Ionothermal Synthesis of Polyanionic Electrode Material Na3V2(PO4)2FO2 through a Topotactic Reaction.

Polyanionic Na3V2(PO4)2FO2 has been successfully prepared for the first time by ionothermal reaction in 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (EMIM TFSI) ionic liquid. Its structure and elemental stoichiometry are confirmed by X-ray diffraction, NMR spectroscopy, and ICP-OES, respectively. Furthermore, the scanning electron microscopy reveals that the as-obtained material possesses an original platelet-like morphology. A topochemical reaction mechanism is proposed to explain the formation of the 3D framework of Na3V2(PO4)2FO2 from layered compound α-VOPO4·2H2O. Galvanostatic electrochemical tests indicate a modification of the desodiation and sodiation mechanism of the as-prepared Na3V2(PO4)2FO2 compared to those synthesized by conventional solid-state approaches. Furthermore, the electrochemical performance of Na3V2(PO4)2FO2 obtained at different cycling rates is also discussed.

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China.

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Aluminum substitution for vanadium in the Na3V2(PO4)2F3 and Na3V2(PO4)2FO2 type materials.

Among the positive electrode materials for Na-ion batteries, Na3V2(PO4)2F3 is considered as one of the most promising and generates high interest. Here, we study the influence of the sol-gel synthesis parameters on the structure and on the electrochemical signature of the partially substituted Na3V2-zAlz(PO4)2(F,O)3 materials. We demonstrate that the acidity of the starting solution influences the vanadium oxidation state of the final product. For the first time we report on the possibility of controlling the double Al/V and O/F substitution that leads to the preparation of the Na3V2-zAlz(PO4)2F1+zO2-z solid solution.

Monitoring the Crystal Structure and the Electrochemical Properties of Na3(VO)2(PO4)2F through Fe3+ Substitution.

We here present the synthesis of a new material, Na3(VO)Fe(PO4)2F2, by the sol-gel method. Its atomic and electronic structural descriptions are determined by a combination of several diffraction and spectroscopy techniques such as synchrotron X-ray powder diffraction and synchrotron X-ray absorption spectroscopy at V and Fe K edges, 57Fe Mössbauer, and 31P solid-state nuclear magnetic resonance spectroscopy. The crystal structure of this newly obtained phase is similar to that of Na3(VO)2(PO4)2F, with a random distribution of Fe3+ ions over vanadium sites. Even though Fe3+ and V4+ ions situate on the same crystallographic position, their local environment can be studied separately using 57Fe Mössbauer and X-ray absorption spectroscopy at Fe and V K edges, respectively. The Fe3+ ion resides in a symmetric octahedral environment, while the octahedral site of V4+ is greatly distorted due to the presence of the vanadyl bond. No electrochemical activity of the Fe4+/Fe3+ redox couple is detected, at least up to 5 V, whereas the reduction of Fe3+ to Fe2+ has been observed at ∼1.5 V versus Na+/Na through the insertion of 0.5 Na+ into Na3(VO)Fe(PO4)2F2. Comparing to Na3(VO)2(PO4)2F, the electrochemical profile of Na3(VO)Fe(PO4)2F2 in the same cycling condition shows a smaller polarization which could be due to a slight improvement in Na+ diffusion process thanks to the presence of Fe3+ in the framework. Furthermore, the desodiation mechanism occurring upon charging is investigated by operando synchrotron X-ray diffraction and operando synchrotron X-ray absorption at V K edge.

Preparation of an insulin with improved pharmacokinetics relative to human insulin through consideration of structural homology with insulin-like growth factor I.

The Diabetes Control and Complications Trial has emphasized the need for improved control of blood glucose as a means to diminish long-term complications of diabetes. LysPro-insulin is an analog of human insulin whose design was modeled on structural homology with insulin-like growth factor I. An analysis of the structural conformation of insulin suggested that an inversion of amino acids B28 and B29 in the C-terminus of the B chain could yield an insulin analog with a faster onset of biological action. This insulin analog has proved to be virtually identical to human insulin in action, with one important exception. LysPro-insulin has demonstrated an improved time course of action in control of a mealtime glucose elevation. This offers the opportunity for improved convenience and safety for patients with insulin-dependent diabetes mellitus.

Detection of an equilibrium intermediate in the folding of a monomeric insulin analog.

To determine the conformational properties of the C-terminal region of the insulin B-chain relative to the helical core of the molecule, we have investigated the fluorescence properties of an insulin analog in which amino acids B28 and B29 have been substituted with a tryptophan and proline residue respectively, ([WB28,PB29]insulin). The biological properties and far-UV circular dichroism (CD) spectrum of the molecule indicate that the conformation is similar to that of native human insulin. Guanidine hydrochloride (GdnHCl)-induced equilibrium denaturation of the analog as monitored by CD intensity at 224 nm indicates a single cooperative transition with a midpoint of 4.9 M GdnHCl. In contrast, when the equilibrium denaturation is observed by steady-state fluorescence emission intensity at 350 nm, two distinct transitions are observed. The first transition accounts for 60% of the observed signal and has a midpoint of 1.5 M GdnHCl. The second transition roughly parallels that observed by CD measurements with an approximate midpoint of 4.5 M GdnHCl. The near-UV CD spectrum, size-exclusion, and ultracentrifugation properties of [WB28,PB29]insulin indicate that this analog does not self-associate in a concentration-dependent manner as does human insulin. Thus, the observed fluorescence changes must be due to specific conformational transitions which occur upon unfolding of the insulin monomer with the product of the first transition representing a stable folding intermediate of this molecule.

(A-C-B) human proinsulin, a novel insulin agonist and intermediate in the synthesis of biosynthetic human insulin.

The hormone insulin is synthesized in the beta cell of the pancreas as the precursor, proinsulin, where the carboxyl terminus of the B-chain is connected to the amino terminus of the A-chain by a connecting or C-peptide. Proinsulin is a weak insulin agonist that possesses a longer in vivo half-life than does insulin. A form of proinsulin clipped at the Arg65-Gly66 bond has been shown to be more potent than the parent molecule with protracted in vivo activity, presumably as a result of freeing the amino terminal residue of the A-chain. To generate a more active proinsulin-like molecule, we have constructed an "inverted" proinsulin molecule where the carboxyl terminus of the A-chain is connected to the amino terminus of the B-chain by the C-peptide, leaving the critical Gly1 residue free. Transformation of Escherichia coli with a plasmid coding for A-C-B human proinsulin led to the stable production of the protein. By a process of cell disruption, sulfitolysis, anion-exchange chromatography, refolding, and reversed-phase high-performance liquid chromatography, two forms of the inverted proinsulin differing at their amino termini as Gly1 and Met0-Gly1 were identified and purified to homogeneity. Both proteins were shown by a number of analytical techniques to be of the inverted sequence, with insulin-like disulfide bonding. Biological analyses by in vitro techniques revealed A-C-B human proinsulin to be intermediate in potency when compared to human insulin and proinsulin. The time to maximal lowering of blood glucose in the fasted normal rat appeared comparable to that of proinsulin. Additionally, we were able to generate fully active, native insulin from A-C-B human proinsulin by proteolytic transformation. The results of this study lend themselves to the generation of novel insulin-like peptides while providing a simplified route to the biosynthetic production of insulin.

Improved insulin stability through amino acid substitution.

Insulin analogs designed to decrease self-association and increase absorption rates from subcutaneous tissue were found to have altered stability. Replacement of HB10 with aspartic acid increased stability while substitutions at B28 and/or B29 were either comparable to insulin or had decreased stability. The principal chemical degradation product of accelerated storage conditions was a disulfide-linked multimer that was formed through a disulfide interchange reaction which resulted from beta-elimination of the disulfides. The maintenance of the native state of insulin was shown to be important in protecting the disulfides from reduction by dithiothreitol and implicitly from the disulfide interchange reaction that occurs during storage. To understand how these amino acid changes alter chemical stability, the intramolecular conformational equilibria of each analog was assessed by equilibrium denaturation. The Gibbs free energy of unfolding was compared with the chemical stability during storage for over 20 analogs. A significant positive correlation (R2 = 0.8 and P less than 0.0005) exists between the conformational stability and chemical stability of these analogs, indicating that the chemical stability of insulin's disulfides is under the thermodynamic control of the conformational equilibria.

Altering the association properties of insulin by amino acid replacement.

The importance of ProB28 and LysB29 on the self-association of insulin was established by systematically truncating the C terminus of the B chain. The relationship between structure and association was further explored by making numerous amino acid replacements at B28 and B29. Association was studied by circular dichroism, size-exclusion chromatography and ultracentrifugation. Our results show that the location of a prolyl residue at B28 is critical for high-affinity self-association. Removal of ProB28 in a series of C-terminal truncated insulins, or amino acid replacement of ProB28, greatly reduced association. The largest disruption to association was achieved by replacing LysB29 with Pro and varying the amino acid at B28. Several of the analogs were predominantly monomers in solutions up to 3 mg/ml. These amino acid substitutions decreased association by primarily disrupting the formation of dimers. Such amino acid substitutions also substantially reduced the Zn-induced insulin hexamer formation. The formation of monomeric insulins through amino acid replacements was accompanied by conformational changes that may be the cause for decreased association. It is demonstrated that self-association of insulin can be drastically altered by substitution of one or two key amino acids.

Modifications in the B10 and B26-30 regions of the B chain of human insulin alter affinity for the human IGF-I receptor more than for the insulin receptor.

Inversion of the natural sequence of the B chain of human insulin (HI) from ProB28LysB29 to LysB28ProB29 generates an insulin analogue with reduced tendency to self-associate. Since this substitution increases the homology of insulin to insulin-like growth factor-I (IGF-I), we have examined the affinity of a series of insulin analogues with the general modified structure XaaB28ProB29 HI for binding to both human placental insulin and IGF-I receptors. The XaaB28ProB29 HI series is approximately equipotent to HI in binding to the insulin receptor with the exception of when Xaa = Phe, Trp, Leu, Ile, and Gly (40-60% relative to HI). Substitution with basic residues in the B28 position increased the relative affinity to the IGF-I receptor approximately 1.5-2-fold (ArgB28ProB29 > OrnB28ProB29 = LysB28ProB29). Substitution with acidic residues reduced relative affinity for the IGF-I receptor approximately 2-fold (CyaB28ProB29 = GluB28ProB29 > AspB28ProB29). Combination of AspB10 substitution in conjunction with a modification in the B28-29 position (e.g. AspB10LysB28ProB29 HI) showed an additional 2-fold selective increase in affinity for the IGF-I receptor, suggesting that these two effects are additive. Addition of Arg residues at B31-32, on the backbone of either HI or AspB10 HI, increased affinity for the IGF-I receptor 10 and 28 fold, respectively, compared to HI, confirming the significance of enhanced positive charge at the C-terminal end of the insulin B-chain in increasing selectivity for the IGF-I receptor. This relative increase in IGF-I receptor affinity correlated largely, but not completely, with enhanced growth promoting activity in human mammary epithelial cells. In the case of LysB28ProB29 HI, growth activity correlated with dissociation kinetics from the insulin receptor which were shown to be identical with those of human insulin.