WBFD symptoms. SBT and TUBB1 were also required for CGMMV infection. In contrast, silencing of XTH23 and PE/PEI7 (low-level lignin, cellulose and pectin) and ATPS1 (low-level glutathione) promoted CGMMV accumulation. Furthermore, RAP2-3, MYB6, WRKY12, H2A, and DnaJ11 are likely to participate in host antiviral resistance. In addition, a higher (spermidine + spermine):putrescine ratio, malondialdehyde content, and lactic acid content were responsible for fruit decay and acidification. Our results provide new knowledge on the roles of boron in watermelon resistance to CGMMV-induced WBFD. This new knowledge can be used to design better control methods for CGMMV in the field and to breed CGMMV resistant watermelon and other cucurbit crops.

Regulatory mechanisms of fatty acids biosynthesis in Armeniaca sibirica seed kernel oil at different developmental stages.

Background: Armeniaca sibirica seed kernel oil is rich in oleic acid and linoleic acid, thus holding potential value as a source of high-quality edible oils. However, some regulatory factors involved in fatty acids accumulation in A. sibirica seed kernels remain largely elusive. Thus, the aim of this study was to elucidate the regulatory mechanisms underlying fatty acids biosynthesis in A. sibirica developing seed kernels. Methods: Seed kernels from six plants from a single A. sibirica clone were taken at five different developmental stages (days 30, 41, 52, 63, and 73 after anthesis). Fatty acid composition in seed kernel oil was determined by gas chromatography-mass spectrometry (GC-MS). In addition, transcriptome analysis was conducted using second-generation sequencing (SGS) and single-molecule real-time sequencing (SMRT). Results: Rapid accumulation of fatty acids occurred throughout the different stages of seed kernels development, with oleic acid and linoleic acid as the main fatty acids. A total of 10,024, 9,803, 6,004, 6,719 and 9,688 unigenes were matched in the Nt, Nr, KOG, GO and KEGG databases, respectively. In the category lipid metabolism, 228 differentially expressed genes (DEGs) were annotated into 13 KEGG pathways. Specific unigenes encoding 12 key enzymes related to fatty acids biosynthesis were determined. Co-expression network analysis identified 11 transcription factors (TFs) and 13 long non-coding RNAs (lncRNAs) which putatively participate in the regulation of fatty acid biosynthesis. This study provides insights into the molecular regulatory mechanisms of fatty acids biosynthesis in A. sibirica developing seed kernels, and enabled the identification of novel candidate factors for future improvement of the production and quality of seed kernel oil by breeding.

Reactive oxygen species-related genes participate in resistance to cucumber green mottle mosaic virus infection regulated by boron in Nicotiana benthamiana and watermelon.

Cucumber green mottle mosaic virus (CGMMV) infection causes acidification and rot of watermelon flesh, resulting in serious economic losses. It is widely reported the interaction relationship between boron and reactive oxygen species (ROS) in regulating normal growth and disease resistance in plants. Our previous results demonstrated that exogenous boron could improve watermelon resistance to CGMMV infection. However, the roles of ROS-related genes regulated by boron in resistance to CGMMV infection are unclear. Here, we demonstrated that CGMMV symptoms were alleviated, and viral accumulations were decreased by boron application in Nicotiana benthamiana, indicating that boron contributed to inhibiting CGMMV infection. Meanwhile, we found that a number of differentially expressed genes (DEGs) associated with inositol biosynthesis, ethylene synthesis, Ca2+ signaling transduction and ROS scavenging system were up-regulated, while many DEGs involved in ABA catabolism, GA signal transduction and ascorbic acid metabolism were down-regulated by boron application under CGMMV infection. Additionally, we individually silenced nine ROS-related genes to explore their anti-CGMMV roles using a tobacco rattle virus (TRV) vector. The results showed that NbCat1, NbGME1, NbGGP and NbPrx Q were required for CGMMV infection, while NbGST and NbIPS played roles in resistance to CGMMV infection. The similar results were obtained in watermelon by silencing of ClCat, ClPrx or ClGST expression using a pV190 vector. This study proposed a new strategy for improving plant resistance to CGMMV infection by boron-regulated ROS pathway and provided several target genes for watermelon disease resistance breeding.

The upstream regulatory mechanism of BplMYB46 and the function of upstream regulatory factors that mediate resistance to stress in Betula platyphylla.

Previously, we have shown that the transcription factor BplMYB46 in Betula platyphylla can enhance tolerance to salt and osmotic stress and promote secondary cell wall deposition, and we characterized its downstream regulatory mechanism. However, its upstream regulatory mechanism remains unclear. Here, the promoter activity and upstream regulatory factors of BplMYB46 were studied. Analyses of ß-glucuronidase (GUS) staining and activity indicated that BplMYB46 promoter was specific temporal and spatial expression, and its expression can be induced by salt and osmotic stress. We identified three upstream regulatory factors of BplMYB46: BpDof1, BpWRKY3, and BpbZIP3. Yeast-one hybrid assays, GUS activity, chromatin immunoprecipitation, and quantitative real-time polymerase chain reaction revealed that BpDof1, BpWRKY3, and BpbZIP3 can directly regulate the expression of BplMYB46 by specifically binding to Dof, W-box, and ABRE elements in the BplMYB46 promoter, respectively. BpDof1, BpWRKY3, and BpbZIP3 were all localized to the nucleus, and their expressions can be induced by stress. Overexpression of BpDof1, BpWRKY3, and BpbZIP3 conferred the resistance of transgenic birch plants to salt and osmotic stress. Our findings provide new insights into the upstream regulatory mechanism of BplMYB46 and reveal new upstream regulatory genes that mediate resistance to adverse environments. The genes identified in our study provide novel targets for the breeding of forest tree species.

Suppression of Cucumber Green Mottle Mosaic Virus Infection by Boron Application: From the Perspective of Nutrient Elements and Carbohydrates.

Cucumber green mottle mosaic virus (CGMMV) infection causes "blood flesh" symptoms in watermelon fruits, which severely reduces yield and edibleness. However, the growth of watermelon fruits is strongly associated with boron (B), a trace element for improving fruit quality. In this study, B-gradient hydroponic experiments (B concentration: 0, 2.86, and 5.72 mg·L-1 H3BO3) and foliar-spray experiments (B concentration: 30 and 300 mg·L-1 H3BO3) were performed. We found that the B-supplement could inhibit CGMMV infection and especially relieve "blood flesh" symptoms in watermelon fruits. The nutrient element, soluble sugar, and cell wall polysaccharide contents and their metabolism- and transport-related gene expressions were determined in leaves and fruits of the watermelons in B-gradient hydroponic and foliar-spray experiments. We found that the accumulation and metabolism of nutrients and carbohydrates in cells were disrupted by CGMMV infection; however, the B-supplement could restore and maintain their homeostasis. Additionally, we uncovered that NIP5;1 and SWEET4, induced by B-application with CGMMV infection, could majorly contribute to the resistance to CGMMV infection by regulating nutrient elements and carbohydrate homeostasis. These results provided a novel insight into the molecular mechanism of B-mediated CGMMV suppression and an efficient method of B-application for the improvement of watermelon quality after CGMMV infection.

Genome-wide analysis of BpDof genes and the tolerance to drought stress in birch (Betula platyphylla).

BACKGROUND: DNA binding with one finger (Dof) proteins are plant-specific transcription factors playing vital roles in developmental processes and stress responses in plants. Nevertheless, the characterizations, expression patterns, and functions of the Dof family under drought stress (a key determinant of plant physiology and metabolic homeostasis) in woody plants remain unclear. METHODS: The birch (Betula platyphylla var. mandshuric) genome and plant TFDB database were used to identify Dof gene family members in birch plants. ClustalW2 of BioEdit v7.2.1, MEGA v7.0, ExPASy ProtParam tool, Subloc, TMHMM v2.0, GSDS v2.0, MEME, TBtools, KaKs Calculator v2.0, and PlantCARE were respectively used to align the BpDof sequences, build a phylogenetic tree, identify the physicochemical properties, analyze the chromosomal distribution and synteny, and identify the cis-elements in the promoter regions of the 26 BpDof genes. Additionally, the birch seedlings were exposed to PEG6000-simulated drought stress, and the expression patterns of the BpDof genes in different tissues were analyzed by qRT-PCR. The histochemical staining and the evaluation of physiological indexes were performed to assess the plant tolerance to drought with transient overexpression of BpDof4, BpDof11, and BpDof17 genes. SPSS software and ANOVA were used to conduct all statistical analyses and determine statistically significant differences between results. RESULTS: A total of 26 BpDof genes were identified in birch via whole-genome analysis. The conserved Dof domain with a C(x)2C(x)21C(x)2C zinc finger motif was present in all BpDof proteins. These birch BpDofs were classified into four groups (A to D) according to the phylogenetic analysis of Arabidopsis thaliana Dof genes. BpDof proteins within the same group mostly possessed similar motifs, as detected by conserved motif analysis. The exon-intron analysis revealed that the structures of BpDof genes differed, indicating probable gene gain and lose during the BpDof evolution. The chromosomal distribution and synteny analysis showed that the 26 BpDofs were unevenly distributed on 14 chromosomes, and seven duplication events among six chromosomes were found. Cis-acting elements were abundant in the promoter regions of the 26 BpDof genes. qRT-PCR revealed that the expression of the 26 BpDof genes was differentially regulated by drought stress among roots, stems, and leaves. Most BpDof genes responded to drought stress, and BpDof4, BpDof11, and BpDof17- were significantly up-regulated. Therefore, plants overexpressing these three genes were generated to investigate drought stress tolerance. The BpDof4-, BpDof11-, and BpDof17--overexpressing plants showed promoted reactive oxygen species (ROS) scavenging capabilities and less severe cell damage, suggesting that they conferred enhanced drought tolerance in birch. This study provided an in-depth insight into the structure, evolution, expression, and function of the Dof gene family in plants.

Synthesis and biological evaluation of genistein-O-alkylamine derivatives as potential multifunctional anti-Alzheimer agents.

A series of genistein derivatives were synthesized and evaluated as multifunctional anti-Alzheimer agents. The results showed that these derivatives had significant acetylcholinesterase (AChE) inhibitory activity; compound 5a exhibited the strongest inhibition to AChE with an IC50 value (0.034 µM) much lower than that of rivastigmine (6.53 µM). A Lineweaver-Burk plot and molecular modeling study showed that compound 5a targeted both the catalytic active site and the peripheral anionic site of AChE. These compounds also showed potent peroxy scavenging activity and metal-chelating ability. The compounds did not show obvious effect on HepG2 and PC12 cell viability at the concentration of 100 µM. Therefore, these genistein derivatives can be utilized as multifunctional agents for the treatment of AD.

Development of tacrine-bifendate conjugates with improved cholinesterase inhibitory and pro-cognitive efficacy and reduced hepatotoxicity.

A novel series of tacrine-bifendate (THA-DDB) conjugates (7a-e) were synthesized and evaluated as potential anti-Alzheimer's agents. These compounds showed potent cholinesterase and self-induced ß-amyloid (Aß) aggregation inhibitory activities. A Lineweaver-Burk plot and molecular modeling study showed that these compounds can target both catalytic active site (CAS) and peripheral anionic site (PAS) of acetylcholinesterase (AChE). The cytotoxicity of the conjugate 7d against PC12 and HepG2 cells and hepatotoxicity against human hepatocyte cell line (HL-7702) were found to be considerably less compared to THA. Moreover, treatment with 7d did not exhibit significant hepatotoxicity in mice. Finally, in vivo studies confirmed that 7d significantly ameliorates the cognitive performances of scopolamine-treated ICR mice. Therefore, 7d has high potential for the treatment of Alzheimer's disease and warrants further investigation.