RESUMO
Anaplasma capra is an emerging tickborne human pathogen initially recognized in China in 2015; it has been reported in ticks and in a wide range of domestic and wild animals worldwide. We describe whole-genome sequences of 2 A. capra strains from metagenomic sequencing of purified erythrocytes from infected goats in China. The genome of A. capra was the smallest among members of the genus Anaplasma. The genomes of the 2 A. capra strains contained comparable G+C content and numbers of pseudogenes with intraerythrocytic Anaplasma species. The 2 A. capra strains had 54 unique genes. The prevalence of A. capra was high among goats in the 2 endemic areas. Phylogenetic analyses revealed that the A. capra strains detected in this study were basically classified into 2 subclusters with those previously detected in Asia. Our findings clarify details of the genomic characteristics of A. capra and shed light on its genetic diversity.
Assuntos
Genômica , Cabras , Animais , Humanos , Prevalência , Filogenia , Anaplasma/genética , China/epidemiologiaRESUMO
BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.
Assuntos
Melatonina , Tobamovirus , Reguladores de Crescimento de Plantas , Cisteína , Melatonina/farmacologia , Tobamovirus/genética , Nicotiana/genética , Doenças das Plantas/genéticaRESUMO
A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.
RESUMO
Increasing cashmere yield is one of the important goals of cashmere goat breeding. To achieve this goal, we screened the key genes that can improve cashmere performance. In this study, we used the RNA raw datasets of the skin and dermal papilla cells of secondary hair follicle (SHF-DPCs) samples of hair follicle (HF) anagen and telogen of Albas cashmere goats and identified a set of significant differentially expressed genes (DEGs). To explore potential associations between gene sets and SHF growth features and to identify candidate genes, we detected functional enrichment and constructed protein-protein interaction (PPI) networks. Through comprehensive analysis, we selected Thymosin ß4 (Tß4), Rho GTPase activating protein 6 (ARHGAP6), ADAM metallopeptidase with thrombospondin type 1 motif 15, (ADAMTS15), Chordin (CHRD), and SPARC (Osteonectin), cwcv and kazal-like domains proteoglycan 1 (SPOCK1) as candidate genes. Gene set enrichment analysis (GSEA) for these genes revealed Tß4 and ARHGAP6 have a close association with the growth and development of SHF-DPCs. However, the expression of Tß4 in the anagen was higher than that in the telogen, so we finally chose Tß4 as the ultimate research object. Overexpressing Tß4 promoted and silencing Tß4 inhibited the proliferation of SHF-DPCs. These findings suggest that Tß4 can promote the growth and development of SHF-DPCs and indicate that this molecule may be a valuable target for increasing cashmere production.
Assuntos
Proliferação de Células , Folículo Piloso/metabolismo , Timosina/metabolismo , Animais , Células Cultivadas , Ativação Enzimática , Perfilação da Expressão Gênica , Cabras , Folículo Piloso/citologia , Folículo Piloso/crescimento & desenvolvimento , Timosina/genéticaRESUMO
To investigate the microbial contamination in Chinese herbal decoction pieces with different functional types by studying the total aerobic microbial count (TAMC), and total yeast and mould count (TYMC) in 40 samples of 8 types of root decoction pieces; further evaluate the contamination load of bile-resistant Gram-negative bacteria, and identify the Gram-negative bacteria by using biochemical identification system for Gram-negative bacteria. Our results showed that the TAMC value was more than 1 000 CFUâ¢g⻹ in 85% (34/40) samples, and was more than 100 CFUâ¢g⻹ in 30% (12/40) samples; the contamination of bile-resistant Gram-negative bacteria was detected in 45% (18/40) of the samples. The bile-resistant Gram-negative bacteria load of seven batches of samples was N>1 000 MPNâ¢g⻹. Sixteen bacterium strains including Serratia plymouthensis, Cedecea neteri, Escherichia vulneris, Klebsiella oxytoca, Enterobacter amnigenus, E. cloacae, E. sakazakii, Proteus penneri and E. gergoviae were obtained and identified. E. cloacae was the predominant bacterium that was isolated from Salviae Miltiorrhizae Radix et Rhizoma, while E. amnigenus, Yersinia pseudotuberculosis was the typical bacterium of Ophiopogonis Radix and Codonopsis Radix, respectively. All these suggested that the contamination of bile-resistant Gram-negative bacteria was severe for the root decoction pieces in Wuhan city. Microbial species have certain selection specificity for medicinal ingredients, so the type and limit of control bacteria for detection should be formulated according to the pollution type and quantity of bile-resistant Gram-negative bacteria.
Assuntos
Antibacterianos/farmacologia , Bile , Medicamentos de Ervas Chinesas/farmacologia , Bactérias Gram-Negativas/efeitos dos fármacos , Raízes de Plantas/químicaRESUMO
OBJECTIVE: To investigate the effects of cysteinyl leukotriene (CysLT) receptor agonist leukotriene D4 (LTD4) on proliferation and migration in lung epithelial A549 cells. METHODS: The expression of CysLT1 receptor and CysLT2 receptor was determined by immunofluoresence staining in A549 cells. A549 cells were treated with LTD4 (0.01-100 nmol/L) for 24-72 h. Cell viability was detected by MTT reduction assay. Cell migration was determined by modified scratch and healing model. RESULTS: In A549 cells, CysLT1 receptor and CysLT2 receptor were mainly expressed in the cytoplasm, membrane and few in the nuclei. The treatment of LTD4 (0.01-100 nmol/L) for 24-72 h caused no effect on cell viability (Ps>0.05); when A549 cells were treated with 100 nmol/L LTD4 for 24, 48 and 72 h the cell viability was (103.00±4.46)%ï¼(107.00±9.45)% and (105.00±9.02)% of control, respectively (Ps>0.05). The migration rate of A549 cells after scratching during the first 24 h was markedly greater than that during the second and third 24 h in the same concentration groups; however, no significant difference in migration rate was noticed when the cells were treated with different concentrations of LTD4 (0.01-100 nmol/L)(Ps>0.05). The migration of A549 cells was 1.15-fold, 1.21-fold and 1.06-fold of that of control when the cells were treated with 100 nmol/L LTD4 for 24, 48 and 72 h, respectively (Ps>0.05). CONCLUSION: The proliferation and migration of A549 cells are not changed when treated with 0.01-100 nmol LTD4 for up to 72h.
Assuntos
Células Epiteliais/citologia , Leucotrieno D4/farmacologia , Alvéolos Pulmonares/citologia , Linhagem Celular , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Células Epiteliais/efeitos dos fármacos , HumanosRESUMO
Employing an MS/MS-based molecular networking-guided strategy, three new eudesmane-type sesquiterpenes (1-3) and one undescribed pseudoguaianolide sesquiterpene (8), along with four known eudesmane-type sesquiterpene lactones (4-7) were extracted and purified from the herbs of Carpesium abrotanoides L. Structural elucidation encompassed comprehensive spectroscopic analysis, NMR calculations, DP4+ analysis, and ECD calculations. The cytotoxicity activity of all isolates was evaluated against two human hepatoma carcinoma cells (HepG2 and Hep3B) in vitro. It was demonstrated that compounds 2 and 4 showed moderate cytotoxic against HepG2 and Hep3B cells. Furthermore, all compounds were evaluated for their acetylcholinesterase (AChE) inhibitory activity. Particularly noteworthy is that, in comparison to the positive control, compound 1 demonstrated significant AChE inhibition with an inhibition rate of 77.86%. In addition, the inhibitory mechanism of compound 1 were investigated by in silico docking analyze and molecular dynamic simulation.
Assuntos
Antineoplásicos Fitogênicos , Asteraceae , Inibidores da Colinesterase , Simulação de Acoplamento Molecular , Sesquiterpenos , Humanos , Inibidores da Colinesterase/farmacologia , Inibidores da Colinesterase/isolamento & purificação , Inibidores da Colinesterase/química , Sesquiterpenos/farmacologia , Sesquiterpenos/isolamento & purificação , Sesquiterpenos/química , Estrutura Molecular , Asteraceae/química , Antineoplásicos Fitogênicos/farmacologia , Antineoplásicos Fitogênicos/isolamento & purificação , Compostos Fitoquímicos/farmacologia , Compostos Fitoquímicos/isolamento & purificação , Células Hep G2 , Espectrometria de Massas em Tandem , Linhagem Celular Tumoral , China , Acetilcolinesterase/metabolismoRESUMO
ETHNOPHARMACOLOGICAL RELEVANCE: Flos Chrysanthemi Indici (FCI), the flower of Chrysanthemum Indicum L., is a popular traditional Chinese medicine (TCM) for treatment of inflammatory diseases in China. FCI is also a functional food, and is widely used as herbal tea for clearing heat and detoxicating. AIM OF THE STUDY: To explore quality control markers of FCI based on the optimal harvest period. MATERIALS AND METHODS: First, UPLC-Q-TOF/MS based untargeted metabolomics was applied to explore the chemical profiles of FCIs collected at bud stages (BS), initial stages (IS), full bloom stages (FS) and eventual stages (ES) from eight cultivated regions in China. Subsequently, lipopolysaccharide (LPS)-induced RAW264.7 cell inflammatory model and carrageenan-induced rat paw edema model were used to confirm the anti-inflammatory effect of FCIs collected at IS/FS. Then, UPLC-PDA targeted metabolomics was used to quantitatively analyze 9 constituents with anti-inflammatory activity (7 flavonoids and 2 phenolic acids) changed significantly (VIP > 4) during flowering stages. Finally, ROC curves combined with PCA analysis based on the variation of 9 active constituents in FCIs from different flowering stages were applied to screen the quality markers of FCI. RESULTS: FCIs at IS/FS had almost same chemical characteristics, but quite different from those at BS and ES. A total of 32 constituents in FCIs including flavonoids and phenolic acids were changed during flowering development. Most of the varied constituents had the highest or higher contents at IS/FS compared with those at ES, indicating that the optimal harvest period of FCI should be at IS/FS. FCI extract could effectively suppress nitric oxide (NO) production in LPS-induced RAW264.7 cells and regulate the abnormal levels of cytokines and PGE2 in carrageenan-induced paw edema model rat. The results of quantitatively analysis revealed that the variation trends of phenolic acids and flavonoids in FCIs were different during flowering development, but most of them had higher contents at IS/FS than those at ES in all FCIs collected from eight cultivated regions, except one sample from Anhui. Finally, linarin, luteolin, apigenin and 3,5-dicaffeoylquinic acid were selected as the Q-markers based on the contribution of their AUC values in ROC and clustering of PCA analysis. CONCLUSIONS: Our study demonstrates the optimal harvest period of FCI and specifies the multi-constituents Q-markers of FCI based on the influence of growth progression on the active constituents using untargeted/targeted metabolomics. The findings not only greatly increase the utilization rate of FCI resources and improve quality control of FCI products, but also offer new strategy to identify the Q-markers of FCI.
Assuntos
Anti-Inflamatórios , Chrysanthemum , Edema , Flores , Metabolômica , Controle de Qualidade , Ratos Sprague-Dawley , Animais , Chrysanthemum/química , Camundongos , Metabolômica/métodos , Células RAW 264.7 , Masculino , Edema/tratamento farmacológico , Edema/induzido quimicamente , Anti-Inflamatórios/farmacologia , Ratos , Quimiometria , Carragenina , Extratos Vegetais/farmacologia , Extratos Vegetais/química , Inflamação/tratamento farmacológico , Medicamentos de Ervas Chinesas/farmacologia , Medicamentos de Ervas Chinesas/química , LipopolissacarídeosRESUMO
OBJECTIVE: The pathogenesis of diarrhea-predominant irritable bowel syndrome (IBS-D) is related to damage to the intestinal mucosal barrier function. Based on the Mast cell (MC)/Tryptase/Protease-activated receptor-2 (PAR-2)/Myosin light chain kinase (MLCK) pathway, this study explored the effect of electroacupuncture (EA) on IBS-D rats and its possible mechanism of protecting the intestinal mucosal barrier. METHODS: The IBS-D rat model was established by mother-offspring separation, acetic acid enema, and chronic restraint stress. The efficacy of EA on IBS-D rats was evaluated by observing the rate of loose stool (LSP) and the minimum volume threshold of abdominal withdrawal reflex (AWR) in rats. Mast cells and the ultrastructure of intestinal mucosa were observed by H&E staining, toluidine blue staining, and transmission electron microscopy. The expression levels of Tryptase, PAR-2, MLCK, zonula occludens-1 (ZO-1), and Occludin in rats were detected by ELISA, qRT-PCR, and western blot. RESULTS: After 7 days of intervention, compared to the IBS-D group, the loose stool rates of rats in IBS-D + EA group and IBS-D + ketotifen group were decreased (P < 0.01), the minimum volume thresholds of AWR were improved (P < 0.01), the inflammation of colon tissue decreased, the number of MCs were decreased (P < 0.01), the expression of Tryptase, PAR-2, and MLCK were lowered (P < 0.01, P < 0.05), and the expression of ZO-1 and Occludin were enhanced (P < 0.01, P < 0.05). Compared to the EA group, there was no significant difference in each index between the ketotifen groups (P > 0.05). CONCLUSION: EA has a good therapeutic effect on IBS-D rats. Regulating the MCs/Tryptase/PAR-2/MLCK pathway may be a mechanism to protect the intestinal mucosal barrier.
RESUMO
BACKGROUND: Haemaphysalis concinna, carrying multiple pathogens, has attracted increasing attention because of its expanded geographical range and significant role in disease transmission. This study aimed to identify the potential public health risks posed by H. concinna and H. concinna-associated pathogens. METHODS: A comprehensive database integrating a field survey, literature review, reference book, and relevant websites was developed. The geographical distribution of H. concinna and its associated pathogens was illustrated using ArcGIS. Meta-analysis was performed to estimate the prevalence of H. concinna-associated microbes. Phylogenetic and geographical methods were used to investigate the role of birds in the transmission of H. concinna-associated microbes. The potential global distribution of H. concinna was predicted by ecological niche modeling. RESULTS: Haemaphysalis concinna was distributed in 34 countries across the Eurasian continent, predominantly in China, Russia, and Central Europe. The tick species carried at least 40 human pathogens, including six species in the Anaplasmataceae family, five species of Babesia, four genospecies in the complex Borrelia burgdorferi sensu lato, ten species of spotted fever group rickettsiae, ten species of viruses, as well as Francisella, Coxiella, and other bacteria. Haemaphysalis concinna could parasitize 119 host species, with nearly half of them being birds, which played a crucial role in the long-distance transmission of tick-borne microbes. Our predictive modeling suggested that H. concinna could potentially survive in regions where the tick has never been previously recorded such as central North America, southern South America, southeast Oceania, and southern Africa. CONCLUSIONS: Our study revealed the wide distribution, broad host range, and pathogen diversity of H. concinna. Authorities, healthcare professionals, and the entire community should address the growing threat of H. concinna and associated pathogens. Tick monitoring and control, pathogen identification, diagnostic tools, and continuous research should be enhanced.
Assuntos
Babesia , Ixodes , Carrapatos , Animais , Europa (Continente) , Ixodidae/microbiologia , Filogenia , Carrapatos/microbiologiaRESUMO
The emergence of Anaplasma bovis or A. bovis-like infection in humans from China and the United States of America has raised concern about the public health importance of this pathogen. Although A. bovis has been detected in a wide range of ticks and mammals in the world, no genome of the pathogen is available up to now, which has prohibited us from better understanding the genetic basis for its pathogenicity. Here we describe an A. bovis genome from metagenomic sequencing of an infected goat in China. Anaplasma bovis had the smallest genome of the genus Anaplasma, and relatively lower GC content. Phylogenetic analysis of single-copy orthologue sequence showed that A. bovis was closely related to A. platys and A. phagocytophilum, but relatively far from intraerythrocytic Anaplasma species. Anaplasma bovis had 116 unique orthogroups and lacked 51 orthogroups in comparison to other Anaplasma species. The virulence factors of A. bovis were significantly less than those of A. phagocytophilum, suggesting less pathogenicity of A. bovis. When tested by specific PCR assays, A. bovis was detected in 23 of 29 goats, with an infection rate up to 79.3% (95% CI: 64.6% â¼94.1%). The phylogenetic analyses based on partial 16S rRNA, gltA and groEL genes indicated that A. bovis had high genetic diversity. The findings of this study lay a foundation for further understanding of the biological characteristics and genetic diversity of A. bovis, and will facilitate the formulation of prevention and control strategies.
Assuntos
Anaplasma , Genômica , Humanos , Animais , Filogenia , RNA Ribossômico 16S/genética , Anaplasma/genética , China/epidemiologia , Cabras , Variação GenéticaRESUMO
The continual emergence of tick-borne rickettsioses has garnered widespread global attention. Candidatus Rickettsia barbariae (Candidatus R. barbariae), which emerged in Italy in 2008, has been detected in humans from northwestern China. However, the lack of Candidatus R. barbariae genome and isolated strains limits the understanding of its biological characteristics and genomic features. Here, we isolated the Rickettsia for the first time from eggs of Rhipicephalus turanicus in northwestern China, and assembled its whole genome after next-generation sequencing, so we modified the proposed name to Rickettsia barbariae (R. barbariae) to conform to the International Code of Nomenclature of Prokaryotes. Phylogenetic analysis based on the whole genome revealed that it was most closely related to the pathogenic Rickettsia parkeri and Rickettsia africae. All virulence factors, present in the pathogenic spotted fever group rickettsiae, were identified in the R. barbariae isolate. These findings highlight the pathogenic potential of R. barbariae and the necessity for enhanced surveillance of the emerging Rickettsia in the human population.
Assuntos
Genoma Bacteriano , Filogenia , Rickettsia , Rickettsia/genética , Rickettsia/isolamento & purificação , Rickettsia/classificação , Animais , China , Rhipicephalus/microbiologia , Humanos , Infecções por Rickettsia/microbiologia , Fatores de Virulência/genética , Genômica , Sequenciamento de Nucleotídeos em Larga Escala , Sequenciamento Completo do Genoma , Óvulo/microbiologiaRESUMO
Soft ticks (Ixodida: Argasidae) are ectoparasites of terrestrial vertebrates with worldwide distributions. As one representative group of Argasidae, the genus Argas has an important vectorial role in transmitting zoonotic diseases. However, our knowledge of the subgenus Argas in China is still limited, as most literature only lists occurrence records or describes specific case reports without providing detailed morphological characteristics and further molecular data. This study aims to characterize Argas vulgaris through complete mitochondrial sequencing and morphological diagnostic techniques based on a batch of adult specimens collected from Ningxia Hui Autonomous Regions (NXHAR), North China. The morphology and microstructures of Ar. vulgaris and other lectotypes of argasid ticks in the subgenus Argas were also observed using a stereomicroscope. Following DNA extraction and sequencing, a complete mitochondrial sequence of Ar. vulgaris was assembled and analyzed within a phylogenetic context. The 14,479 bp mitogenome of Ar. vulgaris consists of 37 genes, including 13 genes for protein coding, two for ribosomal RNA, 22 for transfer RNA, and one for control region (D-loops). Phylogenetic analysis of Ar. vulgaris showed 98.27%-100% nucleotide identity with Ar. japonicus, indicating a close relationship between the two tick species. The morphological diagnostic features to differentiate Ar. vulgaris from other ticks within the subgenus Argas included the location of the anus and setae on the anterior lip of the female genital aperture. This study provided high-resolution scanning electron microscope images of female Ar. vulgaris and corresponding molecular data, representing valuable resources for future accurate species identification.
RESUMO
BACKGROUND: Haemaphysalis longicornis is drawing attentions for its geographic invasion, extending population, and emerging disease threat. However, there are still substantial gaps in our knowledge of viral composition in relation to genetic diversity of H. longicornis and ecological factors, which are important for us to understand interactions between virus and vector, as well as between vector and ecological elements. RESULTS: We conducted the meta-transcriptomic sequencing of 136 pools of H. longicornis and identified 508 RNA viruses of 48 viral species, 22 of which have never been reported. Phylogenetic analysis of mitochondrion sequences divided the ticks into two genetic clades, each of which was geographically clustered and significantly associated with ecological factors, including altitude, precipitation, and normalized difference vegetation index. The two clades showed significant difference in virome diversity and shared about one fifth number of viral species that might have evolved to "generalists." Notably, Bandavirus dabieense, the pathogen of severe fever with thrombocytopenia syndrome was only detected in ticks of clade 1, and half number of clade 2-specific viruses were aquatic-animal-associated. CONCLUSIONS: These findings highlight that the virome diversity is shaped by internal genetic evolution and external ecological landscape of H. longicornis and provide the new foundation for promoting the studies on virus-vector-ecology interaction and eventually for evaluating the risk of H. longicornis for transmitting the viruses to humans and animals. Video Abstract.
Assuntos
Ixodidae , Phlebovirus , Carrapatos , Animais , Humanos , Ixodidae/genética , Haemaphysalis longicornis , Viroma/genética , Filogenia , Phlebovirus/genéticaRESUMO
The movement protein (MP) and coat protein (CP) of tobamoviruses play critical roles in viral cell-to-cell and long-distance movement, respectively. Cucumber green mottle mosaic virus (CGMMV) is a member of the genus Tobamovirus. The functions of CGMMV MP and CP during viral infection remain largely unclear. Here, we show that CGMMV MP can interact with CP in vivo, and the amino acids at positions 79-128 in MP are vital for the MP-CP interaction. To confirm this finding, we mutated five conserved residues within the residue 79-128 region and six other conserved residues flanking this region, followed by in vivo interaction assays. The results showed that the conserved threonine residue at the position 107 in MP (MPT107 ) is important for the MP-CP interaction. Substitution of T107 with alanine (MPT107A ) delayed CGMMV systemic infection in Nicotiana benthamiana plants, but increased CGMMV local accumulation. Substitutions of another 10 conserved residues, not responsible for the MP-CP interaction, with alanine inhibited or abolished CGMMV systemic infection, suggesting that these 10 conserved residues are possibly required for the MP movement function through a CP-independent manner. Moreover, two movement function-associated point mutants (MPF17A and MPD97A ) failed to cause systemic infection in plants without impacting on the MP-CP interaction. Furthermore, we have found that co-expression of CGMMV MP and CP increased CP accumulation independent of the interaction. MP and CP interaction inhibits the salicylic acid-associated defence response at an early infection stage. Taken together, we propose that the suppression of host antiviral defence through the MP-CP interaction facilitates virus systemic infection.
Assuntos
Tobamovirus , Proteínas do Capsídeo/genética , Nicotiana , Doenças das PlantasRESUMO
Numerous randomised controlled trials have suggested the positive effects of acupuncture on chronic obstructive pulmonary disease (COPD). However, the underlying therapeutic mechanisms of acupuncture for COPD have not been clearly summarized yet. Inflammation is central to the development of COPD. In this review, we elucidate the effects and underlying mechanisms of acupuncture from an anti-inflammatory perspective based on animal studies. Cigarette smoke combined with lipopolysaccharide is often used to establish animal models of COPD. Electroacupuncture can be an effective intervention to improve inflammation in COPD, and Feishu (BL13) and Zusanli (ST36) can be used as basic acupoints in COPD animal models. Different acupuncture types can regulate different types of inflammatory cytokines; meanwhile, different acupuncture types and acupoint options have similar effects on modulating the level of inflammatory cytokines. In particular, acupuncture exerts anti-inflammatory effects by inhibiting the release of inflammatory cells, inflammasomes and inflammatory cytokines. The main underlying mechanism through which acupuncture improves inflammation in COPD is the modulation of relevant signalling pathways: nuclear factor-κB (NF-κB) (e.g., myeloid differentiation primary response 88/NF-κB, toll-like receptor-4/NF-κB, silent information regulator transcript-1/NF-κB), mitogen-activated protein kinase signalling pathways (extracellular signal-regulated kinase 1/2, p38 and c-Jun NH2-terminal kinase), cholinergic anti-inflammatory pathway, and dopamine D2 receptor pathway. The current synthesis will be beneficial for further research on the effect of acupuncture on COPD inflammation. Please cite this article as: Jiang LH, Li PJ, Wang YQ, Jiang ML, Han XY, Bao YD, Deng XL, Wu WB, Liu XD. Anti-inflammatory effects of acupuncture in the treatment of chronic obstructive pulmonary disease. J Integr Med. 2023; 21(6): 518-527.
Assuntos
Terapia por Acupuntura , Doença Pulmonar Obstrutiva Crônica , Animais , NF-kappa B/metabolismo , Doença Pulmonar Obstrutiva Crônica/tratamento farmacológico , Citocinas , Modelos Animais de Doenças , Inflamação/terapiaRESUMO
Theileria, a tick-borne intracellular protozoan, can cause infections of various livestock and wildlife around the world, posing a threat to veterinary health. Although more and more Theileria species have been identified, genomes have been available only from four Theileria species to date. Here, we assembled a whole genome of Theileria luwenshuni, an emerging Theileria, through next-generation sequencing of purified erythrocytes from the blood of a naturally infected goat. We designated it T. luwenshuni str. Cheeloo because its genome was assembled by the researchers at Cheeloo College of Medicine, Shandong University, China. The genome of T. lunwenshuni str. Cheeloo was the smallest in comparison with the other four Theileria species. T. luwenshuni str. Cheeloo possessed the fewest gene gains and gene family expansion. The protein count of each category was always comparable between T. luwenshuni str. Cheeloo and T. orientalis str. Shintoku in the Eukaryote Orthologs annotation, though there were remarkable differences in genome size. T. luwenshuni str. Cheeloo had lower counts than the other four Theileria species in most categories at level 3 of Gene Ontology annotation. Kyoto Encyclopedia of Genes and Genomes annotation revealed a loss of the c-Myb in T. luwenshuni str. Cheeloo. The infection rate of T. luwenshuni str. Cheeloo was up to 81.5% in a total of 54 goats from three flocks. The phylogenetic analyses based on both 18S rRNA and cox1 genes indicated that T. luwenshuni had relatively low diversity. The first characterization of the T. luwenshuni genome will promote better understanding of the emerging Theileria. IMPORTANCE Theileria has led to substantial economic losses in animal husbandry. Whole-genome sequencing data of the genus Theileria are currently limited, which has prohibited us from further understanding their molecular features. This work depicted whole-genome sequences of T. luwenshuni str. Cheeloo, an emerging Theileria species, and reported a high prevalence of T. luwenshuni str. Cheeloo infection in goats. The first assembly and characterization of T. luwenshuni genome will benefit exploring the infective and pathogenic mechanisms of the emerging Theileria to provide scientific basis for future control strategies of theileriosis.
Assuntos
Theileria , Theileriose , Animais , Bovinos , Theileria/genética , Filogenia , Cabras , GenômicaRESUMO
This study demonstrates a new approach for the selective recognition of chiral mandelic acid by quartz crystal microbalance (QCM) using L-cysteine as the selector. The modification of L-cysteine on the QCM sensor was identified using resonant frequency detection, the contact angle, cyclic voltammetry, and X-ray photoelectron spectroscopy measurements. The chiral recognizability of L- and D-MA on the L-cysteine-modified surface was examined using QCM detection integrated with a vapor diffused molecular assembly reaction technique. The present chiral recognition results suggest that the L-cysteine is a good resolving agent for detecting chiral mandelic acid.
Assuntos
Cisteína/química , Ácidos Mandélicos/química , Eletrodos , Espectroscopia Fotoeletrônica , Quartzo , EstereoisomerismoRESUMO
Since porcine reproductive and respiratory syndrome virus (PRRSV) was first described in China in 1996, several genetically distinct strains of PRRSV have emerged with varying pathogenicity and severity, thereby making the prevention and control of PRRS more difficult in China and worldwide. Between 2017 and 2021, the detection rate of NADC34-like strain in China increased. To date, NADC34-like strains have spread to 10 Chinese provinces and have thus developed different degrees of pathogenicity and mortality. In this review, we summarize the history of NADC34-like strains in China and clarify the prevalence, genomic characteristics, restriction fragment length polymorphisms, recombination, pathogenicity, and vaccine status of this strain in China. In so doing, this study aims to provide a basis for the further development of prevention and control measures targeting the NADC34-like strain.
RESUMO
BACKGROUND: Pemetrexed plus platinum doublet chemotherapy regimen remains to be the standard first-line treatment for lung adenocarcinoma patients. However, few biomarkers can be used to identify potential beneficiaries with maximal efficacy and minimal toxicity. This study aimed to explore potential biomarker models predictive of efficacy and toxicity after pemetrexed plus platinum chemotherapy based on metabolomics profiling. METHODS: A total of 144 patients who received at least two cycles of pemetrexed plus platinum chemotherapy were enroled in the study. Serum samples were collected before initial treatment to perform metabolomics profiling analysis. Logistic regression analysis was performed to establish prediction models. RESULTS: 157 metabolites were found to be differentially expressed between the response group and the nonresponse group. A panel of Phosphatidylserine 20:4/20:1, Sphingomyelin d18:1/18:0, and Phosphatidic Acid 18:1/20:0 could predict pemetrexed and platinum chemotherapy response with an Area Under the Receiver Operating Characteristic curve (AUROC) of 0.7968. 76 metabolites were associated with hematological toxicity of pemetrexed plus platinum chemotherapy. A panel incorporating triglyceride 14:0/22:3/22:5, 3-(3-Hydroxyphenyl) Propionate Acid, and Carnitine C18:0 was the best predictive ability of hematological toxicity with an AUROC of 0.7954. 54 differential expressed metabolites were found to be associated with hepatotoxicity of pemetrexed plus platinum chemotherapy. A model incorporating stearidonic acid, Thromboxane B3, l-Homocitrulline, and phosphoinositide 20:3/18:0 showed the best predictive ability of hepatotoxicity with an AUROC of 0.8186. CONCLUSIONS: This study established effective and convenient models that can predict the efficacy and toxicity of pemetrexed plus platinum chemotherapy in lung adenocarcinoma patients before treatment delivery.