Unraveling the genetic complexities of combined retinal dystrophy and hearing impairment.

Usher syndrome, the most prevalent cause of combined hereditary vision and hearing impairment, is clinically and genetically heterogeneous. Moreover, several conditions with phenotypes overlapping Usher syndrome have been described. This makes the molecular diagnosis of hereditary deaf-blindness challenging. Here, we performed exome sequencing and analysis on 7 Mexican and 52 Iranian probands with combined retinal degeneration and hearing impairment (without intellectual disability). Clinical assessment involved ophthalmological examination and hearing loss questionnaire. Usher syndrome, most frequently due to biallelic variants in MYO7A (USH1B in 16 probands), USH2A (17 probands), and ADGRV1 (USH2C in 7 probands), was diagnosed in 44 of 59 (75%) unrelated probands. Almost half of the identified variants were novel. Nine of 59 (15%) probands displayed other genetic entities with dual sensory impairment, including Alström syndrome (3 patients), cone-rod dystrophy and hearing loss 1 (2 probands), and Heimler syndrome (1 patient). Unexpected findings included one proband each with Scheie syndrome, coenzyme Q10 deficiency, and pseudoxanthoma elasticum. In four probands, including three Usher cases, dual sensory impairment was either modified/aggravated or caused by variants in distinct genes associated with retinal degeneration and/or hearing loss. The overall diagnostic yield of whole exome analysis in our deaf-blind cohort was 92%. Two (3%) probands were partially solved and only 3 (5%) remained without any molecular diagnosis. In many cases, the molecular diagnosis is important to guide genetic counseling, to support prognostic outcomes and decisions with currently available and evolving treatment modalities.

Identification of genes involved in glaucoma pathogenesis using combined network analysis and empirical studies.

Glaucoma is a leading cause of blindness. We aimed in this study to identify genes that may make subtle and cumulative contributions to glaucoma pathogenesis. To this end, we identified molecular interactions and pathways that include transcription factors (TFs) FOXC1, PITX2, PAX6 and NFKB1 and various microRNAs including miR-204 known to have relevance to trabecular meshwork (TM) functions and/or glaucoma. TM tissue is involved in glaucoma pathogenesis. In-house microarray transcriptome results and data sources were used to identify target genes of the regulatory molecules. Bioinformatics analyses were done to filter TM and glaucoma relevant genes. These were submitted to network-creating softwares to define interactions, pathways and a network that would include the genes. The network was stringently scrutinized and minimized, then expanded by addition of microarray data and data on TF and microRNA-binding sites. Selected features of the network were confirmed by empirical studies such as dual luciferase assays, real-time PCR and western blot experiments and apoptosis assays. MYOC, WDR36, LTPBP2, RHOA, CYP1B1, OPA1, SPARC, MEIS2, PLEKHG5, RGS5, BBS5, ALDH1A1, NOMO2, CXCL6, FMNL2, ADAMTS5, CLOCK and DKK1 were among the genes included in the final network. Pathways identified included those that affect ECM properties, IOP, ciliary body functions, retinal ganglion cell viability, apoptosis, focal adhesion and oxidative stress response. The identification of many genes potentially involved in glaucoma pathology is consistent with its being a complex disease. The inclusion of several known glaucoma-related genes validates the approach used.

Effects of intravitreal connective tissue growth factor neutralizing antibody on choroidal neovascular membrane-associated subretinal fibrosis.

Connective tissue growth factor (CTGF) plays an essential role in the regulation of extracellular matrix proteins and pro-fibrotic and angiogenic factors. This experimental research was conducted to evaluate if CTGF is elevated after induction of a choroidal neovascular membrane (CNVM) and whether intravitreal anti-CTGF without and with intravitreal bevacizumab (IVB) may have any effect on the CNVM associated sub-retinal fibrosis. In adherence to ARRIVE guidelines, CNVM was induced by laser spots in the right eye retinas of ninety-four pigmented rats. Quantitative real-time reverse transcription PCR (qRT-PCR) and western-blot analysis were performed on sclerochoroidal tissues of forty-four rats before and at different time intervals after laser application. The remaining fifty rats were randomly divided into five groups after laser application. Group A received intravitreal injection of 2  µl of the 50 µg/ml anti-CTGF. In group B, intravitreal injection of 2  µl of 25 mg/ml bevacizumab was performed. Group C received 1  µl intravitreal anti-CTGF and 1  µl IVB. Group D did not receive any intravitreal injection as the control group. In group E, intravitreal injection of 2  µl of nonspecific purified mouse IgG antibody was performed as the placebo group. After two weeks, double immunohistochemistry was performed by isolectin B4 and anti-collagen type1 on the sclerochoroidal flat-mounts. Masked measurement of the fluorescent images of the CNVM and CNVM associated sub-retinal fibrosis areas was performed using the image J software. Ctgf mRNA and CTGF protein levels increased to the maximum level in 24 h after laser application and remained higher than the control level up to the 14th day for the Ctgf mRNA and up to the 7th day for the CTGF protein level. Means of CNVM associated sub-retinal fibrosis areas in three treatment groups (A, B and C) were significantly less than the control (D) and placebo (E) groups (P < 0.001, <0.05, <0.001 respectively). For groups A and C, mean CNVM associated sub-retinal fibrosis areas were also significantly less than group B (P < 0.05 and < 0.01, respectively). In conclusion, this study showed significant reduction of the CNVM associated sub-retinal fibrosis via inhibition of the CTGF which mediates the final steps of fibrosis in various inflammatory and angiogenic pathways.

Variable Expressivity of Wolfram Syndrome in a Family with Multiple Affected Subjects.

PURPOSE: To study the genetic basis and clinical manifestations of Wolfram syndrome in a multi-affected family. METHODS: Complete clinical examinations including urological, ophthalmic, neurological, and endocrinologic assessment were performed for three affected family members. Genomic DNA was extracted from peripheral blood leukocytes with salting out method and all WFS1 exons and their flanking regions were sequenced. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. RESULTS: A known pathogenic missense mutation in WFS1 gene (c.1885C > T which leads to p.Arg629Trp in the encoded protein) was identified in all affected individuals. Both clinical and genetic investigations confirmed Wolfram syndrome diagnosis with variable phenotypic features. CONCLUSION: Identical mutations in the Wolfram syndrome causative gene can lead to variable manifestations of the syndrome even in the same family. Although the medical findings and clinical examination are imperative for the diagnosis of Wolfram syndrome, genetic testing is useful to confirm the diagnosis, especially in cases with possible reduced penetrance of the characteristic signs.

Prenatal diagnosis of primary congenital glaucoma and histopathological features in a fetal globe with cytochrome p4501B1 mutations.

BACKGROUND/OBJECTIVES: This study aims to report the developmental and histopathological features of ocular tissues from an electively aborted human fetus with mutations in cytochrome p4501B1, and thus predisposed to primary congenital glaucoma in comparison to an age-matched healthy fetal globe. SUBJECTS/METHODS: Both eyes of two 17-week gestational aged fetuses, the first with CYP1B1 mutations and the second as healthy control fetus, were studied. Hematoxylin and eosin, Periodic acid-Schiff, Gomori's trichrome, and Verhoeff-Van Gieson staining protocols in addition to immunohistochemistry staining using anti-cytochrome p4501B1, anti-fibrillin-1, and anti-4-hydroxy-2-nonenal antibodies, as primary antibodies, were performed to assess the effect of the mutations on tissue development, cytochrome p4501B1 protein expression, extracellular matrix structure, and oxidative stress in the developing fetus eye. Quantitative analyses were performed using ImageJ software. Student's t-test was used for statistical analysis and P-values <0.05 were considered as significant. RESULTS: Delayed development in ocular tissues, decreased expression of cytochrome p4501B1 protein, irregular extracellular matrix structure, and increased oxidative stress biomarker were evident in the ocular tissues of the fetus with cytochrome p4501B1 mutations as compared to a normal globe from an age-matched fetus. CONCLUSION: To the best of our knowledge, this is the first report of prenatal diagnosis of primary congenital glaucoma. We also describe histopathological changes in the primary congenital glaucoma-affected globes revealing the effect of cytochrome p4501B1 deficiency on ocular tissues during early fetal development contributing to the glaucoma phenotype.

Multifunctional Theranostic Graphene Oxide Nanoflakes as MR Imaging Agents with Enhanced Photothermal and Radiosensitizing Properties.

The integration of multiple therapeutic and diagnostic functions into a single nanoplatform for image-guided cancer therapy has been an emerging trend in nanomedicine. We show here that multifunctional theranostic nanostructures consisting of superparamagnetic iron oxide (SPIO) and gold nanoparticles (AuNPs) scaffolded within graphene oxide nanoflakes (GO-SPIO-Au NFs) can be used for dual photo/radiotherapy by virtue of the near-infrared (NIR) absorbance of GO for photothermal therapy (PTT) and the Z element radiosensitization of AuNPs for enhanced radiation therapy (RT). At the same time, this nanoplatform can also be detected by magnetic resonance (MR) imaging because of the presence of SPIO NPs. Using a mouse carcinoma model, GO-SPIO-Au NF-mediated combined PTT/RT exhibited a 1.85-fold and 1.44-fold higher therapeutic efficacy compared to either NF-mediated PTT or RT alone, respectively, resulting in a complete eradication of tumors. As a sensitive multifunctional theranostic platform, GO-SPIO-Au NFs appear to be a promising nanomaterial for enhanced cancer imaging and therapy.

Triple combination of heat, drug and radiation using alginate hydrogel co-loaded with gold nanoparticles and cisplatin for locally synergistic cancer therapy.

Although multimodal cancer therapy has shown superior antitumor efficacy in comparison to individual therapy due to the potential generation of synergistic interactions among the treatments, its clinical usage is highly hampered by systemic dose-limiting toxicities. Herein, we developed a multi-responsive nanocomplex constructed from alginate hydrogel co-loaded with cisplatin and gold nanoparticles (AuNPs) (abbreviated as ACA) to combine chemotherapy, radiotherapy (RT) and photothermal therapy. The nanocomplex markedly improved the efficiency of drug delivery where ACA resulted in noticeably higher tumor growth inhibition than free cisplatin. The tumor treated with ACA showed an increased heating rate upon 532 nm laser irradiation, indicating the photothermal conversion ability of the nanocomplex. While RT alone resulted in slight tumor growth inhibition, thermo-chemo therapy, chemoradiation therapy and thermo-radio therapy using ACA dramatically slowed down the rate of tumor growth. Upon 532 nm laser and 6 MV X-ray, the nanocomplex could enable a trimodal thermo-chemo-radio therapy that yielded complete tumor regression with no evidence of relapse during the 90-days follow up period. The results of this study demonstrated that the incorporation of AuNPs and cisplatin into alginate hydrogel network can effectively combine chemotherapy, RT and photothermal therapy to achieve a locally synergistic cancer therapy.

Gold nanoparticles promote a multimodal synergistic cancer therapy strategy by co-delivery of thermo-chemo-radio therapy.

Multimodal cancer therapy has become a new trend in clinical oncology due to potential generation of synergistic therapeutic effects. Herein, we propose a multifunctional nanoplatform comprising alginate hydrogel co-loaded with cisplatin and gold nanoparticles (abbreviated as ACA) for triple combination of photothermal therapy, chemotherapy and radiotherapy (thermo-chemo-radio therapy). The therapeutic potential of ACA was assessed in combination with 532 nm laser and 6 MV X-ray against KB human mouth epidermal carcinoma cells. The results demonstrated that tri-modal thermo-chemo-radio therapy using ACA induced a superior anticancer efficacy than mono- or bi-modality treatments. The intracellular reactive oxygen species (ROS) level in KB cells treated with tri-modal therapy was increased by 4.4-fold compared to untreated cells. The gene expression analysis demonstrated the up-regulation of Bax pro-apoptotic factor (by 4.5-fold) and the down-regulation of Bcl-2 anti-apoptotic factor (by 0.3-fold). The massive cell injury and the appearance of morphological characteristics of apoptosis were also evident in the micrograph of KB cells caused by thermo-chemo-radio therapy. Therefore, ACA nanocomplex can be offered as a promising platform to combine photothermal therapy, chemotherapy and radiotherapy, thereby affording an opportunity for combating chemo- and radio-resistant tumors.

The First Inherited Retinal Disease Registry in Iran: Research Protocol and Results of a Pilot Study.

BACKGROUND: To describe the protocol for developing a national inherited retinal disease (IRD) registry in Iran and present its initial report. METHODS: This community-based participatory research was approved by the Ministry of Health and Medical Education of Iran in 2016. To provide the minimum data set (MDS), several focus group meetings were held. The final MDS was handed over to an engineering team to develop a web-based software. In the pilot phase, the software was set up in two referral centers in Iran. Final IRD diagnosis was made based on clinical manifestations and genetic findings. Ultimately, patient registration was done based on all clinical and non-clinical manifestations. RESULTS: Initially, a total of 151 data elements were approved with Delphi technique. The registry software went live at www. IRDReg.org based on DHIS2 open source license agreement since February 2016. So far, a total of 1001 patients have been registered with a mean age of 32.41±15.60 years (range, 3 months to 74 years). The majority of the registered patients had retinitis pigmentosa (42%, 95% CI: 38.9% to 45%). Genetic testing was done for approximately 20% of the registered individuals. CONCLUSION: Our study shows successful web-based software design and data collection as a proof of concept for the first IRD registry in Iran. Multicenter integration of the IRD registry in medical centers throughout the country is well underway as planned. These data will assist researchers to rapidly access information about the distribution and genetic patterns of this disease.

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment.

BACKGROUND: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6. METHODS: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression. RESULTS: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD). CONCLUSIONS: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.

PRPH2 mutation as the cause of various clinical manifestations in a family affected with inherited retinal dystrophy.

Background/Objectives: To reveal the underlying genetic defect in a complex family affected with different clinical features of inherited retinal dystrophy, we carried out whole exome sequencing followed by confirmatory molecular tests.Materials and Methods: Complete ophthalmic examinations were performed for available affected family members. Whole exome sequencing, bioinformatics analysis, Sanger sequencing confirmation, and segregation analysis were done to identify the causative mutation.Results: Clinical findings suggested fundus flavimaculatus as an early clinical feature progressing to an extensive chorioretinal atrophy involving the macula and mid-periphery of the fundus in one parent and central areolar chorioretinal dystrophy (CACD) as the most probable clinical diagnosis in another parent. Macular pattern dystrophy for one of their daughters and a Leber congenital amaurosis (LCA) like phenotype for the daughter with an early onset retinal dystrophy (EORD) phenotype was suggested. We found a known pathogenic nonsense variation in the PRPH2 gene (NM_000322: p.Gln239Ter). The parents with end stage fundus flavimaculatus and CACD diagnosis and their daughter with macular pattern dystrophy were heterozygous for the identified variant. The daughter affected with EORD/LCA like retinal dystrophy was homozygous for the same variation.Conclusions: In this family, the same pathogenic variant in PRPH2 gene showed a wide range of clinical features of extensive chorioretinal macular atrophy with flecks as fundus falvimaculatus to CACD and macular pattern dystrophy in the heterozygous inheritance pattern and early onset/LCA like retinal dystrophy in the patient who was homozygous for the causative variant.

Incomplete penetrance of CRX gene for autosomal dominant form of cone-rod dystrophy.

Purpose: Cone-rod dystrophy (CRD) is an inherited retinal dystrophy that is transmitted via different modes of inheritance. Mutations in more than 30 genes have been identified to cause the disease. We aimed to investigate the genetic agents of two unrelated cone-rod dystrophy affected Iranian families with autosomal recessive inheritance patterns. Methods: Whole-exome sequencing (WES) was performed for identification of the disease-causing mutations in the probands of both families. The candidate mutations were further confirmed by Sanger sequencing. Samples from five available members of each family were then sequenced for the mutations present in the probands. Comprehensive ocular examinations for all members of the families carrying the mutations were completed by ophthalmologists. Results: We identified a novel premature stop codon c.310C>T in CRX gene in heterozygote form in two symptomatic and two non-symptomatic members of one family (family-A), and a known CRX mutation c.122G>A in homozygote form in another (family B). c.122G>A has been reported to cause late-onset autosomal dominant form of the disease in previous studies. However, the middle-aged heterozygous carriers of the mutation in this family showed normal phenotype. Conclusion: The CRX gene has been previously linked to the autosomal dominant form of cone-rod dystrophy. We report incomplete penetrance of CRX gene for autosomal dominant form of the disease. Incomplete penetrance of the mutations may be partly caused by the influence of other genes in the complex genetic network underlying retinal regulation.