RESUMO
Throughout evolution, arboviruses have developed various strategies to counteract the host's innate immune defenses to maintain persistent transmission. Recent studies have shown that, in addition to bacteria and fungi, the innate Toll-Dorsal immune system also plays an essential role in preventing viral infections in invertebrates. However, whether the classical Toll immune pathway is involved in maintaining the homeostatic process to ensure the persistent and propagative transmission of arboviruses in insect vectors remain unclear. In this study, we revealed that the transcription factor Dorsal is actively involved in the antiviral defense of an insect vector (Laodelphax striatellus) by regulating the target gene, zinc finger protein 708 (LsZN708), which mediates downstream immune-related effectors against infection with the plant virus (Rice stripe virus, RSV). In contrast, an antidefense strategy involving the use of the nonstructural-protein (NS4) to antagonize host antiviral defense through competitive binding to Dorsal from the MSK2 kinase was employed by RSV; this competitive binding inhibited Dorsal phosphorylation and reduced the antiviral response of the host insect. Our study revealed the molecular mechanism through which Toll-Dorsal-ZN708 mediates the maintenance of an arbovirus homeostasis in insect vectors. Specifically, ZN708 is a newly documented zinc finger protein targeted by Dorsal that mediates the downstream antiviral response. This study will contribute to our understanding of the successful transmission and spread of arboviruses in plant or invertebrate hosts.
Assuntos
Arbovírus , Hemípteros , Oryza , Tenuivirus , Animais , Arbovírus/genética , Hemípteros/fisiologia , Tenuivirus/fisiologia , Insetos Vetores , Antivirais/metabolismo , Oryza/genética , Doenças das PlantasRESUMO
Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.
RESUMO
The Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway is an evolutionarily conserved signaling pathway that can regulate various biological processes. However, the role of JAK-STAT pathway in the persistent viral infection in insect vectors has rarely been investigated. Here, using a system that comprised two different plant viruses, Rice stripe virus (RSV) and Rice black-streaked dwarf virus (RBSDV), as well as their insect vector small brown planthopper, we elucidated the regulatory mechanism of JAK-STAT pathway in persistent viral infection. Both RSV and RBSDV infection activated the JAK-STAT pathway and promoted the accumulation of suppressor of cytokine signaling 5 (SOCS5), an E3 ubiquitin ligase regulated by the transcription factor STAT5B. Interestingly, the virus-induced SOCS5 directly interacted with the anti-apoptotic B-cell lymphoma-2 (BCL2) to accelerate the BCL2 degradation through the 26S proteasome pathway. As a result, the activation of apoptosis facilitated persistent viral infection in their vector. Furthermore, STAT5B activation promoted virus amplification, whereas STAT5B suppression inhibited apoptosis and reduced virus accumulation. In summary, our results reveal that virus-induced JAK-STAT pathway regulates apoptosis to promote viral infection, and uncover a new regulatory mechanism of the JAK-STAT pathway in the persistent plant virus transmission by arthropod vectors.
Assuntos
Tenuivirus , Viroses , Animais , Janus Quinases/metabolismo , Transdução de Sinais , Fatores de Transcrição STAT/metabolismo , Tenuivirus/metabolismo , Insetos Vetores , Proteínas Proto-Oncogênicas c-bcl-2/metabolismoRESUMO
A negative-strand symbiotic RNA virus, tentatively named Nilaparvata lugens Bunyavirus (NLBV), was identified in the brown planthopper (BPH, Nilaparvata lugens). Phylogenetic analysis indicated that NLBV is a member of the genus Mobuvirus (family Phenuiviridae, order Bunyavirales). Analysis of virus-derived small interfering RNA suggested that antiviral immunity of BPH was successfully activated by NLBV infection. Tissue-specific investigation showed that NLBV was mainly accumulated in the fat-body of BPH adults. Moreover, NLBV was detected in eggs of viruliferous female BPHs, suggesting the possibility of vertical transmission of NLBV in BPH. Additionally, no significant differences were observed for the biological properties between NLBV-infected and NLBV-free BPHs. Finally, analysis of geographic distribution indicated that NLBV may be prevalent in Southeast Asia. This study provided a comprehensive characterization on the molecular and biological properties of a symbiotic virus in BPH, which will contribute to our understanding of the increasingly discovered RNA viruses in insects.
Assuntos
Hemípteros , Orthobunyavirus , Vírus de RNA , Animais , Feminino , Filogenia , Insetos , Vírus de RNA/genéticaRESUMO
The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.
Assuntos
Genoma Viral , Hemípteros , Fases de Leitura Aberta , Filogenia , Vírus de RNA , RNA Viral , Animais , Hemípteros/virologia , Genoma Viral/genética , RNA Viral/genética , Vírus de RNA/genética , Vírus de RNA/classificação , Vírus de RNA/isolamento & purificação , Doenças das Plantas/virologia , Oryza/virologia , Sequenciamento Completo do Genoma , RNA Interferente Pequeno/genéticaRESUMO
Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.
RESUMO
Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.
RESUMO
Numerous plant viruses that cause significant agricultural problems are persistently transmitted by insect vectors. We wanted to see if apoptosis was involved in viral infection process in the vector. We found that a plant reovirus (rice gall dwarf virus, RGDV) induced typical apoptotic response during viral replication in the leafhopper vector and cultured vector cells, as demonstrated by mitochondrial degeneration and membrane potential decrease. Fibrillar structures formed by nonstructural protein Pns11 of RGDV targeted the outer membrane of mitochondria, likely by interaction with an apoptosis-related mitochondrial protein in virus-infected leafhopper cells or nonvector insect cells. Such association of virus-induced fibrillar structures with mitochondria clearly led to mitochondrial degeneration and membrane potential decrease, suggesting that RGDV Pns11 was the inducer of apoptotic response in insect vectors. A caspase inhibitor treatment and knockdown of caspase gene expression using RNA interference each reduced apoptosis and viral accumulation, while the knockdown of gene expression for the inhibitor of apoptosis protein improved apoptosis and viral accumulation. Thus, RGDV exploited caspase-dependent apoptotic response to promote viral infection in insect vectors. For the first time, we directly confirmed that a nonstructural protein encoded by a persistent plant virus can induce the typical apoptotic response to benefit viral transmission by insect vectors.
Assuntos
Apoptose/fisiologia , Hemípteros/virologia , Reoviridae/metabolismo , Animais , Linhagem Celular , Células Cultivadas , Colágenos Fibrilares/metabolismo , Insetos Vetores/virologia , Insetos/metabolismo , Mitocôndrias/metabolismo , Mitocôndrias/virologia , Membranas Mitocondriais/metabolismo , Membranas Mitocondriais/virologia , Vírus de Plantas/metabolismo , Reoviridae/genética , Reoviridae/patogenicidade , Reoviridae/fisiologia , Proteínas não Estruturais Virais/metabolismo , Replicação ViralRESUMO
Diaphorina citri reovirus (DcRV) was previously identified based on metagenomics surveys for virus discovery. Here, we demonstrated that DcRV induces persistent infection in its psyllid host, Diaphorina citri DcRV was efficiently vertically passed to offspring in a biparental manner. Transmission electron microscopic and immunological analyses showed that the DcRV-encoded nonstructural protein P10 assembled into a virion-packaging tubular structure which is associated with the spread of DcRV throughout the bodies of D. citri insects. P10 tubules containing virions were associated with oocytes of female and sperm of male D. citri insects, suggesting a role in the highly efficient biparental transmission of DcRV. Knocking down P10 by RNA interference for males reduced the percentage of DcRV-infected progeny and for females reduced the viral accumulation in progeny. These results, for the first time, show that a nonstructural protein of a novel insect reovirus provides a safe and pivotal channel for virus spread and biparental transmission to progeny.IMPORTANCE The Asian citrus psyllid, Diaphorina citri Kuwayama, is an important pest in the worldwide citrus industry. It is the vector of "Candidatus Liberibacter asiaticus," the bacterial pathogen of Huanglongbing, which is currently considered the most destructive disease of citrus worldwide. DcRV was previously identified based on metagenomics surveys for virus discovery. Here, we found that this novel and persistent insect reovirus took advantage of a virus-encoded nonstructural protein, P10, for efficient vertical transmission from parents to progeny. P10 assembled into a virion-packaging tubular structure and was associated with oocytes of female D. citri and sperm of males. Consistent with this, knockdown of P10 for either male or female D. citri insects inhibited DcRV transmission to offspring. This tubular strategy for viral spread and biparental transmission might serve as a target for controlling viral vertical transmission and population expansion.
Assuntos
Hemípteros/virologia , Transmissão Vertical de Doenças Infecciosas , Multimerização Proteica , Infecções por Reoviridae/veterinária , Reoviridae/isolamento & purificação , Proteínas não Estruturais Virais/metabolismo , Estruturas Animais/virologia , Animais , Masculino , Oócitos/virologia , Infecções por Reoviridae/transmissão , Espermatozoides/virologiaRESUMO
On acid soils, the trivalent aluminium ion (Al3+ ) predominates and is very rhizotoxic to most plant species. For some native plant species adapted to acid soils including tea (Camellia sinensis), Al3+ has been regarded as a beneficial mineral element. In this study, we discovered that Al3+ is actually essential for tea root growth and development in all the tested varieties. Aluminum ion promoted new root growth in five representative tea varieties with dose-dependent responses to Al3+ availability. In the absence of Al3+ , the tea plants failed to generate new roots, and the root tips were damaged within 1 d of Al deprivation. Structural analysis of root tips demonstrated that Al was required for root meristem development and activity. In situ morin staining of Al3+ in roots revealed that Al mainly localized to nuclei in root meristem cells, but then gradually moved to the cytosol when Al3+ was subsequently withdrawn. This movement of Al3+ from nuclei to cytosols was accompanied by exacerbated DNA damage, which suggests that the nuclear-targeted Al primarily acts to maintain DNA integrity. Taken together, these results provide novel evidence that Al3+ is essential for root growth in tea plants through maintenance of DNA integrity in meristematic cells.
Assuntos
Alumínio/farmacologia , Camellia sinensis/crescimento & desenvolvimento , Raízes de Plantas/crescimento & desenvolvimento , Camellia sinensis/efeitos dos fármacos , Camellia sinensis/ultraestrutura , Núcleo Celular/efeitos dos fármacos , Núcleo Celular/metabolismo , Dano ao DNA , DNA de Plantas/metabolismo , Concentração de Íons de Hidrogênio , Meristema/efeitos dos fármacos , Meristema/crescimento & desenvolvimento , Raízes de Plantas/efeitos dos fármacos , Raízes de Plantas/ultraestrutura , PrótonsRESUMO
Many viral pathogens are persistently transmitted by insect vectors and cause agricultural or health problems. Generally, an insect vector can use autophagy as an intrinsic antiviral defense mechanism against viral infection. Whether viruses can evolve to exploit autophagy to promote their transmission by insect vectors is still unknown. Here, we show that the autophagic process is triggered by the persistent replication of a plant reovirus, rice gall dwarf virus (RGDV) in cultured leafhopper vector cells and in intact insects, as demonstrated by the appearance of obvious virus-containing double-membrane autophagosomes, conversion of ATG8-I to ATG8-II and increased level of autophagic flux. Such virus-containing autophagosomes seem able to mediate nonlytic viral release from cultured cells or facilitate viral spread in the leafhopper intestine. Applying the autophagy inhibitor 3-methyladenine or silencing the expression of Atg5 significantly decrease viral spread in vitro and in vivo, whereas applying the autophagy inducer rapamycin or silencing the expression of Torc1 facilitate such viral spread. Furthermore, we find that activation of autophagy facilitates efficient viral transmission, whereas inhibiting autophagy blocks viral transmission by its insect vector. Together, these results indicate a plant virus can induce the formation of autophagosomes for carrying virions, thus facilitating viral spread and transmission by its insect vector. We believe that such a role for virus-induced autophagy is common for vector-borne persistent viruses during their transmission by insect vectors.
Assuntos
Autofagia/fisiologia , Hemípteros/virologia , Insetos Vetores/virologia , Vírus de Plantas/metabolismo , Reoviridae/fisiologia , Animais , Linhagem Celular , Insetos/virologia , Vírion/metabolismo , Replicação Viral/genéticaRESUMO
Numerous viral pathogens are persistently transmitted by insect vectors and cause agricultural or health problems. These viruses circulate in the vector body, enter the salivary gland, and then are released into the apical plasmalemma-lined cavities, where saliva is stored. The cavity plasmalemma of vector salivary glands thus represents the last membrane barrier for viral transmission. Here, we report a novel mechanism used by a persistent virus to overcome this essential barrier. We observed that the infection by rice gall dwarf virus (RGDV), a species of the genus Phytoreovirus in the family Reoviridae, induced the formation of virus-associated filaments constructed by viral nonstructural protein Pns11 within the salivary glands of its leafhopper vector, Recilia dorsalis Such filaments attached to actin-based apical plasmalemma and induced an exocytosis-like process for viral release into vector salivary gland cavities, through a direct interaction of Pns11 of RGDV and actin of R. dorsalis Failure of virus-induced filaments assembly by RNA interference with synthesized double-stranded RNA targeting the Pns11 gene inhibited the dissemination of RGDV into salivary cavities, preventing viral transmission by R. dorsalis For the first time, we show that a virus can exploit virus-induced inclusion as a vehicle to pass through the apical plasmalemma into vector salivary gland cavities, thus overcoming the last membrane barrier for viral transmission by insect vectors.IMPORTANCE Understanding how persistent viruses overcome multiple tissue and membrane barriers within the insect vectors until final transmission is the key for viral disease control. The apical plasmalemma of the cavities where saliva is stored in the salivary glands is the last barrier for viral transmission by insect vectors; however, the mechanism is still poorly understood. Here we show that a virus has evolved to exploit virus-induced filaments to perform an exocytosis-like process that enables viral passage through the apical plasmalemma into salivary cavities. This mechanism could be extensively exploited by other persistent viruses to overcome salivary gland release barriers in insect vectors, opening new perspectives for viral control.
Assuntos
Hemípteros/virologia , Reoviridae/fisiologia , Proteínas não Estruturais Virais/metabolismo , Liberação de Vírus , Actinas/metabolismo , Animais , Exocitose , Insetos Vetores/virologia , Microscopia de Fluorescência , Interferência de RNA , RNA de Cadeia Dupla/metabolismo , Reoviridae/ultraestrutura , Glândulas Salivares/ultraestrutura , Glândulas Salivares/virologia , Células Sf9 , Montagem de Vírus , Replicação ViralRESUMO
UNLABELLED: Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 10(9) copies of the SRBSDV P10 gene/µg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. IMPORTANCE: Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the midgut epithelium of an incompetent vector, the small brown planthopper (SBPH). Here, we show that silencing of the core component Dicer-2 of the small interfering RNA (siRNA) pathway increases viral titers in the midgut epithelium past the threshold (1.99 × 10(9) copies of the SRBSDV P10 gene/µg of midgut RNA) for viral dissemination into the midgut muscles and then into the salivary glands, allowing the SBPH to become a competent vector of SRBSDV. This result is the first evidence that the siRNA antiviral pathway has a direct role in the control of viral dissemination from the midgut epithelium and that it affects the competence of the virus's vector.
Assuntos
Hemípteros/virologia , RNA Interferente Pequeno/metabolismo , Reoviridae/crescimento & desenvolvimento , Reoviridae/imunologia , Animais , Células Cultivadas , Epitélio/imunologia , Epitélio/virologia , Trato Gastrointestinal/imunologia , Trato Gastrointestinal/virologiaRESUMO
UNLABELLED: Rice ragged stunt virus (RRSV), an oryzavirus in the family Reoviridae, is transmitted by the brown planthopper, Nilaparvata lugens, in a persistent-propagative manner. Here, we established a continuous cell line of brown planthopper to investigate the mechanism underlying the formation of the viroplasm, the putative site for viral replication and assembly, during infection of RRSV in its insect vector cells. Within 24 h of viral infection of cultured cells, the viroplasm had formed and contained the viral nonstructural proteins Pns6 and Pns10, known to be constituents of viroplasm. Core capsid protein P3, core particles, and newly synthesized viral RNAs were accumulated inside the viroplasm, while outer capsid protein P8 and virions were accumulated at the periphery of the viroplasm, confirming that the viroplasm induced by RRSV infection was the site for viral replication and assembly. Pns10 formed viroplasm-like inclusions in the absence of viral infection, suggesting that the viroplasm matrix was largely composed of Pns10. Pns6 was recruited in the viroplasm by direct interaction with Pns10. Core capsid protein P3 was recruited to the viroplasm through specific association with Pns6. Knockdown of Pns6 and Pns10 expression using RNA interference inhibited viroplasm formation, virion assembly, viral protein expression, and viral double-stranded RNA synthesis. Thus, the present study shows that both Pns6 and Pns10 of RRSV play important roles in the early stages of viral life cycle in its insect vector cells, by recruiting or retaining components necessary for viral replication and assembly. IMPORTANCE: The brown planthopper, a commonly distributed pest of rice in Asia, is the host of numerous insect endosymbionts, and the major vector of two rice viruses (RRSV and rice grassy stunt virus). For the first time, we successfully established the continuous cell line of brown planthopper. The unique uniformity of brown planthopper cells in the monolayer can support a consistent, synchronous infection by endosymbionts or viral pathogens, improving our understanding of molecular insect-microbe interactions.
Assuntos
Insetos Vetores/virologia , Reoviridae/fisiologia , Cultura de Vírus/métodos , Replicação Viral , Animais , Técnicas de Cultura de Células , Células Cultivadas , Hemípteros/virologia , Reoviridae/crescimento & desenvolvimento , Proteínas não Estruturais Virais/genética , Proteínas não Estruturais Virais/metabolismoRESUMO
UNLABELLED: The plant reoviruses, plant rhabdoviruses, tospoviruses, and tenuiviruses are transmitted by insect vectors in a persistent propagative manner. These viruses induce the formation of viral inclusions to facilitate viral propagation in insect vectors. The intestines of insect vectors are formed by epithelial cells that lie on the noncellular basal lamina surrounded by visceral muscle tissue. Here, we demonstrate that a recently identified plant reovirus, southern rice black-streaked dwarf virus (SRBSDV), exploits virus-containing tubules composed of virus-encoded nonstructural protein P7-1 to directly cross the basal lamina from the initially infected epithelium toward visceral muscle tissues in the intestine of its vector, the white-backed planthopper (Sogatella furcifera). Furthermore, such tubules spread along visceral muscle tissues through a direct interaction of P7-1 and actin. The destruction of tubule assembly by RNA interference with synthesized double-stranded RNA targeting the P7-1 gene inhibited viral spread in the insect vector in vitro and in vivo. All these results show for the first time that a virus employs virus-induced tubule as a vehicle for viral spread from the initially infected midgut epithelium through the basal lamina, facilitating the rapid dissemination of virus from the intestine of the insect vector. IMPORTANCE: Numerous plant viruses are transmitted in a persistent manner by sap-sucking insects, including thrips, aphids, planthoppers, and leafhoppers. These viruses, ingested by the insects, establish their primary infection in the intestinal epithelium of the insect vector. Subsequently, the invading virus manages to transverse the basal lamina, a noncellular layer lining the intestine, a barrier that may theoretically hinder viral spread. The mechanism by which plant viruses cross the basal lamina is unknown. Here, we report that a plant virus has evolved to exploit virus-induced tubules to pass through the basal lamina from the initially infected midgut epithelium of the insect vector, thus revealing the previously undescribed pathway adapted by the virus for rapid dissemination of virions from the intestine of the insect vector.
Assuntos
Hemípteros/virologia , Insetos Vetores/virologia , Oryza/virologia , Doenças das Plantas/virologia , Reoviridae/fisiologia , Vírion/fisiologia , Animais , Membrana Basal/virologia , Sistema Digestório/virologia , Epitélio/virologia , Corpos de Inclusão Viral/metabolismo , Reoviridae/genética , Proteínas não Estruturais Virais/genética , Proteínas não Estruturais Virais/metabolismo , Vírion/genética , Replicação ViralRESUMO
Plant reoviruses are thought to replicate and assemble within cytoplasmic, nonmembranous structures called viroplasms. Here, we established continuous cell cultures of the white-backed planthopper (Sogatella furcifera Horváth) to investigate the mechanisms for the genesis and maturation of the viroplasm induced by Southern rice black-streaked dwarf virus (SRBSDV), a fijivirus in the family Reoviridae, during infection of its insect vector. Electron and confocal microscopy revealed that the viroplasm consisted of a granular region, where viral RNAs and nonstructural proteins P6 and P9-1 accumulated, and a filamentous region, where viral RNAs, progeny cores, viral particles, as well as nonstructural proteins P5 and P6 accumulated. Our results suggested that the filamentous viroplasm matrix was the site for the assembly of progeny virions. Because viral RNAs were produced by assembled core particles within the filamentous viroplasm matrix, we propose that these viral RNAs might be transported to the granular viroplasm matrix. P5 formed filamentous inclusions and P9-1 formed granular inclusions in the absence of viral infection, suggesting that the filamentous and granular viroplasm matrices were formed primarily by P5 and P9-1, respectively. P6 was apparently recruited in the whole viroplasm matrix by direct interaction with P9-1 and P5. Thus, the present results suggested that P5, P6, and P9-1 are collectively required for the genesis and maturation of the filamentous and granular viroplasm matrix induced by SRBSDV infection. Based on these results, we propose a new model to explain the genesis and maturation of the viroplasms induced by fijiviruses in insect vector cells.
Assuntos
Hemípteros , Insetos Vetores/virologia , Reoviridae/metabolismo , Reoviridae/fisiologia , Proteínas não Estruturais Virais/metabolismo , Animais , Técnicas de Cultura de Células , Hemípteros/ultraestrutura , Hemípteros/virologia , Microscopia Confocal , Microscopia Eletrônica de Transmissão , RNA Viral/genética , RNA Viral/metabolismo , Reoviridae/genética , Proteínas não Estruturais Virais/genética , Vírion/genética , Vírion/metabolismo , Replicação ViralRESUMO
Rice dwarf virus (RDV) replicates in and is transmitted by a leafhopper vector in a persistent-propagative manner. Previous cytopathologic and genetic data revealed that tubular structures, constructed by the nonstructural viral protein Pns10, contain viral particles and are directly involved in the intercellular spread of RDV among cultured leafhopper cells. Here, we demonstrated that RDV exploited these virus-containing tubules to move along actin-based microvilli of the epithelial cells and muscle fibers of visceral muscle tissues in the alimentary canal, facilitating the spread of virus in the body of its insect vector leafhoppers. In cultured leafhopper cells, the knockdown of Pns10 expression due to RNA interference (RNAi) induced by synthesized dsRNA from Pns10 gene strongly inhibited tubule formation and prevented the spread of virus among insect vector cells. RNAi induced after ingestion of dsRNA from Pns10 gene strongly inhibited formation of tubules, preventing intercellular spread and transmission of the virus by the leafhopper. All these results, for the first time, show that a persistent-propagative virus exploits virus-containing tubules composed of a nonstructural viral protein to traffic along actin-based cellular protrusions, facilitating the intercellular spread of the virus in the vector insect. The RNAi strategy and the insect vector cell culture provide useful tools to investigate the molecular mechanisms enabling efficient transmission of persistent-propagative plant viruses by vector insects.
Assuntos
Vetores Artrópodes/virologia , Doenças das Plantas/virologia , Vírus de Plantas/metabolismo , Proteínas não Estruturais Virais/metabolismo , Animais , Vetores Artrópodes/genética , Vetores Artrópodes/metabolismo , Linhagem Celular , Insetos , Vírus de Plantas/genética , Vírus de Plantas/patogenicidade , Vírus de Plantas/ultraestrutura , Proteínas não Estruturais Virais/genéticaRESUMO
Numerous virus pathogens are transmitted by specific arthropod vectors. Understanding the mechanism of transmission is a critical step in the epidemiology of plant viruses and is crucial for the development of effective disease control strategies. In this study, we describe the localization and distribution of Wheat dwarf virus (WDV), an economically important and widespread single-stranded DNA virus, in its leafhopper vector, Psammotettix alienus. The results suggest that WDV not only can move to the salivary glands from the anterior and middle midgut via the hemocoel but also can pass directly through the sheath of the filter chamber and be readily transmitted to healthy wheat plants within 5 min of an acquisition access period on infected plants. When a bacterial-expressed recombinant capsid protein (CP) was incubated with the internal organs of leafhoppers, CP-immunoreactive antigens were found at the anterior and middle midgut. Furthermore, when leafhoppers were fed with an antiserum raised against the CP, the accumulation of WDV in the gut cells, hemocoel, and salivary glands was significantly reduced. These data provide evidence that transmission of WDV is determined by a CP-mediated virion-vector retention mechanism.
Assuntos
Geminiviridae/fisiologia , Hemípteros/virologia , Insetos Vetores/virologia , Doenças das Plantas/virologia , Triticum/virologia , Animais , Proteínas do Capsídeo/genética , Proteínas do Capsídeo/metabolismo , Hemípteros/citologia , Insetos Vetores/citologia , Ninfa , Proteínas Recombinantes , Fatores de TempoRESUMO
Herbivorous insects harbor a variety of insect-specific viruses (ISVs) some of which are considered to be valuable biological agents for potential applications in biological defense and control strategies. Leaf beetles with chewing mouthparts are particularly known for their capacity to disrupt plant tissue while feeding, often creating openings that can act as entry points for plant pathogens. In this study, we have identified two new negative-sense RNA viruses infecting the leaf beetle Aulacophora indica, an important member of the Chrysomelidae family. These recently discovered viruses belong to the viral families Nyamiviridae and Chuviridae and have been preliminarily named Aulacophora indica nyami-like virus 1 (AINlV1) and Aulacophora indica chu-like virus 1 (AIClV1), respectively. The complete genomic sequences of these viruses were obtained using rapid amplification of cDNA ends (RACE) techniques. Detailed analysis of their genomic structures has confirmed their similarity to other members within their respective families. Furthermore, analysis of virus-derived small interfering RNA (vsiRNA) demonstrated a high abundance and typical vsiRNA pattern of AINlV1 and AIClV1, offering substantial evidence to support their classification as ISVs. This research enhances our understanding of viral diversity within insects.
RESUMO
Agricultural insects play a crucial role in transmitting plant viruses and host a considerable number of insect-specific viruses (ISVs). Among these insects, the white-backed planthoppers (WBPH; Sogatella furcifera, Hemiptera: Delphacidae) are noteworthy rice pests and are responsible for disseminating the southern rice black-streaked dwarf virus (SRBSDV), a significant rice virus. In this study, we analyzed WBPH transcriptome data from public sources and identified three novel viruses. These newly discovered viruses belong to the plant-associated viral family Solemoviridae and were tentatively named Sogatella furcifera solemo-like virus 1-3 (SFSolV1-3). Among them, SFSolV1 exhibited a prevalent existence in different laboratory populations, and its complete genome sequence was obtained using rapid amplification of cDNA ends (RACE) approaches. To investigate the antiviral RNA interference (RNAi) response in WBPH, we conducted an analysis of virus-derived small interfering RNAs (vsiRNAs). The vsiRNAs of SFSolV1 and -2 exhibited typical patterns associated with the host's siRNA-mediated antiviral immunity, with a preference for 21- and 22-nt vsiRNAs derived equally from both the sense and antisense genomic strands. Furthermore, we examined SFSolV1 infection and distribution in WBPH, revealing a significantly higher viral load of SFSolV1 in nymphs' hemolymph compared to other tissues. Additionally, in adult insects, SFSolV1 exhibited higher abundance in male adults than in female adults.