Biodiversity mitigates drought effects in the decomposer system across biomes.

Multiple facets of global change affect the earth system interactively, with complex consequences for ecosystem functioning and stability. Simultaneous climate and biodiversity change are of particular concern, because biodiversity may contribute to ecosystem resistance and resilience and may mitigate climate change impacts. Yet, the extent and generality of how climate and biodiversity change interact remain insufficiently understood, especially for the decomposition of organic matter, a major determinant of the biosphere-atmosphere carbon feedbacks. With an inter-biome field experiment using large rainfall exclusion facilities, we tested how drought, a common prediction of climate change models for many parts of the world, and biodiversity in the decomposer system drive decomposition in forest ecosystems interactively. Decomposing leaf litter lost less carbon (C) and especially nitrogen (N) in five different forest biomes following partial rainfall exclusion compared to conditions without rainfall exclusion. An increasing complexity of the decomposer community alleviated drought effects, with full compensation when large-bodied invertebrates were present. Leaf litter mixing increased diversity effects, with increasing litter species richness, which contributed to counteracting drought effects on C and N loss, although to a much smaller degree than decomposer community complexity. Our results show at a relevant spatial scale covering distinct climate zones that both, the diversity of decomposer communities and plant litter in forest floors have a strong potential to mitigate drought effects on C and N dynamics during decomposition. Preserving biodiversity at multiple trophic levels contributes to ecosystem resistance and appears critical to maintain ecosystem processes under ongoing climate change.

Ibrutinib and venetoclax as primary therapy in symptomatic, treatment-naïve Waldenström macroglobulinemia.

ABSTRACT: Concurrent Bruton tyrosine kinase and BCL2 inhibition has not yet been investigated in Waldenström macroglobulinemia (WM). We performed an investigator-initiated trial of ibrutinib and venetoclax in symptomatic treatment-naïve patients with MYD88-mutated WM. Patients received ibrutinib 420 mg once daily (cycle 1), followed by a ramp-up of venetoclax to 400 mg daily (cycle 2). The combination was then administered for 22 additional 4-week cycles. The attainment of very good partial response (VGPR) was the primary end point. Forty-five patients were enrolled in this study. The median baseline characteristics were as follows: age 67 years, serum IgM 43 g/L, and hemoglobin 102 g/L. Seventeen patients (38%) carried CXCR4 mutations. Nineteen patients (42%) achieved VGPR. Grade 3 or higher adverse events included neutropenia (38%), mucositis (9%), and tumor lysis syndrome (7%). Atrial fibrillation occurred in 3 (9%), and ventricular arrhythmia in 4 (9%) patients that included 2 grade 5 events. With a median follow-up of 24.4 months, the 24-month progression-free survival (PFS) and overall survival (OS) rates were 76% and 96%, respectively, and were not impacted by CXCR4 mutations. The median time on therapy was 10.2 months, and the median time after the end of therapy (EOT) was 13.3 months. Eleven of the 12 progression events occurred after EOT, and the 12-month PFS rates after EOT were 79%; 93% if VGPR was attained, and 69% for other patients (P = .12). Ibrutinib and venetoclax induced high VGPR rates and durable responses after EOT, although they were associated with a higher-than-expected rate of ventricular arrhythmia in patients with WM, leading to early study treatment termination. This trial was registered at www.clinicaltrials.gov as #NCT04273139.

Novel serum biomarker of Golgi protein 73 for the diagnosis of clinically significant portal hypertension in patients with compensated cirrhosis.

Hepatic venous pressure gradient (HVPG) is the gold standard for evaluating clinically significant portal hypertension (CSPH). However, reliable noninvasive methods are limited. Our study aims to investigate the diagnostic value of serum Golgi protein 73 (GP73) for CSPH in patients with compensated cirrhosis. The study enrolled 262 consecutive patients with compensated cirrhosis from three centers in China from February 2021 to September 2023, who underwent both serum GP73 tests and HVPG measurements. CSPH was defined as HVPG ≥ 10 mmHg. Diagnostic accuracy was evaluated using the areas under the receiver operating characteristic curve (AUC). The prevalence of CSPH was 56.9% (n = 149). There were significant differences between the CSPH and non-CSPH groups in the median serum GP73 level (126.8 vs. 73.1 ng/mL, p < 0.001). GP73 level showed a significant positive linear correlation with HVPG (r = 0.459, p < 0.001). The AUC for the diagnosis of CSPH using serum GP73 alone was 0.75 (95% confidence interval [CI] 0.68-0.81). Multivariate logistic regression analysis determined that the levels of GP73, platelets and international normalized ratio were independently associated with CSPH. The combination of these three markers was termed "IP73" score with an AUC value of 0.85 (95% CI 0.80-0.89) for CSPH. Using 0 as a cut-off value, the specificity and sensitivity of IP73 score were 77.9% and 81.9%, respectively. The IP73 score offers a novel, simple and noninvasive method of assessing CSPH in patients with compensated cirrhosis. A cut-off value of the IP73 score at 0 can distinguish patients with or without CSPH.

Species pool, local assembly processes: Disentangling the mechanisms determining bacterial α- and ß-diversity during forest secondary succession.

Across ecology, and particularly within microbial ecology, there is limited understanding how the generation and maintenance of diversity. Although recent work has shown that both local assembly processes and species pools are important in structuring microbial communities, the relative contributions of these mechanisms remain an important question. Moreover, the roles of local assembly processes and species pools are drastically different when explicitly considering the potential for saturation or unsaturation, yet this issue is rarely addressed. Thus, we established a conceptual model that incorporated saturation theory into the microbiological domain to advance the understanding of mechanisms controlling soil bacterial diversity during forest secondary succession. Conceptual model hypotheses were tested by coupling soil bacterial diversity, local assembly processes and species pools using six different forest successional chronosequences distributed across multiple climate zones. Consistent with the unsaturated case proposed in our conceptual framework, we found that species pool consistently affected α-diversity, even while local assembly processes on local richness operate. In contrast, the effects of species pool on ß-diversity disappeared once local assembly processes were taken into account, and changes in environmental conditions during secondary succession led to shifts in ß-diversity through mediation of the strength of heterogeneous selection. Overall, this study represents one of the first to demonstrate that most local bacterial communities might be unsaturated, where the effect of species pool on α-diversity is robust to the consideration of multiple environmental influences, but ß-diversity is constrained by environmental selection.

Canopy and understory nitrogen additions differently affect soil microbial residual carbon in a temperate forest.

Atmospheric nitrogen (N) deposition in forests can affect soil microbial growth and turnover directly through increasing N availability and indirectly through altering plant-derived carbon (C) availability for microbes. This impacts microbial residues (i.e., amino sugars), a major component of soil organic carbon (SOC). Previous studies in forests have so far focused on the impact of understory N addition on microbes and microbial residues, but the effect of N deposition through plant canopy, the major pathway of N deposition in nature, has not been explicitly explored. In this study, we investigated whether and how the quantities (25 and 50 kg N ha-1 year-1) and modes (canopy and understory) of N addition affect soil microbial residues in a temperate broadleaf forest under 10-year N additions. Our results showed that N addition enhanced the concentrations of soil amino sugars and microbial residual C (MRC) but not their relative contributions to SOC, and this effect on amino sugars and MRC was closely related to the quantities and modes of N addition. In the topsoil, high-N addition significantly increased the concentrations of amino sugars and MRC, regardless of the N addition mode. In the subsoil, only canopy N addition positively affected amino sugars and MRC, implying that the indirect pathway via plants plays a more important role. Neither canopy nor understory N addition significantly affected soil microbial biomass (as represented by phospholipid fatty acids), community composition and activity, suggesting that enhanced microbial residues under N deposition likely stem from increased microbial turnover. These findings indicate that understory N addition may underestimate the impact of N deposition on microbial residues and SOC, highlighting that the processes of canopy N uptake and plant-derived C availability to microbes should be taken into consideration when predicting the impact of N deposition on the C sequestration in temperate forests.

Evenness of soil organic carbon chemical components changes with tree species richness, composition and functional diversity across forests in China.

Higher tree species richness generally increases the storage of soil organic carbon (SOC). However, less attention is paid to the influence of varied tree species composition on SOC storage. Recently, the perspectives for the stronger persistence of SOC caused by the higher molecular diversity of organic compounds were proposed. Therefore, the influences of tree species richness and composition on the molecular diversity of SOC need to be explored. In this study, an index of the evenness of diverse SOC chemical components was proposed to represent the potential resistance of SOC to decomposition under disturbances. Six natural forest types were selected encompassing a diversity gradient, ranging from cold temperate to tropical forests. We examined the correlations of tree species richness, composition, and functional diversity, with the evenness of SOC chemical components at a molecular level by 13 C nuclear magnetic resonance. Across the range, tree species richness correlated to the evenness of SOC chemical components through tree species composition. The negative correlation of evenness of SOC chemical components with tree species composition, and the positive correlation of evenness of SOC chemical components with tree functional diversity were found. These indicate the larger difference in tree species composition and the lower community functional diversity resulted in the higher heterogeneity of SOC chemical components among the communities. The positive correlation of the evenness of SOC chemical components with the important value of indicator tree species, further revealed the specific tree species contributing to the higher evenness of SOC chemical components in each forest type. Soil fungal and bacterial α-diversity had effect on the evenness of SOC chemical components. These findings suggest that the indicator tree species conservation might be preferrable to simply increasing tree species richness, for enhancing the potential resistance of SOC to decomposition.

Roles of extracellular vesicles on macrophages in inflammatory bone diseases.

Inflammatory bone disease is a general term for a series of diseases caused by chronic inflammation, which leads to the destruction of bone homeostasis, that is, the osteolytic activity of osteoclasts increases, and the osteogenic activity of osteoblasts decreases, leading to osteolysis. Macrophages are innate immune cell with plasticity, and their polarization is related to inflammatory bone diseases. The dynamic balance of macrophages between the M1 phenotype and the M2 phenotype affects the occurrence and development of diseases. In recent years, an increasing number of studies have shown that extracellular vesicles existing in the extracellular environment can act on macrophages, affecting the progress of inflammatory diseases. This process is realized by influencing the physiological activity or functional activity of macrophages, inducing macrophages to secrete cytokines, and playing an anti-inflammatory or pro-inflammatory role. In addition, by modifying and editing extracellular vesicles, the potential of targeting macrophages can be used to provide new ideas for developing new drug carriers for inflammatory bone diseases.

Expression of different genotypes of bovine TRDMT1 gene and its polymorphisms association with body measures in Qinchuan cattle (Bos Taurus).

DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2-4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development.

Gut Microbiome in Progressive Multiple Sclerosis.

OBJECTIVE: This study was undertaken to investigate the gut microbiome in progressive multiple sclerosis (MS) and how it relates to clinical disease. METHODS: We sequenced the microbiota from healthy controls and relapsing-remitting MS (RRMS) and progressive MS patients and correlated the levels of bacteria with clinical features of disease, including Expanded Disability Status Scale (EDSS), quality of life, and brain magnetic resonance imaging lesions/atrophy. We colonized mice with MS-derived Akkermansia and induced experimental autoimmune encephalomyelitis (EAE). RESULTS: Microbiota ß-diversity differed between MS patients and controls but did not differ between RRMS and progressive MS or differ based on disease-modifying therapies. Disease status had the greatest effect on the microbiome ß-diversity, followed by body mass index, race, and sex. In both progressive MS and RRMS, we found increased Clostridium bolteae, Ruthenibacterium lactatiformans, and Akkermansia and decreased Blautia wexlerae, Dorea formicigenerans, and Erysipelotrichaceae CCMM. Unique to progressive MS, we found elevated Enterobacteriaceae and Clostridium g24 FCEY and decreased Blautia and Agathobaculum. Several Clostridium species were associated with higher EDSS and fatigue scores. Contrary to the view that elevated Akkermansia in MS has a detrimental role, we found that Akkermansia was linked to lower disability, suggesting a beneficial role. Consistent with this, we found that Akkermansia isolated from MS patients ameliorated EAE, which was linked to a reduction in RORγt+ and IL-17-producing γδ T cells. INTERPRETATION: Whereas some microbiota alterations are shared in relapsing and progressive MS, we identified unique bacteria associated with progressive MS and clinical measures of disease. Furthermore, elevated Akkermansia in MS may be a compensatory beneficial response in the MS microbiome. ANN NEUROL 2021;89:1195-1211.

Where should China practice forestry in a warming world?

As a nature-based and cost-effective solution, forestation plays a crucial role in combating global warming, biodiversity collapse, environmental degradation, and global well-being. Although China is acknowledged as a global leader of forestation and has achieved considerable overall success in environmental improvements through mega-forestation programs, many negative effects have also emerged at local scales due to the planting of maladapted tree species. To better help achieve carbon neutrality and the new vision of an ecological civilization, China has committed to further increase forestation. However, where forestation lands and such efforts should really be located is not so well understood yet and agreed upon, especially in the face of rapid climate change. Based on an ensemble-learning machine, we predicted the spatial habitats (ecological niche) of the forest, grassland, shrubland, and desert under present and future climate conditions based on the natural climax vegetation distribution across China. We show that the potential forestation lands are mainly located in eastern China, which is east of the Hu Line (also known as the Heihe-Tengchong Line). Under future climate change, forests will shift substantially in the latitudinal, longitudinal, and elevational distribution. Potential forestation lands will increase by 33.1 million hectares through the 2070s, mainly due to the conversions of shrub and grassland to forests along the Hu Line. Our prediction map also indicates that grassland rehabilitation is the universal optimal vegetation restoration strategy in areas west of the Hu Line. This analysis is consistent with much of the observed evidence of forestation failures and recent climate-change-induced forest range shifts. Our results provide an overview and further show the importance of adaptive science-based forestation planning and forest management.

Phosphorus additions imbalance terrestrial ecosystem C:N:P stoichiometry.

Carbon (C):nitrogen (N):phosphorus (P) stoichiometry in plants, soils, and microbial biomass influences productivity and nutrient cycling in terrestrial ecosystems. Anthropogenic inputs of P to ecosystems are increasing; however, our understanding of the impacts of P addition on terrestrial ecosystem C:N:P ratios remains elusive. By conducting a meta-analysis with 1413 paired observations from 121 publications, we showed that P addition significantly decreased plant, soil, and microbial biomass N:P and C:P ratios, but had negligible effects on C:N ratios. The reductions in N:P and C:P ratios became more evident as the P application rates and experimental duration increased. The P addition effects on terrestrial ecosystem C:N:P stoichiometry did not vary with ecosystem types or climates. Moreover, the responses of N:P and C:P ratios in soil and microbial biomass were associated with the responses of soil pH and fungi:bacteria ratios. Additionally, P additions increased net primary productivity, microbial biomass, soil respiration, N mineralization, and N nitrification, but decreased ammonium and nitrate contents. Decreases in plant N:P and C:P ratios were both negatively correlated to net primary productivity and soil respiration, but positively correlated to ammonium and nitrate contents; microbial biomass, soil respiration, ammonium contents, and nitrate contents all increased with declining soil N:P and C:P ratios. Our findings highlight that P additions could imbalance C:N:P stoichiometry and potentially impact the terrestrial ecosystem functions.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages.

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

A novel 17 bp InDel polymorphism within the PPARGC1A gene is significantly associated with growth traits in sheep.

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding.

Genetic effects of FTO gene insertion/deletion (InDel) on fat-tail measurements and growth traits in Tong sheep.

Tong sheep is a kind of famous fat-tailed sheep in China, which no longer meets market demands because of the large amount of fat deposition in tail. Fat mass and obesity associated (FTO) gene regulates fatty acid transport and fat metabolism to affect obesity and is also reported to regulate phenotypic traits in healthy animals. To identify the insertion/deletion (InDel) variations of the FTO gene and evaluate their effects on fat-tail measurements and growth traits, 166 healthy individuals from Tong sheep were identified and analyzed. Herein, 10 novel InDel polymorphisms were founded in the Tong sheep FTO gene, which displayed intermediate polymorphism (0.25 < PIC < 0.5) and were in Hardy-Weinberg equilibrium (p > .05). Correlation analysis of 78 Tong sheep phenotypic traits data and InDel polymorphisms showed that eight InDel loci were significantly associated with partial growth traits (p < .05), four InDel loci were significantly correlated with fat-tail measurements (p < .05). In particular, individuals with genotype DD showed better phenotypic traits than individuals with other genotypes at male sheep InDel 5 and InDel 8 loci, which had small tail-fat dimensions while having good growth traits. These results confirmed potential usefulness of FTO gene in marker-assisted selection programs of Tong sheep breeding.

Detection of key gene InDels in TGF-ß pathway and its relationship with growth traits in four sheep breeds.

TGF-ß signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-ß signaling pathway. LTBP1 binds to TGF-ß, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-ß pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-ß signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding.

The Responses of Bioactive Betanin Pigment and Its Derivatives from a Red Beetroot (Beta vulgaris L.) Betalain-Rich Extract to Hypochlorous Acid.

Neutrophils produce hypochlorous acid (HOCl) as well as other reactive oxygen species as part of a natural innate immune response in the human body; however, excessive levels of HOCl can ultimately be detrimental to health. Recent reports suggest that betacyanin plant pigments can act as potent scavengers of inflammatory factors and are notably effective against HOCl. Comparison of the in vitro anti-hypochlorite activities of a novel betalain-rich red beetroot (Beta vulgaris L.) extract with its pure betalainic pigments revealed that the extract had the highest anti-hypochlorite activity, far exceeding the activity of all of the betalainic derivatives and selected reference antioxidants. This suggests that it may be an important food-based candidate for management of inflammatory conditions induced by excessive HOCl production. Among all pigments studied, betanidin exhibited the highest activity across the pH range.

Nanoactivated Carbon Reduces Mercury Mobility and Uptake by Oryza sativa L: Mechanistic Investigation Using Spectroscopic and Microscopic Techniques.

Mercury (Hg) contamination of paddy field poses a health risk to rice consumers, and its remediation is a subject of global scientific attention. In recent years focus has been given to in situ techniques which reduce the risk of Hg entering the food chain. Here, we investigate the use of nanoactivated carbon (NAC) as a soil amendment to minimize Hg uptake by rice plants. Application of 1-3% NAC to soil (by weight) reduced Hg concentration in the pore water (by 61-76%) and its bioaccumulation in the tissues of rice plants (by 15-63%), relative to the corresponding control. Specifically, NAC reduced the Hg concentration of polished rice by 47-63% compared to the control, to a level that was 29-49% lower than the food safety value (20 ng g-1) defined by the Chinese government. The NAC induced a change in Hg binding from organic matter to nano-HgS in the soil as a function of soil amendment. This Hg speciation transformation might be coupled to the reduction of sulfoxide to reduced sulfur species (S0) by NAC. The NAC amendment may be a practical and effective solution to mitigate the risk of Hg transferring from contaminated soil to rice grains at locations around the world.

Drought can offset potential water use efficiency of forest ecosystems from rising atmospheric CO2.

Increasing atmospheric CO2 is both leading to climate change and providing a potential fertilisation effect on plant growth. However, southern Australia has also experienced a significant decline in rainfall over the last 30 years, resulting in increased vegetative water stress. To better understand the dynamics and responses of Australian forest ecosystems to drought and elevated CO2, the magnitude and trend in water use efficiency (WUE) of forests, and their response to drought and elevated CO2 from 1982 to 2014 were analysed, using the best available model estimates constrained by observed fluxes from simulations with fixed and time-varying CO2. The ratio of gross primary productivity (GPP) to evapotranspiration (ET) (WUEe) was used to identify the ecosystem scale WUE, while the ratio of GPP to transpiration (Tr) (WUEc) was used as a measure of canopy scale WUE. WUE increased significantly in northern Australia (p < 0.001) for woody savannas (WSA), whereas there was a slight decline in the WUE of evergreen broadleaf forests (EBF) in the southeast and southwest of Australia. The lag of WUEc to drought was consistent and relatively short and stable between biomes (≤3 months), but notably varied for WUEe, with a long time-lag (mean of 10 months). The dissimilar responses of WUEe and WUEc to climate change for different geographical areas result from the different proportion of Tr in ET. CO2 fertilization and a wetter climate enhanced WUE in northern Australia, whereas drought offset the CO2 fertilization effect in southern Australia.

Natural forests exhibit higher carbon sequestration and lower water consumption than planted forests in China.

Large-scale planted forests (PF) have been given a higher priority in China for improving the environment and mitigating climate change relative to natural forests (NF). However, the ecological consequences of these PF on water resource security have been less considered in the national scale. Moreover, a critically needed comparison on key ecological effects between PF and NF under climate change has rarely been conducted. Here, we compare carbon sequestration and water consumption in PF and NF across China using combination of remote sensing and field inventory. We found that, on average, NF consumed 6.8% (37.5 mm per growing season) less water but sequestered 1.1% (12.5 g C m-2  growing season-1 ) more carbon than PF in the period of 2000-2012. While there was no significant difference in water consumption (p = 0.6) between PF and NF in energy-limited areas (dryness index [DI] < 1), water consumption was significantly (p < 0.001) higher in PF than that in NF in water-limited regions (DI > 1). Moreover, a distinct and larger shift of water yield was identified in PF than in NF from the 1980s to the 2000s, indicating that PF were more sensitive to climate change, leading to a higher water consumption when compared with NF. Our results suggest NF should be properly valued in terms of maximizing the benefits of carbon sequestration and water yield. Future forest plantation projects should be planned with caution, particularly in water-limited regions where they might have less positive effect on carbon sequestration but lead to significant water yield reduction.

New zonal structure and transition of the membrane to mammillae in the eggshell of chicken Gallus domesticus.

Avian eggshell is a typical bio-engineered ceramics characterized by layer structures. These layers are categorized mainly by the form of crystalline calcite. Whether there exist other layer structures, how the membrane layer is transformed to the carbonate one, what form the carbonate takes after the transition. These questions remain to be clarified. Here we examine the eggshell of chicken Gallus domesticus by optical microscope, scanning electron microscope and transmission electron microscope. We find that there exists another layer structure defined by variation of organic matrices. The transition from the membrane to the mammillary cones is implemented through the calcium reserve assemblies or the mammillary cores. The integrity of the transitional structure was weakens as the reserved calcium is displaced, and loses completely in about 10 days of incubation. As the first deposited carbonate layer after the transition, the mammillary cones comprise amorphous calcium carbonate and clusters/assemblies of calcite crystallites the size about a nanometer, plus bubble pores extending preferentially in the lateral direction. Our results provide new insights into the structure and component of the avian eggshell, and may help decipher the constitution of the bio-ceramics in the perspective of material science.