ExcA proteins of IncI1 plasmid R64 and IncIγ plasmid R621a recognize different segments of their cognate TraY proteins in entry exclusion.

Entry exclusion is a process whereby plasmid transfer between donor and recipient cells harboring identical or closely related conjugative plasmids is inhibited. Exclusion proteins in the recipient cells are responsible for entry exclusion. Although IncI1 Plasmid R64 and IncIγ plasmid R621a exhibit similar genome structure in replication, transfer, and leading regions, they belong to different incompatibility and exclusion groups. The amino acid sequences of TraY and ExcA proteins are significantly different between R64 and R621a. In the present study, TraY proteins of R64 and R621a were exchanged. Transfer of R64 derivative carrying R621a TraY was inhibited by recipient R621a ExcA but not R64 ExcA and transfer of R621a derivative carrying R64 TraY was inhibited by recipient R64 ExcA but not R621a ExcA. This indicates that R64 and R621a TraY proteins in the donor cells are the targets of cognate ExcA proteins in the recipient proteins. Since two segments, an internal and a C-terminal segment, were found to vary between R64 and R621a TraY proteins, various chimera TraY proteins were constructed. Conjugation experiments suggested that the R64 internal variable segment recognizes R64 ExcA protein and the R621a C-terminal variable segment recognizes R621a ExcA protein.

Identification of IAA transport inhibitors including compounds affecting cellular PIN trafficking by two chemical screening approaches using maize coleoptile systems.

The monocot coleoptile tip region has been generally supposed to be the source of IAA to supply IAA to basal parts by the polar IAA transport system, which results in gravi- and phototropic curvature of coleoptiles. Based on this IAA transport system and gravitropism of maize coleoptiles, we have developed two screening methods to identify small molecules from a large chemical library that inhibit IAA transport. The methods detect molecules that affect (i) gravitropic curvature of coleoptiles; and (ii) the amount of IAA transported from the tip. From 10,000 chemicals, eight compounds were identified and categorized into two groups. Four chemicals in group A decreased IAA transport from the tip, and increased endogenous IAA levels in the tip. The structures of two compounds resembled that of 1-N-naphthylphthalamic acid (NPA), but those of the other two differed from structures of known IAA transport inhibitors. Four chemicals in group B strongly inhibited IAA transport from the tip, but IAA levels at the tip were only slightly affected. At higher concentrations, group B compounds inhibited germination of Arabidopsis, similarly to brefeldin A (BFA). Analysis of the cellular distribution of PIN2-green fluorescent protein (GFP) and PIN1-GFP in Arabidopsis revealed that one of the four chemicals in group B induced internalization of PIN1 and PIN2 proteins into vesicles smaller than BFA bodies, suggesting that this compound affects cellular vesicle trafficking systems related to PIN trafficking. The eight chemicals identified here will be a useful tool for understanding the mechanisms of IAA transport in plants.

RSOsPR10 expression in response to environmental stresses is regulated antagonistically by jasmonate/ethylene and salicylic acid signaling pathways in rice roots.

Plant roots play important roles not only in the absorption of water and nutrients, but also in stress tolerance. Previously, we identified RSOsPR10 as a root-specific pathogenesis-related (PR) protein induced by drought and salt treatments in rice. Transcripts and proteins of RSOsPR10 were strongly induced by jasmonate (JA) and the ethylene (ET) precursor 1-aminocyclopropane-1-carboxylic acid (ACC), while salicylic acid (SA) almost completely suppressed these inductions. Immunohistochemical analyses showed that RSOsPR10 strongly accumulated in cortex cells surrounding the vascular system of roots, and this accumulation was also suppressed when SA was applied simultaneously with stress or hormone treatments. In the JA-deficient mutant hebiba, RSOsPR10 expression was up-regulated by NaCl, wounding, drought and exogenous application of JA. This suggested the involvement of a signal transduction pathway that integrates JA and ET signals in plant defense responses. Expression of OsERF1, a transcription factor in the JA/ET pathway, was induced earlier than that of RSOsPR10 after salt, JA and ACC treatments. Simultaneous SA treatment strongly inhibited the induction of RSOsPR10 expression and, to a lesser extent, induction of OsERF1 expression. These results suggest that JA/ET and SA pathways function in the stress-responsive induction of RSOsPR10, and that OsERF1 may be one of the transcriptional factors in the JA/ET pathway.

The genome sequence of the incompatibility group Iγ plasmid R621a: evolution of IncI plasmids.

We present the complete genome sequence of the tetracycline resistance plasmid R621a isolated from Salmonella typhimurium, which belongs to the incompatibility group Iγ. In the 93,185bp circular double-stranded R621a genome, 96 complete ORFs are predicted. In addition, one and six different kinds of proteins are produced by translational reinitiation and shufflon multiple inversions, respectively. The genome consists of four regions: replication, leading, transfer, and miscellaneous regions. The R621a genome is similar to those of IncI1 plasmids such as R64 and ColIb-P9 and particularly to those of pEK204 and pEC_Bactec. Three major differences including inc, parAB, and excA regions were noted between R621a and prototype IncI1 plasmids. Seven nucleotide replacements and one nucleotide deletion in the putative Inc RNA sequence are found between R621a and IncI1 plasmids irrespective of close similarity in the other parts of the rep system. The sequences of R621a parAB and excA genes are significantly different from those of R64 and ColIb-P9, while those of R621a parAB and excA genes exhibit close similarity to those of pEK204 and pEC_Bactec, respectively. The R621a genome is suggested to be formed by acquiring parAB and excA genes from pEK204 and pEC_Bactec genomes, respectively, and then novel inc function by the mutations. The insertions in the R621a, pEK204, and pEC_Bactec genomes are flanked by direct repeats, suggesting that insertions accompanied by long target duplications have also played an important role in the evolution of IncI plasmids.

Complete genome sequence of the incompatibility group I1 plasmid R64.

A streptomycin and tetracycline resistance plasmid R64 isolated from Salmonella enterica serovar Typhimurium belongs to the incompatibility group I1 (IncI1). The DNA sequence of the R64 conjugative transfer region was described previously (Komano et al., 2000). Here, we report the complete genome sequence of R64. In the circular double-stranded R64 genome with 120,826bp, 126 complete ORFs are predicted. In addition, 2 and 6 different kinds of proteins are produced by translational reinitiation and shufflon multiple inversions, respectively. The genome consists of five major regions: replication, drug resistance, stability, transfer leading, and conjugative transfer regions in clockwise order. The nucleotide sequence essential for autonomous replication of R64 is completely identical to that of IncI1 colicinogenic plasmid ColIb-P9, an indication that these two plasmids share the same mechanisms for replication and copy number control. Tetracycline and streptomycin resistance genes are encoded in transposons Tn10 and Tn6082, respectively. These transposons and two insertion elements, IS2 and IS1133, were inserted stepwise into the arsenic-resistant gene, arsA1, present in the drug resistance region. The stability and transfer leading regions contain various important genes such as parAB, resD, ardA, psiAB, or ssb for plasmid maintenance, recombination and transfer reactions. When the genome of R64 was compared with those of other plasmids, varying levels of similarity were observed. It is suggested that genetic recombinations including the site-specific rfsF-ResD system have played an important role in diversity of genomes related to R64. It was found that R64 exhibits highly organized genome structure.

Novel class of mutations of pilS mutants, encoding plasmid R64 type IV prepilin: interface of PilS-PilV interactions.

The type IV pili of plasmid R64 belonging to the type IVB group are required only for liquid mating. They consist of the major and minor components PilS pilin and PilV adhesin, respectively. PilS pilin is first synthesized as a 22-kDa prepilin from the pilS gene and is then processed to a 19-kDa mature pilin by PilU prepilin peptidase. In a previous genetic analysis, we identified four classes of the pilS mutants (T. Horiuchi and T. Komano, J. Bacteriol. 180:4613-4620, 1998). The products of the class I pilS mutants were not processed by prepilin peptidase; the products of the class II mutants were not secreted; in the class III mutants type IV pili with reduced activities in liquid mating were produced; and in the class IV mutants type IV pili with normal activities were produced. Here, we describe a novel class, class V, of pilS mutants. Mutations in the pilS gene at Gly-56 or Tyr-57 produced type IV pili lacking PilV adhesin, which were inactive in liquid mating. Residues 56 and 57 of PilS pilin are suggested to function as an interface of PilS-PilV interactions.

PilV adhesins of plasmid R64 thin pili specifically bind to the lipopolysaccharides of recipient cells.

IncI1 plasmid R64 encodes type IV pili or thin pili, which contain PilV adhesins. The C-terminal segments of PilV adhesins are exchanged into seven types by shufflon multiple DNA inversion. PilV adhesins determine recipient specificity in R64 liquid matings through the recognition of lipopolysaccharides (LPSs) on the surface of recipient cells. Using various waa mutants of Escherichia coli R1 as recipient cells, liquid mating experiments suggest that PilVA adhesin recognizes the GlcNAc(beta1-3)Glc moiety of E.coli R1 type LPS. The direct binding of PilV adhesins to LPSs of the recipient bacterial strains was demonstrated using filter overlay assays. The specificity of PilV-LPS binding is in close agreement with the recipient specificity determined by R64 liquid matings. The C-terminal segments of PilVA, PilVC, PilVC', and PilVD' adhesins were expressed as fusion proteins with glutathione-S-transferase (GST). GST-A, GST-C, GST-C', and GST-D' proteins bound to their respective LPSs with the specificities identical with those determined in the R64 liquid matings, indicating that the C-terminal segments of PilV adhesins bind to specific moieties of LPS molecules.

Sequence-specific and non-specific binding of the Rci protein to the asymmetric recombination sites of the R64 shufflon.

Specific cleavages within the shufflon-specific recombination site of plasmid R64 were detected by primer extension when a DNA fragment carrying the recombination site was incubated with the shufflon-specific Rci recombinase. Rci-dependent cleavages occurred in the form of a 5' protruding 7 bp staggered cut, suggesting that DNA cleavage and rejoining in the shufflon system take place at these positions. As a result, shufflon crossover sites were designated as sfx sequences consisting of a central 7 bp spacer sequence, and left and right 12 bp arms. R64 sfx sequences are unique among various site-specific recombination sites, since only the spacer sequence and the right arm sequence are conserved among various R64 sfxs, whereas the left arm sequence is not conserved and is not related to the right arm sequence. From nuclease protection analyses, Rci protein was shown to bind to entire R64 and artificial sfx sequences, suggesting that one Rci molecule binds to the conserved sfx right arm in a sequence-specific manner and the second to the sfx left arm in a non-specific manner. The sfx left arm sequences as well as the right arm sequences were shown to determine affinity to Rci and subsequently inversion frequency. Asymmetry of the sfx sequence may be the reason why Rci protein acts only on the inverted sfx sequences.

Structural basis of the role of the NikA ribbon-helix-helix domain in initiating bacterial conjugation.

Conjugation is a fundamental process for the rapid evolution of bacteria, enabling them, for example, to adapt to various environmental conditions or to acquire multi-drug resistance. NikA is one of the relaxosomal proteins that initiate the intercellular transfer of the R64 conjugative plasmid with the P-type origin of transfer, oriT. The three-dimensional structure of the N-terminal 51 residue fragment of NikA, NikA(1-51), which binds to the 17-bp repeat A sequence in R64 oriT, was determined by NMR to be a homodimer composed of two identical ribbon-helix-helix (RHH) domains, which are commonly found in transcriptional repressors. The structure determination of NikA(1-51) was achieved using automated NOE assignment with CYANA, without measuring filtered NOESY experiments to distinguish between the intra- and intermolecular NOEs, and without any a priori assumption on the tertiary or quaternary structure of the protein. Mutational experiments revealed that the DNA-binding region of the NikA(1-51) dimer is an anti-parallel beta-sheet composed of one beta-strand from each of the N-terminal ends of the two domains. Various biochemical experiments have indicated that the full length NikA(1-109) exists as a homotetramer formed through an alpha-helical domain at the C-terminus, and that the anti-parallel beta-sheets of both dimeric domains bind to two homologous 5 bp internal repeats within repeat A. As a tetramer, the full length NikA(1-109) showed higher affinity to repeat A and bent the oriT duplex more strongly than NikA(1-51) did. Many RHH proteins are involved in specific DNA recognition and in protein-protein interactions. The discovery of the RHH fold in NikA suggests that NikA binds to oriT and interacts with the relaxase, NikB, which is unable to bind to the nick region in oriT without NikA.

Asymmetry of shufflon-specific recombination sites in plasmid R64 inhibits recombination between direct sfx sequences.

The shufflon of plasmid R64 consists of four DNA segments separated and flanked by seven sfx recombination sites. Rci-mediated recombination between any inverted sfx sequences causes inversion of the DNA segments independently or in groups. The R64 shufflon selects one of seven pilV genes encoding type IV pilus adhesins, in which the N-terminal region is constant, while the C-terminal regions are variable. The R64 sfx sequences are asymmetric. The sfx central region and right arm sequences are conserved, but left arm sequences are not. Here we constructed a symmetric sfx sequence, in which the sfx left arm sequence was changed to the inverted repeat of the right arm sequence and made artificial shufflon segments carrying symmetric sfx sequences in inverted or direct orientations. The symmetric sfx sequence exhibited the highest inversion frequency in a shufflon segment flanked by two inverted sfx sequences. Rci-dependent deletion of a shufflon segment flanked by two direct symmetric sfx sequences was observed, suggesting that asymmetry of R64 sfx sequences inhibits recombination between direct sfx sequences. In addition, intermolecular recombination between symmetric sfx sequences was also observed. The extra C-terminal domain of Rci was shown to be essential for inversion of the R64 shufflon using asymmetric sfx sequences but not essential for recombination using symmetric sfx sequences, suggesting that the Rci C-terminal segment helps the binding of Rci to asymmetric sfx sequences. Rci protein lacking the C-terminal domain bound to both arms of symmetric sfx sequence but only to the right arm of asymmetric sfx sequence.

OspE2 of Shigella sonnei is required for the maintenance of cell architecture of bacterium-infected cells.

The OspE2 product of Shigella spp., the expression of which is regulated by the mxiE gene, is secreted through a type III secretion system into host cells. We investigated the function of OspE2 of Shigella sonnei by using cultured epithelial cells. Cells invaded by an ospE2 deletion mutant altered their morphology into the rounding shape, which was not due to cell death, whereas cells invaded by the wild-type strain kept their cell shape intact. The ospE2 mutation did not affect initial cell entry and multiplication in cells, but the mutant formed smaller-than-normal plaques on cell monolayers, indicating a deficiency in cell-to-cell spread by the bacteria. An mxiE deletion mutant also showed changes in cell morphology and deficiency in bacterial spread to adjacent cells. In cells invaded by the ospE2 mutant, disturbance of actin stress fibers was prominent at 3 h after invasion. Analysis of OspE2 localization indicated that the OspE2 protein accumulated on focal contact-like structures in the infected host cells. These results suggest that colocalization of the OspE2 protein in the focal contacts of infected cells may function to maintain an intact cell morphology. The morphological change induced by invasion of the ospE2 mutant may affect secondary bacterial transmission.

The IntP C-terminal segment is not required for excision of bacteriophage Mx8 from the Myxococcus xanthus chromosome.

During lysogenization of myxophage Mx8, phage DNA can be integrated into the attB site of the Myxococcus xanthus chromosome through site-specific recombination. We previously demonstrated that the Mx8 attP site is located within the coding sequence of the Mx8 intP gene. Hence, the integration of Mx8 into the M. xanthus chromosome results in the conversion of the 112-amino-acid C-terminal segment of the IntP protein into a 13-amino-acid C-terminal segment of a new protein, IntR. To examine whether IntR is active for Mx8 excision, we have constructed a series of plasmids carrying various lengths of the intP-attP or intR-attR regions as well as the lacZ gene. The integrated Mx8 was excised at a high frequency, indicating that IntR is active for the excision. For Mx8 excision, a gene designated xis was shown to be required in addition to intR.

NikAB- or NikB-dependent intracellular recombination between tandemly repeated oriT sequences of plasmid R64 in plasmid or single-stranded phage vectors.

The origin of transfer (oriT) of a bacterial plasmid plays a key role in both the initiation and termination of conjugative DNA transfer. We have previously shown that a conjugation-dependent recombination between the tandem R64 oriT sequences cloned into pHSG398 occurred, resulting in the deletion of the intervening sequence during DNA transfer. In this study, we tandemly cloned two oriT sequences of IncI1 plasmid R64 into pUC18. Specific recombination between the two oriT sequences in pUC18 was observed within Escherichia coli cells harboring mini-R64. This recombination was found to be independent of both the recA gene and conjugative DNA transfer. The R64 genes nikA and nikB, required for conjugal DNA processing, were essential for this recombination. Although a fully active 92-bp oriT sequence was required at one site for the recombination, the 44-bp oriT core sequence was sufficient at the other site. Furthermore, when two oriT sequences were tandemly cloned into the single-stranded phage vector M13 and propagated within E. coli cells, recombination between the two oriT sequences was observed, depending on the nikB gene. These results suggest that the R64 relaxase protein NikB can execute cleavage and rejoining of single-stranded oriT DNA within E. coli cells, whereas such a reaction in double-stranded oriT DNA requires collaboration of the two relaxosome proteins, NikA and NikB.

Thin pilus PilV adhesins of plasmid R64 recognize specific structures of the lipopolysaccharide molecules of recipient cells.

IncI1 plasmid R64 encodes a type IV pilus called a thin pilus, which includes PilV adhesins. Seven different sequences for the C-terminal segments of PilV adhesins can be produced by shufflon DNA rearrangement. The expression of the seven PilV adhesins determines the recipient specificity in liquid matings of plasmid R64. Salmonella enterica serovar Typhimurium LT2 was recognized by the PilVA' and PilVB' adhesins, while Escherichia coli K-12 was recognized by the PilVA', PilVC, and PilVC' adhesins. Lipopolysaccharide (LPS) on the surfaces of recipient cells was previously shown to be the specific receptor for the seven PilV adhesins. To identify the specific receptor structures of LPS for various PilV adhesins, R64 liquid matings were carried out with recipient cells consisting of various S. enterica serovar Typhimurium LT2 and E. coli K-12 waa mutants and their derivatives carrying various waa genes of different origins. From the mating experiments, including inhibition experiments, we propose that the GlcNAc(alpha1-2)Glc and Glc(alpha1-2)Gal structures of the LPS core of S. enterica serovar Typhimurium LT2 function as receptors for the PilVB' and PilVC' adhesins, respectively, while the PilVC' receptor in the wild-type LT2 LPS core may be masked. We further propose that the GlcNAc(beta1-7)Hep and Glc(alpha1-2)Glc structures of the LPS core of E. coli K-12 function as receptors for the PilVC and PilVC' adhesins, respectively.

Analysis of fruE, a novel developmental gene of Myxococcus xanthus.

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, a TnV insertion developmental mutation, Omega773, of M. xanthus was analyzed. The TnV Omega773 insertion was found to be located within a novel developmental gene, fruE. The FruE protein is composed of 140 amino acid residues and bears an N-terminal signal peptide. The amino acid sequence of FruE shared no significant similarity with any other known protein in the databases. The fruE mutant displayed a development-delayed phenotype. The formation of tightly aggregated mounds in the fruE mutant was slower than that in the wild-type strain. The initiation of spore production in the fruE mutant was delayed by 12 h in comparison to the wild-type strain, and the process of spore formation was more asynchronous than that of the wild-type strain. The transcription initiation sites of the fruE gene were located 81 bp (P1) and 57 bp (P2) upstream of the fruE initiation codon. Although both promoters were active during vegetative growth and development, the P1 promoter was more active during development and the P2 promoter was more active during vegetative growth. The expression of the fruE gene increased to a peak at 6 h poststarvation and then decreased. The decrease in fruE expression was not observed in the D and E signal mutants.

Genes required for plasmid R64 thin-pilus biogenesis: identification and localization of products of the pilK, pilM, pilO, pilP, pilR, and pilT genes.

We have previously shown that the pilL, pilN, pilQ, pilS, pilU, and pilV genes of plasmid R64 encode outer membrane lipoprotein, secretin, cytoplasmic ATPase, major pilin, prepilin peptidase, and minor pilin, respectively, which are required for thin-pilus formation. In this work, we characterized the products of the remaining essential genes, pilK, pilM, pilO, pilP, pilR, and pilT, with regard to their localization and processing. Overexpression systems containing pilM, pilO, and pilP genes fused with N-terminal glutathione S-transferase (GST) or a His tag were constructed. Overproduced proteins were purified and used to raise specific antibodies. Localization of PilM, PilO, and PilP proteins was performed by Western blot analysis with anti-GST-PilM, anti-PilO, and anti-PilP antibodies, respectively. The pilK, pilR, and pilT products were produced with a C-terminal His tag and then detected by anti-His tag antibody. Subcellular fractionation experiments with Escherichia coli cells producing R64 thin pili revealed that PilK, PilM, and PilR are inner membrane proteins, and PilP and PilT are periplasmic proteins. PilO protein was localized to the outer membrane in the presence of other Pil proteins, whereas it was localized to the cytoplasm in the absence of these proteins. Furthermore, the cleavage site of PilP protein was determined by N-terminal amino acid sequencing of purified mature PilP protein. We predict that PilK, PilM, PilO, PilP, and PilT proteins function as the components of the pilin transport apparatus and thin-pilus basal body.

Novel developmental genes, fruCD, of Myxococcus xanthus: involvement of a cell division protein in multicellular development.

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development.

Regulation of FRUA expression during vegetative growth and development of Myxococcus xanthus.

Expression of the fruA gene, encoding a putative transcription factor essential for fruiting body formation of Myxococcus xanthus, is specifically activated during development. In the present study, we have analyzed the mechanism of the transcriptional regulation of fruA expression. From gel retardation and footprinting assays using various fruA regulatory regions as probes and competitors, a protein designated factor X was found to specifically bind to a sequence (xbs) located downstream of the transcription-initiation site (+78 to +94) of the fruA gene. Factor X activity was present during vegetative growth and decreased during early development. Analysis of promoter activities of various segments of the fruA regulatory region using the lacZ reporter gene in vivo indicated that a DNA segment extending 45-bp upstream from the transcription-initiation site was required for developmentally regulated fruA expression at a low level. In addition, cis-acting regulatory regions located upstream and downstream of the fruA promoter region and including C-box and xbs, were found to be involved in regulation of fruA expression during development. When inserted into the vegA gene, the xbs element inhibited vegA expression during vegetative growth. Together with previously reported results, our studies reveal that fruA expression is regulated by both positive and negative mechanisms during the M. xanthus life cycle.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Structure and function of the shufflon in plasmid R64.

Conservative site-specific recombination plays key roles in creating biological diversity in prokaryotes. Most site-specific inversion systems consist of two recombination sites and a recombinase gene. In contrast, the shufflon multiple inversion system of plasmid R64 consists of seven sfx recombination sites, which separate four invertible DNA segments, and the rci gene encoding a site-specific recombinase of the integrase family. The rci product mediates recombination between any two inverted sfx sites, resulting in the inversion of four DNA segments independently or in groups. Random shufflon inversions construct seven pilV genes encoding constant N-terminal segment with different C-terminal segments. The pilV products are tip-located adhesins of the type IV pilus, called the thin pilus, of R64 and recognize lipopolysaccharides of recipient bacterial cells during R64 liquid matings. Thus, the shufflon determines the recipient specificity of liquid matings. Rci protein of R64 was overexpressed, purified, and used for in vitro recombination reactions. The cleavage and rejoining of DNA strands in shufflon recombinations were found to take place in the form of a 5' protruding 7-bp staggered cut within sfx sequences. Thus, the sfx sequence is asymmetric: only the 7-bp spacer sequence and the right arm sequence are conserved among various R64 sfxs, whereas the sfx left arm sequences are not conserved. Rci protein was shown to bind to entire sfx sequences, suggesting that it binds to the right arms of the sfx sequences in a sequence-specific manner and to their left arms in a non-sequence-specific manner. The sfx left arm sequences greatly affected the shufflon inversion frequency. The artificial symmetric sfx sequence, in which the sfx left arm was changed to the inverted repeat sequence of the right arm, exhibited the highest inversion frequency. Rci-dependent deletion of a DNA segment flanked by two symmetric sfx sequences in direct orientation was observed, suggesting that the asymmetry of sfx sequences may prevent recombination between sfx sequences in direct orientation in the R64 shufflon. The Rci C-terminal domain was not required for recombination using the symmetric sfx sequence. A model, where the C-terminal domain of Rci protein plays a key role in the sequence-specific and non-specific binding of Rci to asymmetric sfx sites, was proposed. Site-specific recombination in the temperate phage Mx8 of M. xanthus was also described. The Mx8 attP site is located within the coding sequence of the Mx8 intP gene. Therefore, the integration of Mx8 into the M. xanthus chromosome results in the conversion of the intP gene into a new gene, intR. As a result of this conversion, the 112-amino-acid C-terminal sequence of the intP product is replaced with a 13-amino acid sequence of the intR product. The C-terminal domain of Mx8 IntP recombinase is only required for integration and not for excision.