First Report of Impatiens Downy Mildew Outbreaks Caused by Plasmopara obducens Throughout the Hawai'ian Islands.

Downy mildew of impatiens (Impatiens walleriana Hook.f.) was first reported from the continental United States in 2004. In 2011 to 2012, severe and widespread outbreaks were documented across the United States mainland, resulting in considerable economic losses. On May 5, 2013, downy mildew disease symptoms were observed from I. walleriana 'Super Elfin' at a retail nursery in Mililani, on the Hawai'ian island of Oahu. Throughout May and June 2013, additional sightings of the disease were documented from the islands of Oahu, Kauai, Maui, and Hawai'i from nurseries, home gardens, and botanical park and landscape plantings. Symptoms of infected plants initially showed downward leaf curl, followed by a stippled chlorotic appearance on the adaxial leaf surfaces. Abaxial leaf surfaces were covered with a layer of white mycelia. Affected plants exhibited defoliation, flower drop, and stem rot as the disease progressed. Based on morphological and molecular data, the organism was identified as Plasmopara obducens (J. Schröt.) J. Schröt. Microscopic observation disclosed coenocytic mycelium and hyaline, thin-walled, tree-like (monopodial branches), straight, 94.0 to 300.0 × 3.2 to 10.8 µm sporangiophores. Ovoid, hyaline sporangia measuring 11.0 to 14.6 × 12.2 to 16.2 (average 13.2 × 14.7) µm were borne on sterigma tips of rigid branchlets (8.0 to 15.0 µm) at right angle to the main axis of the sporangiophores (1,3). Molecular identification of the pathogen was conducted by removing hyphae from the surface of three heavily infected leaves using sterile tweezers, then extracting DNA using the QIAGEN Plant DNA kit (QIAGEN, Gaithersburg, MD). The nuclear rDNA internal transcribed spacer was sequenced from each of the three samples bidirectionally from Illustra EXOStar (GE Healthcare, Piscataway, NJ) purified amplicon generated from primers ITS1-O and LR-0R (4). Resultant sequences (GenBank KF366378 to 80) shared 99 to 100% nucleotide identity with P. obducens accession DQ665666 (4). A voucher specimen (BPI892676) was deposited in the U.S. National Fungus Collections, Beltsville, MD. Pathogenicity tests were performed by spraying 6-week-old impatiens plants (I. walleriana var. Super Elfin) grown singly in 4-inch pots with a suspension of 1 × 104 P. obducens sporangia/ml until runoff using a handheld atomizer. Control plants were sprayed with distilled water. The plants were kept in high humidity by covering with black plastic bags for 48 h at 20°C, and then maintained in the greenhouse (night/day temperature of 20/24°C). The first symptoms (downward curling and chlorotic stippling of leaves) and sporulation of the pathogen on under-leaf surfaces of the inoculated plants appeared at 10 days and 21 days after inoculation, respectively. Control plants remained healthy. Morphological features and measurements matched those of the original inoculum, thus fulfilling Koch's postulates. To our knowledge, this is the first report of downy mildew on I. walleriana in Hawai'i (2). The disease appears to be widespread throughout the islands and is likely to cause considerable losses in Hawai'ian landscapes and production settings. References: (1) O. Constantinescu. Mycologia 83:473, 1991. (2) D. F. Farr and A. Y. Rossman. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ July 16, 2013. (3) P. A. Saccardo. Syllogue Fungorum 7:242, 1888. (4) M. Thines. Fungal Genet Biol 44:199, 2007.

First Report of Rust Caused by Pucciniastrum boehmeriae on Mamaki (Pipturus albidus) in Hawaii.

Pipturus albidus (Hook. & Arn.) A. Gray or mamaki is a flowering plant species in the Urticaceae (nettles) endemic to the Hawaiian Islands. Mamaki is a forest and agricultural commodity, as well as a traditional medicinal and fiber crop. In August 2013, leaf rust was observed in Kuristown, Hawaii, on 15 mamaki plants. Infected leaves had vein-delimited chlorotic spots on the adaxial surface and yellow to orange uredinia on the abaxial surface. Uredinia were scattered, minute, pulverulent, subepidermal, and dome-shaped with a central pore, consistent with Pucciniastrum. Urediniospores were 16 to 23 × 10 to 14 µm, echinulate, ellipsoid to pyriform, walls hyaline, 0.5 µm thick, contents pale yellow to bright yellow. No teliospores were observed. A voucher specimen was deposited in the U.S. National Fungus Collections (BPI 892695). The only species of Pucciniastrum previously known on Pipturus, Pucciniastrum pipturi Syd. [syn. Uredo pipturi (Syd.) Hirats. f.], has larger urediniospores, 26.5 to 40.0 × 19.5 to 27.5 µm, and is currently reported from Japan and the Philippines (3). The pathogen was identified as Pucciniastrum boehmeriae (Dietel) Syd. & P. Syd., which infects Boehmeria Jacq., also in the Urticaceae, and has urediniospores that are 18 to 27 × 13 to 18 µm and similar in shape (2). DNA was extracted from uredinial lesions and the nuclear ribosomal internal transcribed spacer (ITS2) region and the 5' end of large subunit (28S) rDNA were amplified and sequenced following the protocol of Aime (1). The resulting fragment (GenBank Accession No. KF711854) was 100% identical to authenticated and vouchered P. boehmeriae ITS2/28S rDNA sequences (AB221449 to AB221451 and AB221391 to AB221393) (4). Sequences from P. pipturi are not available for comparison, but host family, molecular, and morphological data support the identification of the rust as P. boehmeriae, which is found throughout eastern Asia. To our knowledge, this is the first report of P. boehmeriae on mamaki and the first report in Hawaii on any host. Plant health professionals and regulatory officials can utilize this information to establish survey methods and implement appropriate management practices for this rust disease. References: (1) M. C. Aime. Mycoscience 47:112, 2006. (2) N. Hiratsuka. Revision of Taxonomy of the Pucciniastreae. Kasai Publishing and Printing, Tokyo, 1958. (3) M. Kakishima and T. Kobayashi. Mycoscience 35:125, 1994. (4) Y.-M. Liang et al. Mycoscience 47:137, 2006.

First Report of Passalora Leaf Spot of Quinoa Caused by Passalora dubia in the United States.

The Andean seed crop quinoa, Chenopodium quinoa Willd., is an important export of Bolivia, Ecuador, and Peru. Key foliar diseases of quinoa include quinoa downy mildew (caused by Peronospora variabilis Gäum) (1), Ascochyta leaf spot (caused by Ascochyta sp.) (1), and a Cercospora-like leaf spot, the latter of which has been observed on cultivated quinoa (Jose B. Ochoa, unpublished) and native Chenopodium species. Passalora dubia (Riess) U. Braun (syn. Cercospora dubia) was tested in Europe as a biological control agent for Chenopodium album (3) and has been reported on C. album in the United States (U.S. National Fungus Collections). Quinoa field plots were established in Pennsylvania during summer 2011 and Cercospora-like leaf spot symptoms were first observed on quinoa in Centre Co. and Lancaster Co. in August 2011, after an extended rainy period. Foliar symptoms were round to oval, brown to grey-black lesions, less than 1 cm in diameter, with darker brown, reddish margins. Similar symptoms were observed on C. album weeds within both fields. Using a hand lens, conidia were observed within sporulating lesions. Conidia were hyaline and septate, 25 to 98 µm × 5 to 10 µm, and had an average of six cells per conidium. The fungus was isolated by picking single conidia from sporulating lesions (under a dissecting scope) and incubated on V8 agar in the dark at 20°C to induce sporulation. For DNA extraction, cultures were grown in potato dextrose broth amended with yeast extract. The internal transcribed spacer (ITS) region was amplified using primers ITS4 and ITS5 (2), and the resulting sequence shared 99% maximum identity with a vouchered isolate of P. dubia (GenBank EF535655). To test the pathogenicity of our P. dubia isolate, 5.9 × 103 conidia/ml (suspended in sterile water with 0.1% Tween 20) or the control solution with no conidia were sprayed, using an atomizer, onto 2-month-old quinoa plants, with 18 replications per treatment. Plants were covered with a humidity dome and maintained at >99% RH for 48 h. Plants were grown in the greenhouse at approximately 65% RH. After 1 month, circular to oval light brown lesions (<1 cm diameter) with darker margins were observed on approximately 10% of the leaves of inoculated plants, whereas no symptoms were observed on the control plants. Infected leaves were collected, incubated in a humidity chamber, and conidia were picked from sporulating lesions and inoculated onto V8 agar amended with 3% (w/v) fresh, ground quinoa plant tissue (4). Cultures were maintained at 20°C with 16-h photoperiod to induce sporulation. The identity of the reisolated fungus was confirmed morphologically and by DNA sequencing to be identical to the isolate used to test Koch's postulates. P. dubia was also isolated from C. album lesions and infected C. album may have served as a source of inoculum for quinoa. To our knowledge, this is the first report of Passalora leaf spot of quinoa in the United States. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) S. Goodwin et al. Phytopathology 91:648, 2001. (3) P. Scheepens et al. Integ. Pest. Man. Rev. 2:71, 1997. (4) M. Vathakos. Phytopathology 69:832, 1979.

First Report of Ascochyta Leaf Spot of Quinoa Caused by Ascochyta sp. in the United States.

The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 µm long by 5 to 10 µm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.

First Report of Quinoa Downy Mildew Caused by Peronospora variabilis in the United States.

Quinoa, Chenopodium quinoa Willd., is an Andean crop prized for its high nutritional value and adaptability to harsh environments. Quinoa is plagued by downy mildew caused by Peronospora variabilis Gäum (formerly Peronospora farinosa f. sp. chenopodii Byford) (1). Quinoa production has spread beyond native Andean ranges and quinoa downy mildew has been reported in India, Canada, and Denmark (1). During the summer of 2011, quinoa trials were established to determine the ability of quinoa to grow under Mid-Atlantic conditions and monitor for regional disease problems. In July, after cool, rainy conditions, downy mildew-like symptoms were observed on quinoa at research plots in Centre and Lancaster counties of Pennsylvania. Symptoms and signs consisted of irregularly shaped areas of foliar chlorosis or pink discoloration accompanied by dense, gray sporulation on both leaf surfaces. Sporangia were tan to gray-brown, semi-ovoid, often with a pedicel, mean length of 31 µm, and mean width of 23 µm. Sporangiophores branched dichotomously, and the terminal branchlets curved and tapered to a point. Orange oospores were present in field samples of leaf tissue. DNA was extracted from infected foliar tissue and sporangial suspensions. A seminested PCR protocol (2) was used to obtain partial internal transcribed spacer (ITS) sequences of six Peronospora isolates. The sequences shared 99% maximum identity to a known P. variabilis accession (FM863721.2) in GenBank. A voucher specimen was deposited into the U.S. National Fungus Collections (BPI 882064). Pathogenicity of each of two strains of P. variabilis was confirmed by inoculating quinoa with sporangia (4). Sporangia were shaken from leaves in sterile distilled water and the suspension was filtered through cheesecloth. A 0.01% Tween solution was added and the suspension diluted to 103 sporangia/ml. With an atomizer, a 10-ml sporangial suspension (or sterile water for noninoculated control plants) was sprayed onto one flat of 18 2-week-old quinoa plants, and relative humidity was increased to saturation using a humidity dome for 24 h. After 1 week, chlorosis and pink discoloration were noted on leaves of inoculated quinoa, and after 18 h of subsequent increased humidity (>95% relative humidity), dense gray sporulation was observed. No symptoms were noted on noninoculated control plants. Sporangia and sporangiophores were examined morphologically and confirmed to be P. variabilis, confirming Koch's postulates. For culture maintenance, 2-week-old quinoa leaves were placed onto a sporangial suspension on top of 1% water agar and maintained in a growth chamber at 20°C with 16 h of light per day. Quinoa downy mildew is seedborne (3) and initial infections may have occurred from oospores in the pericarp, despite intensive processing of consumable quinoa seeds to remove saponins. To our knowledge, this is the first report of quinoa downy mildew in the United States and also the first report of P. variabilis in the United States. References: (1) Y. Choi et al. Mycopathologia 169:403, 2010. (2) D. Cooke et al. Fungal Genet. Biol. 30:17, 2000. (3) S. Danielson et al. Seed Sci. Technol. 32:91, 2004. (4) J. Ochoa et al. Plant Pathol. 48:425, 1999.

First Report of Bamboo Rust Caused by Kweilingia divina on Bambusa domestica in Los Angeles County, California.

Elongate, interveinal, hypophyllous lesions were observed on bamboo plants (Bambusa domestica) during an inspection of a plant shipment in November of 2006 in Los Angeles County, CA. Disease incidence was 100%. Minute uredinia were spaced at regular intervals within each lesion. Urediniospores were pale tan, echinulate, and 18 to 29 × 16 to 23 µm with 1- to 1.5-µm walls. The urediniospores were surrounded and partially covered by incurved pale-to-brownish yellow paraphyses 34 to 45 × 12 µm with walls that were primarily thickened apically and dorsally to 5 µm. Several telia were observed forming inside old uredinia. Telia were brownish black, forming a flabellar head of teliospores fused laterally and in chains of three to six cells. Teliospores were chestnut brown, cuboidal to oblong, and measured 10 to 12.5 × 12.5 to 25 µm. DNA sequence of the 28S large subunit nuclear ribosomal DNA was obtained using previously published methods (1). The sequence deposited in GenBank as Accession No. EF192212 matched sequence No. DQ354554 (1), Kweilingia divina from Costa Rica (1), with 100% identity. On the basis of morphological characteristics (2) and sequence information, the rust was identified as K. divina (Syd.) Buriticá (= Dasturella divina (Syd.) Mundk. & Khesw.), causal agent of bamboo rust. Bamboo rust is widespread in parts of Asia but has also been found in Africa, Colombia, Brazil, Central America (3), and Australia (4). The shipment was traced to a foliage plant producer in Hawaii where the disease was subsequently found in the environment on the four major Hawaiian Islands of Oahu, Hawaii, Kauai, and Maui. All 10 bamboo plants received by the nursery were located and destroyed. To the best of our knowledge, this is the first report of bamboo rust occurring in California. References: (1) M. C. Aime. Mycoscience 47:112, 2006. (2) G. B. Cummins. Page 43 in: The Rust Fungi of Cereals, Grasses and Bamboos. Springer-Verlag, New York, 1971. (3) D. F. Farr et al. Fungal Databases, Systematic Mycology and Microbiology Laboratory. Online publication. ARS, USDA, year. (4) G. I. Johnson. Australas. Plant Pathol. 14:54, 1985.

First Report of Puccinia kuehnii, Causal Agent of Orange Rust of Sugarcane, in the United States and Western Hemisphere.

In June 2007, approximately 8 km east of Belle Glade, FL, a rust disease was observed on a sugarcane (a complex hybrid of Saccharum L. species) cultivar (CP 80-1743) considered resistant to brown rust caused by Puccinia melanocephala Syd. & P. Syd. Approximately 10 km south of Canal Point, FL, another cultivar (CP 72-2086), also considered resistant to P. melanocephala, was found to be infected with a rust. Samples were sent to the USDA-APHIS National Mycologist and the USDA-ARS Systematic Mycology and Microbiology Laboratory in Beltsville, MD for identification. Observed morphological features were consistent with P. kuehnii E.J. Butler. Uredinial lesions were orange and variable in size, measuring 650 to 850 × 26 to 32 µm, hypophyllous, ellipsoidal to fusiform in shape, and distinctly lighter than pustules of P. melanocephala that were present in the area along with P. kuehnii. Urediniospores were mostly obovoid to pyriform or broadly ellipsoidal, variable in size, 32 to 45 × 25 to 30 µm, and moderately echinulate with mostly evenly distributed spines 2 to 4.5 µm apart. Walls were orange-to-light cinnamon brown, 1 to 2.5 µm thick with a pronounced apical wall thickening as much as 7 µm, and 4 to 5 equatorial pores. Similar orange uredinial lesions were subsequently observed on the same two cultivars and several other cultivars, including CPCL99-1777 and CPCL01-1055, at different locations in South Florida. Telia and teliospores were not observed. The nuclear large subunit rDNA region of the rust infecting cv. CP 80-1743 (BPI 878243, GenBank Accession No. EU164549) and the ITS1, 5.8S, and ITS2 rDNA regions of the rust infecting CP 80-1743 (GenBank Accession No. EU176009) and CP 72-2086 (GenBank Accession No. EU176008) were sequenced (1,4). All sequences were identical to sequences of P. kuehnii and distinct from known sequences of P. melanocephala (4). To our knowledge, this is the first confirmed record of P. kuehnii infecting sugarcane in the Western Hemisphere, and the disease appears to be distributed widely in the South Florida sugarcane-growing area. Although listed by P. Holliday (3) as occurring in Cuba, the Dominican Republic, and Mexico, CMI map no. 215 ed. 4 (2) does not include these three countries in the known distribution of P. kuehnii. P. kuehnii has also been reported in the literature as present in Hawaii (4). However, examination of the specimen label found that the specimen cited in those papers (BPI 079624) was actually collected in Tahiti. Therefore, the report from Hawaii is erroneous. References: (1) M. C. Aime. Mycoscience 47:112, 2006. (2) CMI. Distribution Maps of Plant Diseases. No. 215, ed. 4. CAB International, Wallingford, UK, 1981. (3) P. Holliday. Fungus Diseases of Tropical Crops. Cambridge University Press, Cambridge, 1980. (4) E. V. Virtudazo et al. Mycoscience 42:447, 2001.

First Report of Uromyces transversalis, Causal Agent of Gladiolus Rust, in San Diego County, California.

In May 2006, signs and symptoms of a rust disease were observed on hybrid gladiolus plants in a home garden located in the city of San Diego, CA. Uredinial lesions were bright orange, variable in shape from globose to oval to transversely elongate, and measured 28 to 652 × 36 to 994 µm. Urediniospores measured 16 to 26 × 16 to 23 µm and had hyaline walls that were 2 µm thick and finely echinulate with recurved spines. Some uredinial lesions located primarily at the base of the leaves were surrounded by dark, irregular lesions (telia) by the epidermis. Telia contained nonseptate, light-to-chestnut brown teliospores that measured 20 to 30 × 13 to 20 µm with an apical thickening measuring 2 to 5 µm. Teliospore pedicels measured 3 to 33 × 2 to 5 µm. Groups of teliospores were separated into locules by upright, pale brown paraphyses. The rust was identified as Uromyces transversalis, the cause of gladiolus rust and a quarantine pest for the United States. An intensive 23 square mile survey was initiated and resulted in the detection of infected plants at one nearby residence 200 feet away, in a commercial nursery six miles east of the initial site of detection, and at a residence across the street from the infected nursery. Plants in the nursery were grown outdoors in three blocks, in which the disease incidences were 20, 80, and 100% with varying levels of severity. Telia were also found at this location. The nursery grows gladiolus flowers for sale at local farmer markets, sometimes supplemented by additional cut gladiolus from Mexico. U. transversalis is known to occur in Mexico (2). This rust is under eradication at all four sites. Gladiolus rust was reported in Florida in April 2006. To our knowledge, this is the first confirmed report of Gladiolus rust in California. References: (1) J. R. Hernández. Invasive Fungi. Gladiolus Rust. Systemic Botany and Mycology Laboratory, Online publication. ARS, USDA, 2004. (2) G. Rodríguez-Alvarado et al. Plant Dis. 90:687, 2006.

First Report of Asian Soybean Rust Caused by Phakopsora pachyrhizi on Soybean in Alabama.

On November 4, 2004, soybean leaves (Glycine max (L.) Merr) were submitted to the Auburn University Plant Diagnostic Lab by a State Department of Agriculture and Industries Inspector. Samples were collected from an 80-ha field of soybean plants in a late-reproductive-growth stage in Mobile County, Alabama. Under microscopic examination, leaves showed rust pustules in advanced stages of development with urediniospores and sori characteristic of Phakopsora spp. Uredinia were ostiolate in small, brown, angular leaf spots (2 to 3 mm) on lower leaf surfaces. Urediniospores were pale yellow-to-white, globose or ovate, 20 to 40 × 15 to 25 µm. In a subsequent visit to the field, symptoms and signs of the rust disease were observed on plants bordering the edge of the field since the majority of plants were senescent. Tan lesions on lower leaf surfaces contained small pustules surrounded by a small zone of slightly discolored necrotic tissue. Masses of tan spores covered the lower leaf surface pustules. Leaves were mailed overnight to the USDA National Identification Services (Mycology) Laboratory in Beltsville, MD. The fungal structures were confirmed to be a Phakopsora sp., and the sample was forwarded to the USDA National Plant Germplasm and Biotechnology Laboratory in Beltsville, MD. DNA was extracted from leaf pieces containing sori using the Qiagen DNeasy Plant Mini kit (Qiagen, Valencia, CA). Phakopsora pachyrhizi was detected using a real-time polymerase chain reaction (PCR) protocol (1) performed in a Cepheid SmartCycler (Sunnyvale, CA). The PCR master mix was modified to include OmniMix beads (Cepheid). The field and microscopic suspect diagnosis of P. pachyrhizi was confirmed officially by APHIS on November 18, 2004. This was the fourth USDA official confirmation of Asian soybean rust in the continental United States during 2004, and to our knowledge, this is the first report of the disease in Alabama. This report helps confirm that early occurrences of Asian soybean rust in the United States were present in other areas in addition to the first reported finding in Louisiana (2). References: (1) R. D. Frederick et al. Phytopathology 92:217, 2002. (2) R. W. Schneider et al. Plant Dis. 89:774, 2005.

First Report of Rust Caused by Phakopsora pachyrhizi on Soybean and Kudzu in Texas.

The Asian soybean rust fungus, Phakopsora pachyrhizi H. Sydow & Sydow, was found on a 0.4-ha patch of kudzu (Pueraria lobata) near Dayton (Liberty County) in East Texas on November 2, 2005. Nearly 100% of the 300 leaflets examined were diseased with severity ranging from 5 to >100 lesions per leaflet. Eleven soybean fields as much as 20 km away were scouted and no infected plants were found. Asian soybean rust was also found on a 0.4-ha field of soybean (Glycine max cv. Vernal) on February 14, 2006 at the Texas A&M Agricultural Experiment Station in Weslaco (Hidalgo County) in the Lower Rio Grande Valley (LRGV) of Texas. Disease incidence was 100% (severity ranging from 5 to >100 lesions per leaflet) on 50 younger plants with green leaves along the edges of the field, whereas most of the plants in this field had senesced. These plants were not symptomatic and were at the R6 stage (full seed) when this field was previously scouted on December 19, 2005. Lesions on leaflets of kudzu and soybean were small and angular with erumpent uredinia typical of P. pachyrhizi. Urediniospores were ovoid or globose, hyaline, and measured 25 to 30 × 14 to 21 µm. Leaf samples with pustules were positive for P. pachyrhizi using enzyme-linked immunosorbent assay (ELISA) (Envirologix, Portland, ME). Morphological and polymerase chain reaction (PCR) identification of P. pachyrhizi from kudzu and soybean samples were confirmed by the USDA-APHIS-PPQ NIS and CPHST laboratories in Beltsville, MD as previously described (2). The kudzu in East Texas is not likely to support overwintering of the pathogen because it usually dies back during the winter. Leaves at this site were dead by January 17, 2006. This is the southernmost infestation of kudzu in Texas known to us. In contrast, the LRGV has a subtropical climate that would favor year-round survival of the fungus (3). This area, where 120 to 160 ha of soybeans are grown, may be a source of inoculum for soybean rust epidemics in the Midwest. Spore movement would follow the same pattern as seen with cereal rusts (1). However, soybeans are typically absent from the LRGV between late December and early March, so survival of the fungus during this interval would require other hosts. Regardless of whether the fungus overwinters here, or moves in from elsewhere, the LRGV spring crop could serve as an early indicator of a potential rust epidemic. References: (1) M. G. Eversmeyer and C. L. Kramer. Annu. Rev. Phytopathol. 38:491, 2000. (2) J. M. Mullen et al. Plant Dis. 90:112, 2006. (3) S. Pivonia et al. Plant Dis. 89:678, 2005.

First Report of Soybean Rust Caused by Phakopsora pachyrhizi in North Carolina.

Asian soybean rust, caused by Phakopsora pachyrhizi Sydow, has been known to occur in the eastern hemisphere for nearly a century. More recently, it was reported from South America in 2002 and the continental United States in Louisiana in November 2004 (1,2). Subsequently, P. pachyrhizi was confirmed in Alabama, Arkansas, Georgia, Florida, Missouri, Mississippi, South Carolina, and Tennessee in 2004. Surveys conducted in North Carolina in late November 2004 failed to detect this pathogen. Symptoms of the disease were first observed on soybean (Glycine max (L.) Merr.) in North Carolina on 25 October 2005 in farmers' fields in the counties of Brunswick, Columbus, and Robeson. Typical pustules and urediniospores were readily apparent on infected leaves when viewed with a dissecting microscope. Urediniospores were obovoid to broadly ellipsoidal, hyaline to pale yellowish brown with a minutely echinulate thin wall, and measured 18 to 37 × 15 to 24 µm. This morphology is typical of soybean rust caused by P. pachyrhizi or P. meibomiae, the latter is a less aggressive species causing soybean rust in the western hemisphere (1). DNA was extracted from leaves containing sori using the Qiagen DNeasy Plant Mini kit (Valencia, CA). P. pachyrhizi was detected using a real-time polymerase chain reaction (PCR) protocol that differentiates between P. pachyrhizi and P. meibomiae in a Cepheid thermocycler (Sunnyvale, CA) with appropriate positive and negative controls. The PCR master mix was modified to include OmniMix beads (Cepheid). Field diagnosis of P. pachyrhizi was confirmed by the USDA/APHIS on 28 October 2005. Soybean rust was identified in subsequent surveys of soybean fields and leaf samples submitted by North Carolina Cooperative Extension Agents in an additional 15 counties. These samples also were assayed using a traditional PCR protocol and by the enzyme-linked immunosorbent assay protocol included in the EnviroLogix QualiPlate kit (Portland, ME) for soybean rust. Ten soybean specimens from 10 sites were confirmed positive by these methods. Disease was not found on three kudzu samples, although one kudzu sample was adjacent to a soybean field that was positive for P. pachyrhizi. Although soybean rust was eventually detected in 18 North Carolina counties in 2005, no soybean yield loss occurred since the pathogen was detected when more than 80% of the soybean crop was mature. To our knowledge, this is the first report of P. pachyrhizi in North Carolina and the northern most find on soybean in the continental United States in 2005. References: (1) R. D. Frederick et al. Phytopathology 92:217, 2002. (2) R. W. Schneider et al. Plant Dis. 89:774 2005.

First Report of Soybean Rust Caused by Phakopsora pachyrhizi on Kudzu (Pueraria montana var. lobata) in Kentucky.

Phakopsora pachyrhizi, the causal organism of soybean rust, was first observed in the continental United States on 6 November 2004 (2). On 11 November 2005, as part a national soybean rust monitoring effort, 75 leaves of kudzu (Pueraria montana var. lobata) were arbitrarily collected from a patch growing in Princeton, Caldwell County, Kentucky (37.106650°N, 87.886120°W) that had been periodically scouted for the presence of the disease since May 2005. Upon microscopic examination of the nonincubated sample, a small (˜2.0 cm2) area of one leaf exhibited lesions, uredinia, and urediniospores characteristic of those reported for P. pachyrhizi (the Asian species) and P. meibomiae (the New World species) (2). No other infected leaves were observed despite repeated visits to the site and collection and observation of nearly 200 leaves. On 16 November 2005, one-half of the symptomatic tissue was sent by overnight courier to the USDA/APHIS/PPQ/NIS Laboratory, Beltsville, MD and the other half was sent to the Southern Plant Diagnostic Network Laboratory (SPDN), University of Florida, Gainesville. Both laboratories confirmed that the rust was a Phakopsora spp. on the basis of morphological examination. The preliminary polymerase chain reaction (PCR) testing conducted by the SPDN according to Harmon et al. (1) indicated the presence of P. pachyrhizi that was confirmed by the USDA/NPGBL using the validated modified real-time PCR assay described previously (2). The field diagnosis of P. pachyrhizi and preliminary PCR results were officially confirmed by USDA/APHIS on 18 November 2005. To our knowledge, this is the first report of P. pachyrhizi on kudzu or any host in Kentucky, and currently, the northernmost report of soybean rust on any host in the continental United States. References: (1) P. F. Harmon et al. On-line publication, doi:10.1094/PHP-2005-0613-O1-RS. Plant Health Progress, 2005. (2) R. W. Schneider et al. Plant Dis. 89:774, 2005.

First Report of Soybean Rust Caused by Phakopsora pachyrhizi in the Continental United States.

Asian soybean rust, caused by Phakopsora pachyrhizi Sydow, has been known to occur in the eastern hemisphere for nearly a century. More recently, it was reported from Hawaii in 1994, eastern and southern Africa from 1996-1998, Nigeria in 2001, and Brazil and Paraguay in 2002. Aerobiological models suggested that urediniospores of the pathogen would be disseminated on wind currents to the continental United States in association with tropical storms if the disease became established north of the equator during hurricane season (U.S. Soybean Rust Detection and Aerobiological Modeling online publication at www.aphis.usda.gov/ppq/ ep/soybean_rust/ ). Since soybean rust was observed at approximately 5°N latitude in South America before several hurricanes impacted the continental United States in September 2004, it seems likely that the introduction was associated with at least one of these tropical storms, especially hurricane Ivan. Symptoms of the disease were first observed on soybean (Glycine max (L.) Merr.) in the continental United States on November 6, 2004 in a field near Baton Rouge, LA. Typical pustules and urediniospores on infected leaves were readily apparent when viewed with a dissecting microscope. Urediniospores were obovoid to broadly ellipsoidal, hyaline to pale yellowish brown with a minutely echinulate thin wall, and measured 18 to 37 × 15 to 24 µm. Paraphyses were cylindric to clavate and slightly thickened at the apex, colorless to pale yellowish brown, and 25-50 × 6-14 µm in size. This morphology is typical of Phakopsora pachyrhizi and P. meibomiae, a less aggressive, western hemisphere species (2). DNA was extracted from leaves containing sori using the Qiagen DNeasy Plant Mini kit. P. pachyrhizi was detected using a real-time polymerase chain reaction (PCR) protocol (1) that differentiates between P. pachyrhizi and P. meibomiae performed in a Cepheid thermocycler with appropriate positive and negative controls. The PCR master mix was modified to include OmniMix beads (Cepheid). The field diagnosis of P. pachyrhizi was confirmed officially by the USDA/APHIS on November 10, 2004, and this was followed on November 11, 2004 by a wide-ranging survey of soybean and kudzu (Pueraria sp.) in soybean production areas in southern and central Louisiana. Collections from this survey also were assayed as described above, and six soybean specimens from five sites were confirmed positive. The disease was not found on kudzu samples. To our knowledge, this is the first report of P. pachyrhizi in the continental United States. Voucher specimens have been placed in the USDA National Fungus Collection. References: (1) R. D. Frederick et al. Phytopathology 92:217, 2002. (2) Y. Ono et al. Mycol. Res. 96:825, 1992.