Impedance-based detection of DNA sequences using a silicon transducer with PNA as the probe layer.

Electrochemical impedance measurements were used for the detection of single-strand DNA sequences using a peptide nucleic acid (PNA) probe layer immobilized onto Si/SiO2 chips. An epoxysilane layer is first immobilized onto the Si/SiO2 surface. The immobilization procedure consists of an epoxide/amine coupling reaction between the amino group of the PNA linker and the epoxide group of the silane. A 20-nucleotide sequence of PNA was used. Impedance measurements allow for the detection of the changes in charge distribution at the oxide/solution interface following modifications to the oxide surface. Due to these modifications, there are significant shifts in the semiconductor's flat-band potential after immobilization and hybridization. The results obtained using this direct and rapid approach are supported by fluorescence measurements according to classical methods for the detection of nucleic acid sequences.

Immobilization of homooligonucleotide probe layers onto Si/SiO(2) substrates: characterization by electrochemical impedance measurements and radiolabelling.

Radiolabelling and electrochemical impedance measurements were used to characterize the immobilization of single stranded homooligonucleotides onto silica surfaces and their subsequent hybridization with complementary strands. The immobilization procedure consists of grafting an epoxysilane onto microelectronic grade Si/SiO(2) substrates, and coupling oligonucleotides bearing a hexylamine linker onto the epoxy moiety. Radiolabelling was used as a reference method to quantify the amount of immobilized and hybridized oligonucleotides. These results show that the Si/SiO(2) substrates modified with an epoxysilane yield a surface concentration of approximately 10(11) strands/cm(2) for the immobilized oligonucleotides, after vigorous washings, and that approximately 36% of these undergo hybridization with complementary strands. The impedance measurements, which provide a direct means of detecting variations in electrical charge accumulation across the semiconductor/oxide/electrolyte structure when the oxide surface is chemically modified, show that the semiconductor's flat band potential undergoes reproducible shifts of -150 and -100 mV following the immobilization and the hybridization step, respectively. These results demonstrate that electrochemical impedance measurements using chemically modified semiconductor/oxide/electrolyte structures of this type offer a viable alternative for the direct detection of complementary DNA strands upon hybridization.

DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences.

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.

DNA immobilization onto electrochemically functionalized Si(100) surfaces.

N-type Si(100) surfaces were modified by reduction of 4-nitrobenzenediazonium through cyclic voltammetry. Contact mode AFM was employed to produce holes in the deposited layers and cross-sectional profiles were obtained to determine their thicknesses. Layer thickness was found to increase with the number of cyclic potential scans in both aqueous and non-aqueous media. In acetonitrile, the single scan thickness was determined to be approximately 15nm, whereas for three scans the layer thickness was found to be approximately 35nm. These thicknesses were also measured and confirmed by ellipsometry. Both thicknesses are indicative of multilayer formation on the silicon surface. Layers formed in acetonitrile were more uniform and of better quality (without holes), compared to those prepared in water. This type of functionalized surface, after further cyclic voltammetric reduction of the nitro groups and treatment with glutaraldehyde, was then used to immobilize single strand DNA-C(6)H(12)NH(2) probe sequences for hybridization with complementary DNA sequences. Fluorescein-labeled probe and target oligonucleotide sequences were used to validate the immobilization of the probe layer and hybridization with the complementary sequence. No binding was observed when using a non-complementary sequence as probe.

Impedance based DNA chip for direct T(m) measurement.

Si/SiO(2) chips were used to detect the hybridization of immobilized Oligo d(T)(20) through impedance measurement. The immobilization procedure involved an aminopropyl silane grafted silicon oxide surface activated by glutaraldehyde and subsequently modified by an aminolinker supporting oligonucleotides. The immobilization procedure was optimized and, in the best conditions, the hybridization of the immobilized oligonucleotide was able to generate a 50 Omega impedance change at an applied dc potential of -300 mV. The optimized DNA sensor was then used to directly determine the immobilized oligonucleotide T(m) via impedance measurement in a continuous temperature control flow system. A reproducible and specific 65 Omega impedance change was observed at 32 degrees C with a step duration as low as 15 min. This value compared well with the 31.4 degrees C theoretical value calculated from the sequence base pair composition and length.

Effect of steroid hormones on sulfated oviductal glycoprotein secretion by oviductal explants in vitro.

Explants of rabbit ampullary and isthmic tissue were cultured 4 days with and without exogenous steroids, and the sulfated oviductal glycoprotein (SOG) concentration in the explant culture supernatants was determined. Tissues cultured with progesterone plus estrogen secreted significantly more SOG than control tissues, whereas tissues cultured with estrogen alone did not. Ampullary tissues cultured with progesterone plus estrogen secreted significantly more SOG than control tissues on Days 2 and 3, whereas SOG secretion by isthmic tissues was significantly above control secretion on Day 4. Ampullary and isthmic tissues differed significantly in their secretory capacity. Maximum ampullary SOG secretion was approximately 650 ng SOG/mg tissue/day. Maximum isthmic SOG secretion was approximately 30 ng SOG/mg tissue/day. These findings suggest that the oviduct is composed of discrete functional regions that provide support to gametes and developing embryos through the unique secretory characteristics of each region.

Sulfated oviductal glycoproteins in the rabbit: quantitation by competitive enzyme-linked immunosorbent assay.

The rabbit oviductal epithelium synthesizes and secretes a family of antigenically related, sulfated oviductal glycoproteins (SOG). Anti-SOG monoclonal antibodies (Mabs) were produced and two (Mab 1 and Mab 2) were selected for further characterization. Periodate oxidation of Western blots of oviductal fluid did not affect the binding of Mab 1 or Mab 2, thus suggesting that these antibodies recognized protein rather than carbohydrate epitopes on SOG. The specificity of Mab 1 was determined by Western blot analysis of tissues obtained from estrous rabbits and from the male rabbit reproductive tract. SOG was identified in tissue extracts of both the oviductal ampulla and isthmus. Cervix was the only non-oviductal tissue with which Mab 1 cross-reacted. Mab 1 was used to isolated SOG from whole oviductal fluid by immuno-affinity chromatography. Affinity-purified SOG and Mab 1 were used to develop a quantitative, SOG-specific, competitive enzyme-linked immunosorbent assay. This assay was used to quantify SOG in rabbit oviductal fluid collected during estrus and pseudopregnancy. SOG secretion during pseudopregnancy was resolved into two transient episodes of increased secretion. Maximum SOG secretion (X = 1039 +/- 199 micrograms/day) occurred within 48 h of the induction of pseudopregnancy. A second period of enhanced SOG secretion (X = 308 +/- 46 micrograms/day) occurred during the fifth and sixth days of pseudopregnancy. Baseline SOG secretion occurred during estrus at approximately 60% of maximum postovulatory secretion.