Finite-Entanglement Scaling of 2D Metals.

We extend the study of finite-entanglement scaling from one-dimensional gapless models to two-dimensional systems with a Fermi surface. In particular, we show that the entanglement entropy of a contractible spatial region with linear size L scales as S∼Llog[ξf(L/ξ)] in the optimal tensor network, and hence area-law entangled, state approximation to a metallic state, where f(x) is a scaling function which depends on the shape of the Fermi surface and ξ is a finite correlation length induced by the restricted entanglement. Crucially, the scaling regime can be realized with numerically tractable bond dimensions. We also discuss the implications of the Lieb-Schultz-Mattis theorem at fractional filling for tensor network state approximations of metallic states.

Impaired primordial follicle assembly in offspring ovaries from zearalenone-exposed mothers involves reduced mitochondrial activity and altered epigenetics in oocytes.

Previous works have shown that zearalenone (ZEA), as an estrogenic pollutant, has adverse effects on mammalian folliculogenesis. In the present study, we found that prolonged exposure of female mice to ZEA around the end of pregnancy caused severe impairment of primordial follicle formation in the ovaries of newborn mice and altered the expression of many genes in oocytes as revealed by single-cell RNA sequencing (scRNA-seq). These changes were associated with morphological and molecular alterations of mitochondria, increased autophagic markers in oocytes, and epigenetic changes in the ovaries of newborn mice from ZEA-exposed mothers. The latter increased expression of HDAC2 deacetylases was leading to decreased levels of H3K9ac and H4K12ac. Most of these modifications were relieved when the expression of  Hdac2 in newborn ovaries was reduced by RNA interference during in vitro culture in the presence of ZEA. Such changes were also alleviated in offspring ovaries from mothers treated with both ZEA and the coenzyme Q10 (CoQ10), which is known to be able to restore mitochondrial activities. We concluded that impaired mitochondrial activities in oocytes caused by ZEA are at the origin of metabolic alterations that modify the expression of genes controlling autophagy and primordial follicle assembly through changes in epigenetic histones.

[Effects of Rehmanniae Radix and Rehmanniae Radix Praeparata on proteomics and autophagy in mice with type 2 diabetes mellitus induced by high-fat diet coupled with streptozotocin].

To compare the pancreatic proteomics and autophagy between Rehmanniae Radix-and Rehmanniae Radix Praeparata-treated mice with type 2 diabetes mellitus(T2DM). The T2DM mouse model was established by high-fat diet coupled with streptozotocin(STZ, intraperitoneal injection, 100 mg·kg~(-1), once a day for three consecutive days). The mice were then randomly assigned into a control group, low-(5 g·kg~(-1)) and high-dose(15 g·kg~(-1)) Rehmanniae Radix groups, low-(150 mg·kg~(-1)) and high-dose(300 mg·kg~(-1)) catalpol groups, low-(5 g·kg~(-1)) and high-dose(15 g·kg~(-1)) Rehmanniae Radix Praeparata groups, low-(150 mg·kg~(-1)) and high-dose(300 mg·kg~(-1)) 5-hydroxymethyl furfuraldehyde(5-HMF) groups, and a metformin(250 mg·kg~(-1)) group. In addition, a normal group was also set and each group included 8 mice. The pancreas was collected after four weeks of administration and proteomics tools were employed to study the effects of Rehmanniae Radix and Rehmanniae Radix Praeparata on protein expression in the pancreas of T2DM mice. The expression levels of proteins involved in autophagy, inflammation, and oxidative stress response in the pancreatic tissues of T2DM mice were determined by western blotting, immunohistochemical assay, and transmission electron microscopy. The results showed that the differential proteins between the model group and Rehmanniae Radix/Rehmanniae Radix Prae-parata group were enriched in 7 KEGG pathways, such as autophagy-animal, which indicated that the 7 pathways may be associated with T2DM. Compared with the control group, drug administration significantly up-regulated the expression levels of beclin1 and phosphorylated mammalian target of rapamycin(p-mTOR)/mTOR and down-regulated those of the inflammation indicators, Toll-like receptor-4(TLR4) and Nod-like receptor protein 3(NLRP3), in the pancreas of T2DM mice, and Rehmanniae Radix showed better performance. In addition, the expression levels of inducible nitric oxide synthase(iNOS), nuclear factor erythroid 2-related factor 2(Nrf2), and heine oxygenase-1(HO-1) in the pancreas of T2DM mice were down-regulated after drug administration, and Rehmanniae Radix Praeparata demonstrated better performance. The results indicate that both Rehmanniae Radix and Rehmanniae Radix Praeparata can alleviate the inflammatory symptoms, reduce oxidative stress response, and increase the autophagy level in the pancreas of T2DM mice, while they exert the effect on different autophagy pathways.

Analysis of Sheep and Goat IAPP Provides Insight into IAPP Amyloidogenicity and Cytotoxicity.

Human islet amyloid polypeptide (hIAPP) plays a role in glucose regulation but forms pancreatic amyloid deposits in type 2 diabetes, and that process contributes to ß-cell dysfunction. Not all species develop diabetes, and not all secrete an IAPP that is amyloidogenic in vitro under normal conditions, a perfect correlation currently exists between both. Studies of IAPPs from such organisms can provide clues about the high amyloidogenicity of hIAPP and can inform the design of soluble analogues of hIAPP. Sheep and goat IAPP are among the most divergent from hIAPP, with 13 and 11 substitutions, respectively, including an unusual Tyr to His substitution at the C-terminus. The properties of sheep and goat IAPP were examined in solution and in the presence of anionic vesicles, resulting in no observed amyloid formation, even at increased concentrations. Furthermore, both peptides are considerably less toxic to cultured ß-cells than hIAPP. The effect of the Y37H replacements was studied in the context of hIAPP, as was a Y37R substitution. Buffer- and salt-dependent effects were observed. There was little impact on the time to form amyloid in phosphate-buffered saline; however, a significant deceleration was observed in Tris buffer, and amyloid formation was slower in the absence of added salt. The Y37H substitution had little impact on toxicity, while the Y37R replacement led to a 30% decrease in toxicity compared with that of hIAPP. The implications for the amyloidogenicity of hIAPP and the design of soluble analogues of the human peptide are discussed.

Ruxolitinib reduces severe CRS response by suspending CAR-T cell function instead of damaging CAR-T cells.

The therapeutic effect of CAR-T is often accompanied by sCRS, which is the main obstacle to the promotion of CAR-T therapy. The JAK1/2 inhibitor ruxolitinib has recently been confirmed as clinically effective in maintaining control over sCRS, however, its mechanism remains unclear. In this study, we firstly revealed that ruxolitinib significantly inhibited the proliferation of CAR-T cells without damaging viability, and induced an efficacy-favored differentiation phenotype. Second, ruxolitinib reduced the level of cytokine release not only from CAR-T cells, but also from other cells in the immune system. Third, the cytolytic activity of CAR-T cells was restored once the ruxolitinib was removed; however, the cytokines released from the CAR-T cells maintained an inhibited state to some degree. Finally, ruxolitinib significantly reduced the proliferation rate of CAR-T cells in vivo without affecting the therapeutic efficacy after withdrawal at the appropriate dose. We demonstrated pre-clinically that ruxolitinib interferes with both CAR-T cells and the other immune cells that play an important role in triggering sCRS reactions. This work provides useful and important scientific data for clinicians on the question of whether ruxolitinib has an effect on CAR-T cell function loss causing CAR-T treatment failure when applied in the treatment of sCRS, the answer to which is of great clinical significance.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

The Fluorescent Dye 1,6-Diphenyl-1,3,5-hexatriene Binds to Amyloid Fibrils Formed by Human Amylin and Provides a New Probe of Amylin Amyloid Kinetics.

The fluorescent dye 1,6-diphenyl-1,3,5-hexatriene (DPH) is widely used as a probe of membrane order. We show that DPH also interacts with amyloid fibrils formed by human amylin (h-amylin, also known as islet amyloid polypeptide) in solution, and this results in a 100-fold increase in DPH fluorescence for a sample of 20 µM h-amylin and 0.25 µM DPH. No increase in DPH fluorescence is observed with the non-amyloidogenic rat amylin or with freshly dissolved, nonfibrillar h-amylin. The time course of amyloid formation by amylin was followed by monitoring the fluorescence of added DPH as a function of time and was similar to that monitored by the standard fluorescent probe thioflavin-T. The inclusion of DPH in the buffer did not perturb the time course of amyloid formation under the conditions examined, and the time course was independent of the range of DPH concentrations tested (0.25-5 µM). The maximum final fluorescence intensity is observed at substoichiometric ratios of DPH to amylin. No significant increase in fluorescence was observed during the lag phase of amyloid formation, and the implications for the structure of amylin prefibril oligomers are discussed. h-Amylin contains three aromatic residues. A triple aromatic to leucine mutant forms amyloid, and DPH binds to the resulting fibrils, indicating that interactions with aromatic side chains are not required for DPH-amylin amyloid interactions. DPH may be especially useful for studies of mutant amylins and other polypeptides in which changes in charged residues might complicate interpretation of thioflavin-T fluorescence.

Preparation of Asymmetric Vesicles with Trapped CsCl Avoids Osmotic Imbalance, Non-Physiological External Solutions, and Minimizes Leakage.

The natural asymmetry of cellular membranes influences their properties. In recent years, methodologies for preparing asymmetric vesicles have been developed that rely on cyclodextrin-catalyzed exchange of lipids between donor lipid multilamellar vesicles and acceptor lipid unilamellar vesicles, and the subsequent separation of the, now asymmetric, acceptor vesicles from the donors. Isolation is often accomplished by preloading acceptor vesicles with a high concentration of sucrose, typically 25% (w/w), and separating from donor and cyclodextrin by sucrose gradient centrifugation. We found that when the asymmetric vesicles prepared using methyl-α-cyclodextrin exchange were dispersed under hypotonic conditions using physiological salt solutions, there was enhanced leakage of an entrapped probe, 6-carboxyfluorescein. Studies with symmetric vesicles showed this was due to osmotic pressure and was specific to hypotonic solutions. Inclusion of cholesterol partly reduced leakage but did not completely eliminate it. To avoid having to use hypotonic conditions or to suspend vesicles at nonphysiological solute concentrations to minimize leakage, a method for preparing asymmetric vesicles using acceptor vesicle-entrapped CsCl at a physiological ion concentration (100 mM) was developed. Asymmetric vesicles prepared with the entrapped CsCl protocol were highly resistant to 6-carboxyfluorescein leakage out of the vesicles.

Unhinging the Surfaces of Higher-Order Topological Insulators and Superconductors.

We show that the chiral Dirac and Majorana hinge modes in three-dimensional higher-order topological insulators (HOTIs) and superconductors (HOTSCs) can be gapped while preserving the protecting C_{2n}T symmetry upon the introduction of non-Abelian surface topological order. In both cases, the topological order on a single side surface breaks time-reversal symmetry, but appears with its time-reversal conjugate on alternating sides in a C_{2n}T preserving pattern. In the absence of the HOTI/HOTSC bulk, such a pattern necessarily involves gapless chiral modes on hinges between C_{2n}T-conjugate domains. However, using a combination of K-matrix and anyon condensation arguments, we show that on the boundary of a 3D HOTI/HOTSC these topological orders are fully gapped and hence "anomalous." Our results suggest that new patterns of surface and hinge states can be engineered by selectively introducing topological order only on specific surfaces.

Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation.

DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (hTERT), is overexpressed in ∼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the hTERT gene can down-regulate its expression. However, DNA methylation in the first exon can prevent CTCF binding in most cancers, but the molecular mechanism is unknown. The NMR analysis showed that a stretch of guanine-rich sequence in the first exon of hTERT and located within the CTCF-binding region can form two secondary structures, a hairpin and a quadruplex. A key finding was that the methylation of cytosine at the specific CpG dinucleotides will participate in quartet formation, causing the shift of the equilibrium from the hairpin structure to the quadruplex structure. Of further importance was the finding that the quadruplex formation disrupts CTCF protein binding, which results in an increase in hTERT gene expression. Our results not only identify quadruplex formation in the first exon promoted by CpG dinucleotide methylation as a regulator of hTERT expression but also provide a possible mechanistic insight into the regulation of gene expression via secondary DNA structures.

A novel transition pathway of ligand-induced topological conversion from hybrid forms to parallel forms of human telomeric G-quadruplexes.

The folding topology of DNA G-quadruplexes (G4s) depends not only on their nucleotide sequences but also on environmental factors and/or ligand binding. Here, a G4 ligand, 3,6-bis(1-methyl-4-vinylpyridium iodide)-9-(1-(1-methyl-piperidinium iodide)-3,6,9-trioxaundecane) carbazole (BMVC-8C3O), can induce topological conversion of non-parallel to parallel forms in human telomeric DNA G4s. Nuclear magnetic resonance (NMR) spectroscopy with hydrogen-deuterium exchange (HDX) reveals the presence of persistent imino proton signals corresponding to the central G-quartet during topological conversion of Tel23 and Tel25 G4s from hybrid to parallel forms, implying that the transition pathway mainly involves local rearrangements. In contrast, rapid HDX was observed during the transition of 22-CTA G4 from an anti-parallel form to a parallel form, resulting in complete disappearance of all the imino proton signals, suggesting the involvement of substantial unfolding events associated with the topological transition. Site-specific imino proton NMR assignments of Tel23 G4 enable determination of the interconversion rates of individual guanine bases and detection of the presence of intermediate states. Since the rate of ligand binding is much higher than the rate of ligand-induced topological conversion, a three-state kinetic model was evoked to establish the associated energy diagram for the topological conversion of Tel23 G4 induced by BMVC-8C3O.

Structural basis of sodium-potassium exchange of a human telomeric DNA quadruplex without topological conversion.

Understanding the mechanism of Na(+)/K(+)-dependent spectral conversion of human telomeric G-quadruplex (G4) sequences has been limited not only because of the structural polymorphism but also the lack of sufficient structural information at different stages along the conversion process for one given oligonucleotide. In this work, we have determined the topology of the Na(+) form of Tel23 G4, which is the same hybrid form as the K(+) form of Tel23 G4 despite the distinct spectral patterns in their respective nuclear magnetic resonance (NMR) and circular dichroism spectra. The spectral difference, particularly the well-resolved imino proton NMR signals, allows us to monitor the structural conversion from Na(+) form to K(+) form during Na(+)/K(+) exchange. Time-resolved NMR experiments of hydrogen-deuterium exchange and hybridization clearly exclude involvement of the global unfolding for the fast Na(+)/K(+) spectral conversion. In addition, the K(+) titration monitored by NMR reveals that the Na(+)/K(+) exchange in Tel23 G4 is a two-step process. The addition of K(+) significantly stabilizes the unfolding kinetics of Tel23 G4. These results offer a possible explanation of rapid spectral conversion of Na(+)/K(+) exchange and insight into the mechanism of Na(+)/K(+) structural conversion in human telomeric G4s.

Conformational transition of a hairpin structure to G-quadruplex within the WNT1 gene promoter.

The role of G-quadruplexes (G4s) in biological systems has been widely studied. It is found that they have an important function in gene transcription and regulation. In this work, we have identified two topologies of hairpin and G4 structures formed by a native G-rich sequence (WT22: 5'-GGGCCACCGGGCAGGGGGCGGG-3') from the WNT1 promoter region using nuclear magnetic resonance (NMR) spectroscopy. With the help of site-specific isotope labeling, the topologies of these two structures are unambiguously characterized. Circular dichroism and NMR results are analyzed to determine the kinetics associated with the potassium ion-induced hairpin-to-G4 transition, which is very slow-on the time scale of 4800 s-compared to the previously reported folding kinetics of G4 formation. In addition, the free energies of the unfolding of these two structures are obtained using differential scanning calorimetry. Combining the kinetic and thermodynamic data, we have established the free energy landscape of this two-state folding system. Considering that similar conformational change may exist in other native G-rich sequences, this work highlights an important hairpin to G4 conformational transition which can be used in manipulation of gene regulation or ligand modulation in vivo.

Melatonin alleviates the toxic effect of di(2-ethylhexyl) phthalate on oocyte quality resulting from CEBPB suppression during primordial follicle formation.

Presently, the exposure of plasticizers to humans and animals occurs daily, which pose a potential threat to reproductive health. In the present study, a pregnant mouse model exposed to di(2-ethylhexyl) phthalate (DEHP, one of the most common plasticizers) and melatonin was established, and the single-cell transcriptome technology was applied to investigate the effects of melatonin in ovarian cells against DEHP. Results showed that DEHP markedly altered the gene expression pattern of ovarian cells, and severely weakened the histone methylation modification of oocytes. The administration of melatonin recovered the expression of LHX8 and SOHLH1 proteins that essential for primordial follicle formation, and increased the expression of CEBPB, as well as key genes of histone methylation modification (such as Smyd3 and Kdm5a). In addition, the ovarian damage caused by DEHP was also relieved after the overexpression of CEBPB, which suggested melatonin could improve primordial follicle formation progress via enhancing CEBPB expression in mice. Besides, the apoptosis of ovarian cells induced by DEHP also was diminished by melatonin. The study provides evidence of melatonin preventing the damage mediated by plasticizers on the reproductive system in females and CEBPB may serve as a downstream target factor of melatonin in the process.

Impact of Ca2+ on membrane catalyzed IAPP amyloid formation and IAPP induced vesicle leakage.

Human islet amyloid polypeptide (hIAPP, also known as amylin) is a 37 amino acid pancreatic polypeptide hormone that plays a role in regulating glucose levels, but forms pancreatic amyloid in type-2 diabetes. The process of amyloid formation by hIAPP contributes to ß-cell death in the disease. Multiple mechanisms of hIAPP induced toxicity of ß-cells have been proposed including disruption of cellular membranes. However, the nature of hIAPP membrane interactions and the effect of ions and other molecules on hIAPP membrane interactions are not fully understood. Many studies have used model membranes with a high content of anionic lipids, often POPS, however the concentration of anionic lipids in the ß-cell plasma membrane is low. Here we study the concentration dependent effect of Ca2+ (0 to 50 mM) on hIAPP membrane interactions using large unilamellar vesicles (LUVs) with anionic lipid content ranging from 0 to 50 mol%. We find that Ca2+ does not effectively inhibit hIAPP amyloid formation and hIAPP induced membrane leakage from binary LUVs with a low percentage of POPS, but has a greater effect on LUVs with a high percentage of POPS. Mg2+ had very similar effects, and the effects of Ca2+ and Mg2+ can be largely rationalized by the neutralization of POPS charge. The implications for hIAPP-membrane interactions are discussed.

Interspecies Variation Affects Islet Amyloid Polypeptide Membrane Binding.

The aggregation of islet amyloid polypeptide (IAPP) is associated with ß-cell dysfunction in type 2 diabetes (T2D) in humans. One possible mechanism of toxicity is the interaction of IAPP oligomers with lipid membranes to disrupt the bilayer integrity and/or homeostasis of the cell. Amino acid sequence variations of IAPPs between species can greatly decrease their propensity for aggregation. For example, human IAPP is toxic to ß-cells, but rat and pig IAPP are not. However, it is not clear how these differences affect membrane association. Using native mass spectrometry with lipid nanodiscs, we explored the differences in the association of human, rat, and pig IAPP with lipid bilayers. We discovered that human and rat IAPP bound nanodiscs with anionic dipalmitoyl-phosphatidylglycerol (DPPG) lipids, but pig IAPP did not. Furthermore, human and rat IAPP interacted differently with the membrane. Human IAPP show potential tetramer complexes, but rat IAPP associated with the membrane sequentially. Thus, overall IAPP-bilayer interactions are not necessarily related to disease, but small differences in oligomeric behavior at the membrane may instead play a role.

H3K4me3 as a target of di(2-ethylhexyl) phthalate (DEHP) impairing primordial follicle assembly.

Di (2-ethylhexyl) phthalate (DEHP) is a widely used plastics additive that growing evidence indicates as endocrine disruptor able to negatively affect various reproductive processes both in female and male animals, including humans. However, the precise molecular mechanism of such actions is not completely understood. In the present study, scRNA-seq was performed on the ovaries of offspring from mothers exposed to DEHP from 16.5 days post coitum to 3 days post-partum, when the primordial follicle (PF) stockpile is established. While the histological observations of the offspring ovaries from DEHP exposed mothers confirmed previous data about a distinct reduction of oocytes enclosed in PFs. Focusing on oocytes, scRNA-seq analyses showed that the genes that mostly changed by DEHP were enriched GO terms related to histone H3-K4 methylation. Moreover, we observed H3K4me3 level, an epigenetics modification of H3 that is crucial for chromatin transcription, decreased by 40.28% (P < 0.01) in DEHP-treated group compared with control. When the newborn ovaries were cultured in vitro, the DEHP effects were abolished by tamoxifen (an estrogen receptor antagonist) or overexpression of Smyd3 (one specific methyltransferase of H3K4me3), in particular, the percentage of oocyte enclosed in PF was increased by 15.39% in DEHP plus Smyd3 overexpression group than of DEHP group (P < 0.01), which was accompanied by the upregulation of H3K4me3. Collectively, the present results discover Smyd3-H3K4me3 as a novel target of the deleterious ER-mediated effect of DEHP on PF formation during early folliculogenesis in the mouse and highlight epigenetics changes as prominent targets of endocrine disruptors like DEHP.

Anti-CD19 CAR T-cell consolidation therapy combined with CD19+ feeding T cells and TKI for Ph+ acute lymphoblastic leukemia.

We conducted a single-arm, open-label, single-center phase 1 study to assess the safety and efficacy of multicycle-sequential anti-CD19 chimeric antigen receptor (CAR) T-cell therapy in combination with autologous CD19+ feeding T cells (FTCs) and tyrosine kinase inhibitor (TKI) as consolidation therapy in patients under the age of 65 years with de novo Ph-positive CD19+ B-cell acute lymphoblastic leukemia. Participants were given induction chemotherapy as well as systemic chemotherapy with TKI. Afterward, they received a single cycle of CD19 CAR T-cell infusion and another 3 cycles of CD19 CAR T-cell and CD19+ FTC infusions, followed by TKI as consolidation therapy. CD19+ FTCs were given at 3 different doses. The phase 1 results of the first 15 patients, including 2 withdrawals, are presented. The most common adverse events were cytopenia (13/13) and hypogammaglobinemia (12/13). There was no incidence of cytokine release syndrome above grade 2 or immune effector cell-associated neurotoxicity syndrome or grade 4 nonhematological toxicities. All 13 patients achieved complete remission, including 12 patients with a complete molecular response (CMR) at the data cutoff. The relapse-free survival was 84%, and the overall survival was 83% with a median follow-up of 27 months. The total number of CD19-expressing cells decreased with an increasing CMR rate. CD19 CAR T cells survived for up to 40 months, whereas CD19+ FTCs vanished in 8 patients 3 months after the last infusion. These findings could form the basis for the development of an allo-HSCT-free consolidation paradigm. This trial was registered at www.clinicaltrials.gov as #NCT03984968.

The top 100 most-cited papers in pheochromocytomas and paragangliomas: A bibliometric study.

Background: The purpose of this study was to define and analyze the characteristics of the top 100 most-cited articles and reviews on the topic of pheochromocytomas and paragangliomas (PPGLs) by using bibliometric methods. Methods: We explored the Web of Science Core Collection database to gather the 100 top-cited original articles and reviews of PPGL from 1985 to 20 December 2020. We conducted a bibliometric study to identify the most influential journals, authors, countries, and institutions in the PPGL field. Results: The 100 top-cited papers were cited a total number of 25,723 times, ranging from 131 to 1,144 (mean, 257.23 ± 173.64). All of these 100 top-cited papers were published between 1999 and 2017, and the number of top-cited papers published before 2008 (1999-2008) was significantly higher than that after 2008 (2009-2017) (p = 0.043). The journal with the highest number of published papers is the Journal of Clinical Endocrinology & Metabolism (n = 23). The United States was the most productive country in this topic, which published about half of these publications (n = 51). The National Institutes of Health (NIH) had the largest number of publications (n = 17). Genes or genetics is still the hottest topic in the field of PPGLs. Conclusions: We defined and analyzed the top 100 most-cited papers in the field of PPGLs by gathering detailed information. These data provided insights into the most influential studies related to PPGL. We hoped to inspire researchers and readers in this field to improve their understanding of PPGL research trends and provide ideas for future research from unique perspectives.