Expression of an alcohol dehydrogenase gene in a heterotrophic bacterium induces carbon dioxide-dependent high-yield growth under oligotrophic conditions.

Sphingobium japonicum strain UT26, whose γ-hexachlorocyclohexane-degrading ability has been studied in detail, is a typical aerobic and heterotrophic bacterium that needs organic carbon sources for its growth, and cannot grow on a minimal salt agar medium prepared without adding any organic carbon sources. Here, we isolated a mutant of UT26 with the ability to grow to visible state on such an oligotrophic medium from a transposon-induced mutant library. This high-yield growth under oligotrophic conditions (HYGO) phenotype was CO2-dependent and accompanied with CO2 incorporation. In the HYGO mutant, a transposon was inserted just upstream of the putative Zn-dependent alcohol dehydrogenase (ADH) gene (adhX) so that the adhX gene was constitutively expressed, probably by the transposon-derived promoter. The adhX-deletion mutant (UT26DAX) harbouring a plasmid carrying the adhX gene under the control of a constitutive promoter exhibited the HYGO phenotype. Moreover, the HYGO mutants spontaneously emerged among the UT26-derived hypermutator strain cells, and adhX was highly expressed in these HYGO mutants, while no HYGO mutant appeared among UT26DAX-derived hypermutator strain cells, indicating the necessity of adhX for the HYGO phenotype. His-tagged AdhX that was expressed in Escherichia coli and purified to homogeneity showed ADH activity towards methanol and other alcohols. Mutagenesis analysis of the adhX gene indicated a correlation between the ADH activity and the HYGO phenotype. These results demonstrated that the constitutive expression of an adhX-encoding protein with ADH activity in UT26 leads to the CO2-dependent HYGO phenotype. Identical or nearly identical adhX orthologues were found in other sphingomonad strains, and most of them were located on plasmids, suggesting that the adhX-mediated HYGO phenotype may be an important adaptation strategy to oligotrophic environments among sphingomonads.

Establishment of a novel cell line, CHO-MK, derived from Chinese hamster ovary tissues for biologics manufacturing.

Chinese hamster ovary (CHO) cells are widely used as a host for producing recombinant therapeutic proteins due to advantages such as human-like post-translational modification, correct protein folding, higher productivity, and a proven track record in biopharmaceutical development. Much effort has been made to improve the process of recombinant protein production, in terms of its yield and productivity, using conventional CHO cell lines. However, to the best of our knowledge, no attempts have been made to acquire new CHO cell lines from Chinese hamster ovary. In this study, we established and characterized a novel CHO cell line, named CHO-MK, derived from freshly isolated Chinese hamster ovary tissues. Some immortalized cell lines were established via sub-culture derived from primary culture, one of which was selected for further development toward a unique expression system design. After adapting serum-free and suspension culture conditions, the resulting cell line exhibited a considerably shorter doubling time (approximately 10 h) than conventional CHO cell lines (approximately 20 h). Model monoclonal antibody (IgG1)-producing cells were generated, and the IgG1 concentration of fed-batch culture reached approximately 5 g/L on day 8 in a 200-L bioreactor. The cell bank of CHO-MK cells was prepared as a new host and assessed for contamination by adventitious agents, with the results indicating that it was free from any such contaminants, including infectious viruses. Taking these findings together, this study showed the potential of CHO-MK cells with a shorter doubling time/process time and enhanced productivity in biologics manufacturing.

Novel class of mutations of pilS mutants, encoding plasmid R64 type IV prepilin: interface of PilS-PilV interactions.

The type IV pili of plasmid R64 belonging to the type IVB group are required only for liquid mating. They consist of the major and minor components PilS pilin and PilV adhesin, respectively. PilS pilin is first synthesized as a 22-kDa prepilin from the pilS gene and is then processed to a 19-kDa mature pilin by PilU prepilin peptidase. In a previous genetic analysis, we identified four classes of the pilS mutants (T. Horiuchi and T. Komano, J. Bacteriol. 180:4613-4620, 1998). The products of the class I pilS mutants were not processed by prepilin peptidase; the products of the class II mutants were not secreted; in the class III mutants type IV pili with reduced activities in liquid mating were produced; and in the class IV mutants type IV pili with normal activities were produced. Here, we describe a novel class, class V, of pilS mutants. Mutations in the pilS gene at Gly-56 or Tyr-57 produced type IV pili lacking PilV adhesin, which were inactive in liquid mating. Residues 56 and 57 of PilS pilin are suggested to function as an interface of PilS-PilV interactions.

Glass microchip with three-dimensional microchannel network for 2 x 2 parallel synthesis.

An integrated multireactor system for 2 x 2 parallel organic synthesis has been developed on a single glass microchip. Three-dimensional channel circuits in the chip were fabricated by laminating three glass plate layers. The fabrication method is a straightforward extension of the conventional one, and topological equivalence for any three-dimensional circuits can be constructed easily with it. 2 x 2 phase-transfer amide formation reactions, which constitute a simple model for combinatorial synthesis, were successfully carried out on the microchip, and the integrity of the three-dimensional circuits was confirmed. Combinatorial chemistry with multi-microreactors, in conjunction with a high-throughput screening method based on micro-TAS technologies, is expected to provide an efficient tool for drug discovery.

Drosophila lola encodes a family of BTB-transcription regulators with highly variable C-terminal domains containing zinc finger motifs.

Alternative splicing is an important mechanism contributing to the increased proteome diversity in higher eukaryotes. We have explored the alternative splicing events in the Drosophila longitudinals lacking (lola) gene by means of 5' RACE, 3' RACE, genome sequence searches, and EST sequencing. We demonstrated that the lola locus is comprised of 32 exons spanning over 60 kb, and encodes a total of 80 alternatively spliced variants consisting of 5' and 3' variable sequences and constitutive common exons. All the variants shared a common sequence (exons 5-8) encoding the N-terminal region containing the BTB domain, but both the 5' and 3' ends were variable. There were four promoters responsible for the variation in the 5' end (exons 1-4). Alternative splicing was involved in the variation in the 3' end corresponding to the C-terminal variable region, which was encoded by one or two exons that were selected from 20 groups of exons in a mutually exclusive manner (exons 9-32). Seventeen of the 20 isoforms contained C(2)H(2)-like zinc finger motifs in the C-terminal variable region. Analyses of the 3' variant-specific cDNA pools revealed that all combinations of 5' and 3' variable sequences were expressed in both the embryonic and third instar larval stages. Since the BTB domain mediates dimerization, lola encodes a family of transcription regulators with a large variety of DNA- or protein-binding specificities, and could be involved in various developmental processes, including the embryonic neural pathfindings. We also showed that the structures of Lola isoforms were highly conserved in Drosophila pseudoobscura.

Whole-Genome Profiling of a Novel Mutagenesis Technique Using Proofreading-Deficient DNA Polymerase δ.

A novel mutagenesis technique using error-prone DNA polymerase δ (polδ), the disparity mutagenesis model of evolution, has been successfully employed to generate novel microorganism strains with desired traits. However, little else is known about the spectra of mutagenic effects caused by disparity mutagenesis. We evaluated and compared the performance of the polδMKII mutator, which expresses the proofreading-deficient and low-fidelity polδ, in Saccharomyces cerevisiae haploid strain with that of the commonly used chemical mutagen ethyl methanesulfonate (EMS). This mutator strain possesses exogenous mutant polδ supplied from a plasmid, tthereby leaving the genomic one intact. We measured the mutation rate achieved by each mutagen and performed high-throughput next generation sequencing to analyze the genome-wide mutation spectra produced by the 2 mutagenesis methods. The mutation frequency of the mutator was approximately 7 times higher than that of EMS. Our analysis confirmed the strong G/C to A/T transition bias of EMS, whereas we found that the mutator mainly produces transversions, giving rise to more diverse amino acid substitution patterns. Our present study demonstrated that the polδMKII mutator is a useful and efficient method for rapid strain improvement based on in vivo mutagenesis.

Detection of cationic guest molecules by quenching of luminescence of a self-assembled host molecule consisting of terbium(III) and calix[4]arene-p-tetrasulfonates.

By self-assembly in aqueous solution, calix- (CAS) and thiacalix[4]arene-p-tetrasulfonate (TCAS) formed luminescent complexes Tb(III).(CAS)2 and Tb(III).TCAS, respectively, which were utilized as a host for cationic guests. Addition of 1-ethylpyridinium guest quenched luminescence of Tb(III).(CAS)2 in accordance with the Stern-Volmer (SV) relation with a low detection limit (D.L.) of 5.94 x 10(-8) M (S/N=3, M identical with mol dm(-3)). On the other hand, 1-ethylquinolinium quenched luminescence of Tb(III).TCAS most efficiently, affording a very low D.L. (6.71 x 10(-10) M). The agreement of the SV coefficients obtained with luminescent intensity (K(SV,all)=6.74 x 10(6) M(-1)) and lifetime (K(SV,Tb)=6.50 x 10(6) M(-1)) implied that dynamic quenching of 5D4 excited state of Tb(III) was predominant in the quenching processes. The quenching rate was estimated to be k(q,Tb)=9.94 x 10(9) M(-1) s(-1), which was as fast as diffusion-limited rate. Quenching of Tb(III).(CAS)2 was also applied to detection of NAD+, with a D.L. of 2.78 x 10(-7) M.

Exceptionally long-lived luminescence emitted from Tb(III) ion caged in an Ag(I)-Tb(III)-thiacalix[4]arene supramolecular complex in water.

The compositions and photophysical properties of luminescent ternary complexes of thiacalix[4]arene-p-sulfonate (TCAS), Tb(III), and Ag(I) ions were determined. At pH 6, Ag(I) (2)Tb(III) (2)TCAS(2) formed. Moreover, at pH 10, in the presence of a 20-fold excess of Ag(I) and a 50-fold excess of TCAS with respect to Tb(III), Ag(I) (2)Tb(III)TCAS(2) formed as the main luminescent species. The structure of these complexes was proposed: two TCAS ligands are linked by two S-Ag(I)-S linkages to adopt a double-cone supramolecular structure. Furthermore, each Tb(III) ion in the former complex accepts O(-), S, O(-) donation, whereas in the latter, the Tb(III) center accepts eightfold O(-) donation. The luminescence quantum yield (Phi) of Ag(I) (2)Tb(III) (2)TCAS(2) (0.16) was almost equal to that of Tb(III)TCAS, but the luminescence lifetime tau of the former (=1.09 ms) was larger than that of the latter. For Ag(I) (2)Tb(III)TCAS(2), the yield Phi (=0.11) was small, which is attributed to the low efficiency of photosensitization (eta=0.11). However, the tau value (4.61 ms) was exceptionally large and almost equal to the natural luminescence lifetime of Tb(III) (4.7 ms), which is due to the absence of coordinating water molecules (q=0.1). This is compatible with the proposed structure in which the Tb(III) ion is shielded by a supramolecular cage that expels coordinated water molecules responsible for luminescence quenching.

Alternative trans-splicing: a novel mode of pre-mRNA processing.

Alternative splicing is an important process contributing to proteome diversity without involving an increase in the number of genes. In some cases, alternative splicing is carried out under 'trans-mode', called alternative trans-splicing, in which exons located on separate pre-mRNA molecules are selectively joined to produce mature mRNAs encoding proteins with distinct structures and functions. However, it is not known how widespread or how frequently trans-splicing occurs in vivo. Recently, trans-allelic trans-splicing has been unambiguously demonstrated in Drosophila using a SNP (single nucleotide polymorphism) as a marker. In this review, we provide an overview of alternative trans-splicing in Drosophila and mammals, and discuss its mechanisms.

Alternative trans-splicing of constant and variable exons of a Drosophila axon guidance gene, lola.

longitudinals lacking (lola) is a complex Drosophila gene encoding at least 20 protein isoforms,each bearing the same N-terminal constant region linked to a different C-terminal variable region. Different isoforms specify different aspects of axon growth and guidance. We show here that lola mRNAs are generated by alternative trans-splicing of exons sequentially encoded by the same DNA strand. Chromosomal pairing facilitates interallelic trans-splicing,allowing complementation between mutations in the constant and those in the variable exons. We demonstrate that at least one variable exon is transcribed from its own promoter,and trans-spliced to the constant exons transcribed separately.

Regulation of FRUA expression during vegetative growth and development of Myxococcus xanthus.

Expression of the fruA gene, encoding a putative transcription factor essential for fruiting body formation of Myxococcus xanthus, is specifically activated during development. In the present study, we have analyzed the mechanism of the transcriptional regulation of fruA expression. From gel retardation and footprinting assays using various fruA regulatory regions as probes and competitors, a protein designated factor X was found to specifically bind to a sequence (xbs) located downstream of the transcription-initiation site (+78 to +94) of the fruA gene. Factor X activity was present during vegetative growth and decreased during early development. Analysis of promoter activities of various segments of the fruA regulatory region using the lacZ reporter gene in vivo indicated that a DNA segment extending 45-bp upstream from the transcription-initiation site was required for developmentally regulated fruA expression at a low level. In addition, cis-acting regulatory regions located upstream and downstream of the fruA promoter region and including C-box and xbs, were found to be involved in regulation of fruA expression during development. When inserted into the vegA gene, the xbs element inhibited vegA expression during vegetative growth. Together with previously reported results, our studies reveal that fruA expression is regulated by both positive and negative mechanisms during the M. xanthus life cycle.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.