YTHDF2/m6 A/NF-κB axis controls anti-tumor immunity by regulating intratumoral Tregs.

N6 -methyladenosine (m6 A) in messenger RNA (mRNA) regulates immune cells in homeostasis and in response to infection and inflammation. The function of the m6 A reader YTHDF2 in the tumor microenvironment (TME) in these contexts has not been explored. We discovered that the loss of YTHDF2 in regulatory T (Treg) cells reduces tumor growth in mice. Deletion of Ythdf2 in Tregs does not affect peripheral immune homeostasis but leads to increased apoptosis and impaired suppressive function of Treg cells in the TME. Elevated tumor necrosis factor (TNF) signaling in the TME promotes YTHDF2 expression, which in turn regulates NF-κB signaling by accelerating the degradation of m6 A-modified transcripts that encode NF-κB-negative regulators. This TME-specific regulation of Treg by YTHDF2 points to YTHDF2 as a potential target for anti-cancer immunotherapy, where intratumoral Treg cells can be targeted to enhance anti-tumor immune response while avoiding Treg cells in the periphery to minimize undesired inflammations.

Non-canonical NF-κB Antagonizes STING Sensor-Mediated DNA Sensing in Radiotherapy.

The NF-κB pathway plays a crucial role in supporting tumor initiation, progression, and radioresistance of tumor cells. However, the role of the NF-κB pathway in radiation-induced anti-tumor host immunity remains unclear. Here we demonstrated that inhibiting the canonical NF-κB pathway dampened the therapeutic effect of ionizing radiation (IR), whereas non-canonical NF-κB deficiency promoted IR-induced anti-tumor immunity. Mechanistic studies revealed that non-canonical NF-κB signaling in dendritic cells (DCs) was activated by the STING sensor-dependent DNA-sensing pathway. By suppressing recruitment of the transcription factor RelA onto the Ifnb promoter, activation of the non-canonical NF-κB pathway resulted in decreased type I IFN expression. Administration of a specific inhibitor of the non-canonical NF-κB pathway enhanced the anti-tumor effect of IR in murine models. These findings reveal the potentially interactive roles for canonical and non-canonical NF-κB pathways in IR-induced STING-IFN production and provide an alternative strategy to improve cancer radiotherapy.

Dendritic Cells but Not Macrophages Sense Tumor Mitochondrial DNA for Cross-priming through Signal Regulatory Protein α Signaling.

Inhibition of cytosolic DNA sensing represents a strategy that tumor cells use for immune evasion, but the underlying mechanisms are unclear. Here we have shown that CD47-signal regulatory protein α (SIRPα) axis dictates the fate of ingested DNA in DCs for immune evasion. Although macrophages were more potent in uptaking tumor DNA, increase of DNA sensing by blocking the interaction of SIRPα with CD47 preferentially occurred in dendritic cells (DCs) but not in macrophages. Mechanistically, CD47 blockade enabled the activation of NADPH oxidase NOX2 in DCs, which in turn inhibited phagosomal acidification and reduced the degradation of tumor mitochondrial DNA (mtDNA) in DCs. mtDNA was recognized by cyclic-GMP-AMP synthase (cGAS) in the DC cytosol, contributing to type I interferon (IFN) production and antitumor adaptive immunity. Thus, our findings have demonstrated how tumor cells inhibit innate sensing in DCs and suggested that the CD47-SIRPα axis is critical for DC-driven antitumor immunity.

Unlocking the Potential of Oxidative Asymmetric Catalysis with Continuous Flow Electrochemistry.

In the field of catalytic asymmetric synthesis, the less-treated path lies in oxidative catalytic asymmetric transformations. The hurdles of pinpointing the appropriate chemical oxidants and addressing their compatibility issues with catalysts and functionalities present significant challenges. Organic electrochemistry, employing traceless electrons for redox reactions, is underscored as a promising solution. However, the commonly used electrolysis in batch cells introduces its own set of challenges, hindering the advancement of electrochemical asymmetric catalysis. Here we introduce a microfluidic electrochemistry platform with single-pass continuous flow reactors that exhibits a wide-ranging applicability to various oxidative asymmetric catalytic transformations. This is exemplified through the sulfenylation of 1,3-dicarbonyls, dehydrogenative C-C coupling, and dehydrogenative alkene annulation processes. The unique properties of microfluidic electrochemical reactors not only eliminate the need for chemical oxidants but also enhance reaction efficiency and reduce the use of additives and electrolytes. These salient features of microfluidic electrochemistry expedite the discovery and development of oxidative asymmetric transformations. In addition, the continuous production facilitated by parallel single-pass reactors ensures straightforward reaction upscaling, removing the necessity for reoptimization across various scales, as evidenced by direct translation from milligram screening to hectogram asymmetric synthesis.

A model of hybrid speciation process drawn from three new poplar species originating from distant hybridization between sections.

Although numerous studies have been conducted on hybrid speciation, our understanding of this process remains limited. Through an 18-year systematic investigation of all taxa of Populus on the Qinghai-Tibet Plateau, we discovered three new taxa with clear characteristics of sect. Leucoides. Further evidence was gathered from morphology, whole-genome bioinformatics, biogeography, and breeding to demonstrate synthetically that they all originated from distant hybridization between sect. Leucoides and sect. Tacamahaca. P. gonggaensis originated from the hybridization of P. lasiocarpa with P. cathayana, P. butuoensis from the hybridization of P. wilsonii with P. szechuanica, and P. dafengensis from the hybridization of P. lasiocarpa with P. szechuanica. Due to heterosis, the three hybrid taxa possess greater ecological adaptability than their ancestral species. We propose a hybrid speciation process model that incorporates orthogonal, reverse, and backcrossing events. This model can adequately explain some crucial evolutionary concerns, such as the nuclear-cytoplasmic conflict on phylogeny and the extinction of ancestral species within the distribution range of hybrid species.

A new species of Populus and the extensive hybrid speciation arising from it on the Qinghai-Tibet Plateau.

While the diversity of species formation is broadly acknowledged, significant debate exists regarding the universal nature of hybrid species formation. Through an 18-year comprehensive study of all Populus species on the Qinghai-Tibet Plateau, 23 previously recorded species and 8 new species were identified. Based on morphological characteristics, these can be classified into three groups: species in section Leucoides, species with large leaves, and species with small leaves in section Tacamahaca. By conducting whole-genome re-sequencing of 150 genotypes from these 31 species, 2.28 million single nucleotide polymorphisms (SNPs) were identified. Phylogenetic analysis utilizing these SNPs not only revealed a highly intricate evolutionary network within the large-leaf species of section Tacamahaca but also confirmed that a new species, P. curviserrata, naturally hybridized with P. cathayana, P. szechuanica, and P. ciliata, resulting in 11 hybrid species. These findings indicate the widespread occurrence of hybrid species formation within this genus, with hybridization serving as a key evolutionary mechanism for Populus on the plateau. A novel hypothesis, "Hybrid Species Exterminating Their Ancestral Species (HSEAS)," is introduced to explain the mechanisms of hybrid species formation at three different scales: the entire plateau, the southeastern mountain region, and individual river valleys.

Combined associations of visceral adipose tissue and adherence to a Mediterranean lifestyle with T2D and diabetic microvascular complications among individuals with prediabetes.

BACKGROUND: It's unclear if excess visceral adipose tissue (VAT) mass in individuals with prediabetes can be countered by adherence to a Mediterranean lifestyle (MEDLIFE). We aimed to examine VAT mass, MEDLIFE adherence, and their impact on type 2 diabetes (T2D) and diabetic microvascular complications (DMC) in individuals with prediabetes. METHODS: 11,267 individuals with prediabetes from the UK Biobank cohort were included. VAT mass was predicted using a non-linear model, and adherence to the MEDLIFE was evaluated using the 25-item MEDLIFE index, encompassing categories such as "Mediterranean food consumption," "Mediterranean dietary habits," and "Physical activity, rest, social habits, and conviviality." Both VAT and MEDLIFE were categorized into quartiles, resulting in 16 combinations. Incident cases of T2D and related DMC were identified through clinical records. Cox proportional-hazards regression models were employed to examine associations, adjusting for potential confounding factors. RESULTS: Over a median follow-up of 13.77 years, we observed 1408 incident cases of T2D and 714 cases of any DMC. High adherence to the MEDLIFE, compared to the lowest quartile, reduced a 16% risk of incident T2D (HR: 0.84, 95% CI: 0.71-0.98) and 31% for incident DMC (0.69, 0.56-0.86). Conversely, compared to the lowest quartile of VAT, the highest quartile increased the risk of T2D (5.95, 4.72-7.49) and incident any DMC (1.79, 1.36-2.35). We observed an inverse dose-response relationship between MEDLIFE and T2D/DMC, and a dose-response relationship between VAT and all outcomes (P for trend < 0.05). Restricted cubic spline analysis confirmed a nearly linear dose-response pattern across all associations. Compared to individuals with the lowest MEDLIFE quartile and highest VAT quartile, those with the lowest T2D risk had the lowest VAT and highest MEDLIFE (0.12, 0.08-0.19). High MEDLIFE was linked to reduced T2D risk across all VAT categories, except in those with the highest VAT quartile. Similar trends were seen for DMC. CONCLUSION: High adherence to MEDLIFE reduced T2D and MDC risk in individuals with prediabetes, while high VAT mass increases it, but MEDLIFE adherence may offset VAT's risk partly. The Mediterranean lifestyle's adaptability to diverse populations suggests promise for preventing T2D.

A 15-Inflammation-Related Gene Signature Predicts the Prognosis of Patients With Pancreatic Ductal Adenocarcinoma.

Chronic inflammation promotes the development of pancreatic ductal adenocarcinoma (PDAC) and PDAC-related inflammatory tumor microenvironment facilitates tumor growth and metastasis. Thus, we aimed to study the association between inflammatory response and prognosis in patients with PDAC. We conducted the whole transcriptomic sequencing using tissue samples collected from patients diagnosed with PDAC (n = 106) recruited from Shandong Cancer Hospital. We first constructed a prognostic signature using 15 inflammation-related genes in The Cancer Genome Atlas (TCGA) cohort (n = 177) and further validated it in an independent International Cancer Genome Consortium (ICGC) cohort (n = 90) and our in-house cohort. PDAC patients with a higher risk score had poorer overall survival (OS) (P < 0.001; HR, 3.02; 95% CI, 1.94-4.70). The association between the prognostic signature and OS remained significant in the multivariable Cox regression adjusting for age, sex, alcohol exposure, diabetes, and stage (P < 0.001; HR, 2.91; 95% CI, 1.73-4.89). This gene signature also robustly predicted prognosis in the ICGC cohort (P = 0.01; HR, 1.94; 95% CI, 1.14-3.30) and our cohort (P < 0.001; HR, 2.40; 95% CI, 1.45-3.97). Immune subtype C3 (inflammatory) was enriched and CD8+ T cells were higher in patients with a lower risk score (P < 0.05). Furthermore, PDAC patients with higher risk scores were more sensitive to chemotherapy, immunotherapy, and PARP inhibitors (P < 0.05). In sum, we identified a novel gene signature that was associated with inflammatory response for risk stratification, prognosis prediction, and therapy guidance in PDAC patients. Future studies are warranted to validate the clinical utility of the signature.

Evidence for the smallest fossil Pongo in southern China.

The rarity of Pongo fossils with precise absolute dating from the Middle Pleistocene hampers our understanding of the taxonomy and spatiotemporal distribution of Quaternary orangutans in southern China. Here, we report a newly discovered sample of 113 isolated teeth of fossil Pongo from Zhongshan Cave in the Bubing Basin, Guangxi, southern China. We describe the Pongo specimens from Zhongshan Cave and compare them metrically to other samples of fossil Pongo species (i.e., Pongo weidenreichi, Pongo devosi, Pongo duboisi, Pongo palaeosumatrensis, Pongo javensis, and Pongo sp.) and to extant orangutans (i.e., Pongo pygmaeus and Pongo abelii). The Zhongshan Pongo assemblage is dated using U-series and coupled electron spin resonance/U-series methods. Our results reasonably constrain the Zhongshan Pongo assemblage to 184 ± 16 ka, which is consistent with the biostratigraphic evidence. The Zhongshan Pongo teeth are only 6.5% larger on average than those of extant Pongo. The Zhongshan teeth are smaller overall than those of Pongo from all other cave sites in southern China, and they currently represent the smallest fossil orangutans in southern China. Based on their dental size, and the presence of a well-developed lingual pillar and lingual cingulum on the upper and lower incisors, an intermediate frequency of lingual cingulum remnants on the upper molars, and a higher frequency of moderate to heavy wrinkling on the upper and lower molars, we provisionally assign the Zhongshan fossils to P. devosi. Our results confirm earlier claims that P. weidenreichi is replaced by a smaller species in southern China, P. devosi, by the late Middle Pleistocene. The occurrence of P. devosi in Zhongshan Cave further extends its spatial and temporal distribution. The Pongo specimens from Zhongshan provide important new evidence to demonstrate that the dental morphological features of Pongo in southern China changed substantially during the late Middle Pleistocene.

Copper-Catalyzed [4+1+1] Annulation of Ammonium Salts and Anthranils: Synthesis of 2,3-Diaroylquinolines.

A copper(I)-catalyzed protocol is developed for the synthesis of various 2,3-diaroylquinolines starting from achiral ammonium salts and anthranils through [4+1+1] annulation. Using copper(I) chloride as the sole catalyst, this reaction is featured with easily available starting materials, broad substrate scope, good yields and simple reaction conditions.

Assessment of nonlinear dose-response relationships via nonparametric regression.

We propose a simple approach to assess whether a nonlinear parametric model is appropriate to depict the dose-response relationships and whether two parametric models can be applied to fit a dataset via nonparametric regression. The proposed approach can compensate for the ANOVA, which is sometimes conservative, and is very easy to implement. We illustrate the performance by analyzing experimental examples and a small simulation study.

Myofibroblast-derived exosomes enhance macrophages to myofibroblasts transition and kidney fibrosis.

A critical event in the pathogenesis of kidney fibrosis is the transition of macrophages into myofibroblasts (MMT). Exosomes play an important role in crosstalk among cells in the kidney and the development of renal fibrosis. However, the role of myofibroblast-derived exosomes in the process of MMT and renal fibrosis progression remains unknown. Here, we examined the role of myofibroblast-derived exosomes in MMT and kidney fibrogenesis. In vitro, transforming growth factor-ß1 stimulated the differentiation of kidney fibroblasts into myofibroblasts and promoted exosome release from myofibroblasts. RAW264.7 cells were treated with exosomes derived from myofibroblasts. We found purified exosomes from myofibroblasts trigger the MMT. By contrast, inhibition of exosome production with GW4869 or exosome depletion from the conditioned media abolished the ability of myofibroblasts to induce MMT. Mice treatment with myofibroblast-derived exosomes (Myo-Exo) exhibited severe fibrotic lesion and more abundant MMT cells in kidneys with folic acid (FA) injury, which was negated by TANK-banding kinase-1 inhibitor. Furthermore, suppression of exosome production reduced collagen deposition, extracellular matrix protein accumulation, and MMT in FA nephropathy. Collectively, Myo-Exo enhances the MMT and kidney fibrosis. Blockade of exosomes mediated myofibroblasts-macrophages communication may provide a novel therapeutic target for kidney fibrosis.

Neuronal and Glial Metabolite Abnormalities in Participants With Persistent Neuropsychiatric Symptoms After COVID-19: A Brain Proton Magnetic Resonance Spectroscopy Study.

BACKGROUND: The aim of this study was to determine whether neurometabolite abnormalities indicating neuroinflammation and neuronal injury are detectable in individuals post-coronavirus disease 2019 (COVID-19) with persistent neuropsychiatric symptoms. METHODS: All participants were studied with proton magnetic resonance spectroscopy at 3 T to assess neurometabolite concentrations (point-resolved spectroscopy, relaxation time/echo time = 3000/30 ms) in frontal white matter (FWM) and anterior cingulate cortex-gray matter (ACC-GM). Participants also completed the National Institutes of Health Toolbox cognition and motor batteries and selected modules from the Patient-Reported Outcomes Measurement Information System. RESULTS: Fifty-four participants were evaluated: 29 post-COVID-19 (mean ± SD age, 42.4 ± 12.3 years; approximately 8 months from COVID-19 diagnosis; 19 women) and 25 controls (age, 44.1 ± 12.3 years; 14 women). When compared with controls, the post-COVID-19 group had lower total N-acetyl compounds (tNAA; ACC-GM: -5.0%, P = .015; FWM: -4.4%, P = .13), FWM glutamate + glutamine (-9.5%, P = .001), and ACC-GM myo-inositol (-6.2%, P = .024). Additionally, only hospitalized patients post-COVID-19 showed age-related increases in myo-inositol, choline compounds, and total creatine (interaction P = .029 to <.001). Across all participants, lower FWM tNAA and higher ACC-GM myo-inositol predicted poorer performance on several cognitive measures (P = .001-.009), while lower ACC-GM tNAA predicted lower endurance on the 2-minute walk (P = .005). CONCLUSIONS: In participants post-COVID-19 with persistent neuropsychiatric symptoms, the lower-than-normal tNAA and glutamate + glutamine indicate neuronal injury, while the lower-than-normal myo-inositol reflects glial dysfunction, possibly related to mitochondrial dysfunction and oxidative stress in Post-COVID participants with persistent neuropsychiatric symptoms.

Icotinib, an EGFR tyrosine kinase inhibitor, as adjuvant therapy for patients with stage IIA-IIIA EGFR-mutant non-small-cell lung adenocarcinoma: a multicenter, open-label, single-arm, phase II study (ICAPE).

The survival benefit of icotinib (an oral epidermal growth factor receptor [EGFR] tyrosine kinase inhibitor) in patients with advanced lung cancer has been confirmed in several studies. This study (ICAPE) evaluated the efficacy of icotinib as adjuvant therapy for patients with stage IIA-IIIA EGFR-mutant non-small-cell lung adenocarcinoma. Patients with stage IIA-IIIA EGFR-mutant non-small-cell lung adenocarcinoma were enrolled in the multicenter, open-label, single-arm, phase II study. Eligible patients received oral icotinib 125 mg thrice daily for 1.5 years after complete surgical resection. The primary endpoint was disease-free survival (DFS). Between March 2014 and January 2018, 79 patients were enrolled. The median follow-up time was 39.7 months with a median DFS and overall survival (OS) of 41.4 months (95% CI: 33.6-51.8) and 67.0 months (95% CI: 21.2-not reached [NR]), respectively. The 1-year, 3-year, and 5-year OS rates were 100%, 83.3%, and 61.7%, respectively. No significant difference was found in the median DFS between patients with Bcl-2 interacting mediator of cell death (BIM) mutant-type and wild-type (NR vs. 41.7 months; p = 0.75). No significant difference was found in the median DFS according to EGFR mutation types. Icotinib as adjuvant therapy demonstrated a favorable survival benefit in patients with stage IIA-IIIA EGFR-mutant non-small-cell lung adenocarcinoma, indicating that icotinib might be a promising treatment option for this patient population. The optimal adjuvant duration of icotinib is still not clear and needs more incoming data to answer.

Middle Pleistocene Pongo from Ganxian Cave in southern China with implications for understanding dental size evolution in orangutans.

The Pongo fossil record of China extends from the Early Pleistocene to the Late Pleistocene, but to date, no late Middle Pleistocene samples of Pongo with precise absolute dating have been identified in southern China. Here, we report the recovery of 106 fossil teeth of Pongo from Ganxian Cave in the Bubing Basin, Guangxi, southern China. We dated the speleothems using Uranium-series and dated the two rhinoceros teeth using coupled electron spin resonance/Uranium-series dating methods to between 168.9 ± 2.4 ka and 362 ± 78 ka, respectively. These dates are consistent with the biostratigraphic and magnetostratigraphic age estimates. We further describe the fossil teeth from Ganxian Cave and compare them metrically to samples of fossil Pongo (i.e., Pongo weidenreichi, Pongo duboisi, Pongo palaeosumatrensis, Pongo javensis, and Pongo sp.) from the Early, Middle, and Late Pleistocene and to extant Pongo (i.e., Pongo pygmaeus and Pongo abelii) from Southeast Asia. Based on overall dental size, a high frequency of lingual cingulum remnants on the upper molars, and a low frequency of moderate to heavy wrinkling on the molars, we attribute the Ganxian fossils to P. weidenreichi. Compared with Pongo fossils from other mainland Southeast Asia sites, those from Ganxian confirm that dental size reduction of Pongo occurred principally during the Early and Middle Pleistocene. From the Middle to Late Pleistocene, all teeth except the P3 show little change in occlusal area, indicating that the size of these teeth remained relatively stable over time. The evolutionary trajectory of the Pongo dentition through time may be more complex than previously thought. More orangutan fossils with precise dating constraints are the keys to solving this issue.

STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors.

Ionizing radiation-mediated tumor regression depends on type I interferon (IFN) and the adaptive immune response, but several pathways control I IFN induction. Here, we demonstrate that adaptor protein STING, but not MyD88, is required for type I IFN-dependent antitumor effects of radiation. In dendritic cells (DCs), STING was required for IFN-? induction in response to irradiated-tumor cells. The cytosolic DNA sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) mediated sensing of irradiated-tumor cells in DCs. Moreover, STING was essential for radiation-induced adaptive immune responses, which relied on type I IFN signaling on DCs. Exogenous IFN-? treatment rescued the cross-priming by cGAS or STING-deficient DCs. Accordingly, activation of STING by a second messenger cGAMP administration enhanced antitumor immunity induced by radiation. Thus radiation-mediated antitumor immunity in immunogenic tumors requires a functional cytosolic DNA-sensing pathway and suggests that cGAMP treatment might provide a new strategy to improve radiotherapy.

Coumarin-Based Fluorescent Inhibitors for Photocontrollable Bioactivation.

Activation of the IRE-1/XBP-1 pathway is related to many human diseases. Coumarin-based derivatives acting as both IRE-1 inhibitors and bright fluorophores are highly desirable to establish an integrated fluorescent inhibitor system. Here, we take insights into the aqueous stability of a photocaged IRE-1 inhibitor PC-D-F07 through a structure activity relationship. The substituent effects indicate that the electron-withdrawing -NO2 moiety in the photocage combined with the tricyclic coumarin fluorophore contribute to the structural stability of PC-D-F07. To optimize the photocage of PC-D-F07, we incorporate a 1-ethyl-2-nitrobenzyl or 2-nitrobenzyl photolabile moiety on the hydroxyl group of the IRE-1 inhibitor to generate RF-7 and RF-8. Upon photoactivation, both RF-7 and RF-8 present an increased fluorescence response, sequentially enabling the unlocking of the ortho-1,3-dioxane acetal for the release of active IRE-1 inhibitors. Moreover, RF-7 exhibits a high repolarization ratio of converting M2-type tumor-associated macrophages (M2-TAMs) to M1-type immune-responsive macrophages. This provides a novel prodrug strategy of modulating druggable fluorophore backbones to achieve spatiotemporally controllable drug release for precise cancer treatment.

Neurocognitive and emotional factors predict pain-related healthcare utilization in children with sickle cell disease.

BACKGROUND: Youth with sickle cell disease (SCD) experience increased rates of neurocognitive and emotional difficulties. Cross-sectional studies suggest neurocognitive and emotional functioning are associated with health outcomes in SCD. We investigated whether neurocognitive and emotional factors predicted future pain-related healthcare utilization in children with SCD. PROCEDURE: Total 112 youth with SCD between ages 7 and 16 years reported sociodemographics and completed measures of neurocognitive functioning and emotional well-being. The number of emergency department (ED) visits and hospitalizations for pain 1 and 3 years after enrollment were determined by chart review. RESULTS: The mean age of participants was 10.61 years (standard deviation = 2.91), with most being female (n = 65; 58%). Eighty-three (74%) participants had either HbSS or HbSß0 thalassemia. Regression analyses showed that attention significantly predicted ED visits and hospitalizations for pain at 1 and 3 years after enrollment (all p-values ≤ .017), such that poorer attention was associated with higher healthcare utilization. Lower emotional quality of life also predicted more ED visits for pain at 3 years (b = -.009, p = .013) and hospitalizations for pain at 3 years (b = -.008, p = .020). CONCLUSIONS: Neurocognitive and emotional factors are associated with subsequent healthcare use in youth with SCD. Poor attentional control might limit implementation of strategies to distract from pain or could make disease self-management behaviors more challenging. Results also highlight the potential impact of stress on pain onset, perception, and management. Clinicians should consider neurocognitive and emotional factors when developing strategies to optimize pain-related outcomes in SCD.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Partial Segregation of Bi and Microvoid Formation on a Pure Cu Substrate After Solid-Solid Reactions.

With the trend of technology development and carbon reduction, reducing the process temperature to prevent greenhouse effects is of great urgency. The back-end process of semiconductors is increasingly important because of the limitation of Moore's Law. High-temperature bonding is serious for semiconductor packages, which induces high cost and device damage. One of the critical ways to reduce the process temperature is to adopt low-temperature solders. In this study, we utilize the low-temperature solder Sn58Bi to achieve energy savings and device protection. The interfacial reactions between Sn58Bi and Cu after reflow and aging reactions were investigated. The solubility of Bi in Sn influences the Bi segregation at the interface. Partial Bi segregation, microvoids, and uneven Cu3Sn were observed at the interface after aging. There is no doubt that the aforementioned structures are unfavorable for solder joint strength.