Delphi consensus on stereotactic ablative radiotherapy for oligometastatic and oligoprogressive renal cell carcinoma-a European Society for Radiotherapy and Oncology study endorsed by the European Association of Urology.

The purpose of this European Society for Radiotherapy and Oncology (ESTRO) project, endorsed by the European Association of Urology, is to explore expert opinion on the management of patients with oligometastatic and oligoprogressive renal cell carcinoma by means of stereotactic ablative radiotherapy (SABR) on extracranial metastases, with the aim of developing consensus recommendations for patient selection, treatment doses, and concurrent systemic therapy. A questionnaire on SABR in oligometastatic renal cell carcinoma was prepared by a core group and reviewed by a panel of ten prominent experts in the field. The Delphi consensus methodology was applied, sending three rounds of questionnaires to clinicians identified as key opinion leaders in the field. At the end of the third round, participants were able to find consensus on eight of the 37 questions. Specifically, panellists agreed to apply no restrictions regarding age (25 [100%) of 25) and primary renal cell carcinoma histology (23 [92%] of 25) for SABR candidates, on the upper threshold of three lesions to offer ablative treatment in patients with oligoprogression, and on the concomitant administration of immune checkpoint inhibitor. SABR was indicated as the treatment modality of choice for renal cell carcinoma bone oligometatasis (20 [80%] of 25) and for adrenal oligometastases 22 (88%). No consensus or major agreement was reached regarding the appropriate schedule, but the majority of the poll (54%-58%) retained the every-other-day schedule as the optimal choice for all the investigated sites. The current ESTRO Delphi consensus might provide useful direction for the application of SABR in oligometastatic renal cell carcinoma and highlight the key areas of ongoing debate, perhaps directing future research efforts to close knowledge gaps.

Measurement of the 2νßß Decay Half-Life of

We report on the results obtained with the global CUPID-0 background model, which combines the data collected in the two measurement campaigns for a total exposure of 8.82 kg×yr of ^{82}Se. We identify with improved precision the background sources within the 3 MeV energy region, where neutrinoless double ß decay of ^{82}Se and ^{100}Mo is expected, making more solid the foundations for the background budget of the next-generation CUPID experiment. Relying on the excellent data reconstruction, we measure the two-neutrino double ß-decay half-life of ^{82}Se with unprecedented accuracy: T_{1/2}^{2ν}=[8.69±0.05(stat)_{-0.06}^{+0.09}(syst)]×10^{19} yr.

Final Result on the Neutrinoless Double Beta Decay of

CUPID-0, an array of Zn^{82}Se cryogenic calorimeters, was the first medium-scale demonstrator of the scintillating bolometers' technology. The first project phase (March 2017-December 2018) allowed the most stringent limit on the neutrinoless double beta decay half-life of the isotope of interest, ^{82}Se, to be set. After a six month long detector upgrade, CUPID-0 began its second and last phase (June 2019-February 2020). In this Letter, we describe the search for neutrinoless double beta decay of ^{82}Se with a total exposure (phase I+II) of 8.82 kg yr^{-1} of isotope. We set a limit on the half-life of ^{82}Se to the ground state of ^{82}Kr of T_{1/2}^{0ν}(^{82}Se)>4.6×10^{24} yr (90% credible interval), corresponding to an effective Majorana neutrino mass m_{ßß}<(263-545) meV. We also set the most stringent lower limits on the neutrinoless decays of ^{82}Se to the 0_{1}^{+}, 2_{1}^{+}, and 2_{2}^{+} excited states of ^{82}Kr, finding 1.8×10^{23} yr, 3.0×10^{23} yr, and 3.2×10^{23} yr (90% credible interval) respectively.

Final Result of CUPID-0 Phase-I in the Search for the

CUPID-0 is the first pilot experiment of CUPID, a next-generation project for the measurement of neutrinoless double beta decay (0νDBD) with scintillating bolometers. The detector, consisting of 24 enriched and 2 natural ZnSe crystals, has been taking data at Laboratori Nazionali del Gran Sasso from June 2017 to December 2018, collecting a ^{82}Se exposure of 5.29 kg×yr. In this Letter we present the phase-I results in the search for 0νDBD. We demonstrate that the technology implemented by CUPID-0 allows us to reach the lowest background for calorimetric experiments: (3.5_{-0.9}^{+1.0})×10^{-3} counts/(keV kg yr). Monitoring 3.88×10^{25} ^{82}Se nuclei×yr we reach a 90% credible interval median sensitivity of T_{1/2}^{0ν}>5.0×10^{24} yr and set the most stringent limit on the half-life of ^{82}Se 0νDBD: T_{1/2}^{0ν}>3.5×10^{24} yr (90% credible interval), corresponding to m_{ßß}<(311-638) meV depending on the nuclear matrix element calculations.

Evidence of Single State Dominance in the Two-Neutrino Double-ß Decay of

We report on the measurement of the two-neutrino double-ß decay of ^{82}Se performed for the first time with cryogenic calorimeters, in the framework of the CUPID-0 experiment. With an exposure of 9.95 kg yr of Zn^{82}Se, we determine the two-neutrino double-ß decay half-life of ^{82}Se with an unprecedented precision level, T_{1/2}^{2ν}=[8.60±0.03(stat) _{-0.13}^{+0.19}(syst)]×10^{19} yr. The very high signal-to-background ratio, along with the detailed reconstruction of the background sources allowed us to identify the single state dominance as the underlying mechanism of such a process, demonstrating that the higher state dominance hypothesis is disfavored at the level of 5.5σ.

First Result on the Neutrinoless Double-ß Decay of

We report the result of the search for neutrinoless double beta decay of ^{82}Se obtained with CUPID-0, the first large array of scintillating Zn^{82}Se cryogenic calorimeters implementing particle identification. We observe no signal in a 1.83 kg yr ^{82}Se exposure, and we set the most stringent lower limit on the 0νßß ^{82}Se half-life T_{1/2}^{0ν}>2.4×10^{24} yr (90% credible interval), which corresponds to an effective Majorana neutrino mass m_{ßß}<(376-770) meV depending on the nuclear matrix element calculations. The heat-light readout provides a powerful tool for the rejection of α particles and allows us to suppress the background in the region of interest down to (3.6_{-1.4}^{+1.9})×10^{-3} counts/(keV kg yr), an unprecedented level for this technique.

Antifungal activity of essential oils against azole-resistant and azole-susceptible vaginal Candida glabrata strains.

Candida glabrata is an opportunistic pathogen, associated with endocarditis, meningitis, and disseminated disease, and also with complicated vaginitis. Essential oils derived from aromatic plants are known in traditional medicine as antimicrobial agents and have antifungal properties. The aim of this work was to evaluate whether 12 tested essential oils (tea tree, laurel, anise, basil, bergamot, lavender, mint, oregano, grapefruit, rosemary, winter savory, and ginger) could have a transverse effect on C. glabrata sensitive strains but above all on strains resistant to the three main azole antifungals used (clotrimazole, fluconazole, itraconazole). For this reason, different strains of C. glabrata, vaginal isolated, were characterized (disk diffusion assay, minimal inhibitory concentration) with respect to their response to such antifungals. Electron microscopy analyses were performed to examine cellular damages in depth. Subsequently, we wanted to evaluate the effect of the oils on human cells to estimate their potential cytotoxicity. Oregano and winter savory were the two most effective essential oils, inducing growth inhibition, cell damage of C. glabrata strains (both sensitive and resistant to azole antifungal drugs), and medium-high level of toxicity against human keratinocytes. The results of this work support the research for new alternatives or complementary therapies against vaginal candidiasis.

Effect of active component addition and support modification on catalytic activity of Ag/Al2O3 for the selective catalytic reduction of NOx by hydrocarbon - A review.

The effect of active component addition and support modification of Ag/Al2O3 has been reviewed to examine their contribution to HC-SCR of NOx. This review has depicted the possible mechanisms of reduction of NO by hydrocarbon using metal/metal oxide doped Ag/Al2O3. The addition of second metal results in the maximum formation of well dispersed Agnδ+ clusters. Specifically, addition of Au improves the low-temperature activity of the catalyst. However, the role of second metal also depends on the pretreatment to the catalyst and nature of the reductants. The support modification of Ag/Al2O3 by the addition of different metal oxides has also been reviewed. Modification by MgO showed improvement in activity besides sulfur tolerance. In situ DRIFT study demonstrates that the modification by MgO leads to the inhibition of sulfate formation of Ag and Al2O3. Enhancement in activity after second metal addition and support modification attributed to the synergistic effect and improved surface properties of Ag/Al2O3 catalyst.

Sensitivity of Candida albicans to essential oils: are they an alternative to antifungal agents?

AIMS: Candida albicans is an important opportunistic pathogen, responsible for the majority of yeast infections in humans. Essential oils, extracted from aromatic plants, are well-known antimicrobial agents, characterized by a broad spectrum of activities, including antifungal properties. The aim of this work was to assess the sensitivity of 30 different vaginal isolated strains of C. albicans to 12 essential oils, compared to the three main used drugs (clotrimazole, fluconazole and itraconazole). METHODS AND RESULTS: Thirty strains of C. albicans were isolated from vaginal swab on CHROMagar™ Candida. The agar disc diffusion method was employed to determine the sensitivity to the essential oils. The antifungal activity of the essential oils and antifungal drugs (clotrimazole, itraconazole and fluconazole) were investigated using a microdilution method. Transmission and scanning electron microscopy analyses were performed to get a deep inside on cellular damages. Mint, basil, lavender, tea tree oil, winter savory and oregano essential oils inhibited both the growth and the activity of C. albicans more efficiently than clotrimazole. Damages induced by essential oils at the cellular level were stronger than those caused by clotrimazole. CONCLUSIONS: Candida albicans is more sensitive to different essential oils compared to the main used drugs. Moreover, the essential oil affected mainly the cell wall and the membranes of the yeast. SIGNIFICANCE AND IMPACT OF THE STUDY: The results of this work support the research for new alternatives or complementary therapies against vaginal candidiasis.

Amphiphilic, hydrophilic, or hydrophobic synthetic bacteriochlorins in biohybrid light-harvesting architectures: consideration of molecular designs.

Biohybrid light-harvesting architectures can be constructed that employ native-like bacterial photosynthetic antenna peptides as a scaffold to which synthetic chromophores are attached to augment overall spectral coverage. Synthetic bacteriochlorins are attractive to enhance capture of solar radiation in the photon-rich near-infrared spectral region. The effect of the polarity of the bacteriochlorin substituents on the antenna self-assembly process was explored by the preparation of a bacteriochlorin-peptide conjugate using a synthetic amphiphilic bacteriochlorin (B1) to complement prior studies using hydrophilic (B2, four carboxylic acids) or hydrophobic (B3) bacteriochlorins. The amphiphilic bioconjugatable bacteriochlorin B1 with a polar ammonium-terminated tail was synthesized by sequential Pd-mediated reactions of a 3,13-dibromo-5-methoxybacteriochlorin. Each bacteriochlorin bears a maleimido-terminated tether for attachment to a cysteine-containing analog of the Rhodobacter sphaeroides antenna ß-peptide to give conjugates ß-B1, ß-B2, and ß-B3. Given the hydrophobic nature of the ß-peptide, the polarity of B1 and B2 facilitated purification of the respective conjugate compared to the hydrophobic B3. Bacteriochlorophyll a (BChl a) associates with each conjugate in aqueous micellar media to form a dyad containing two ß-peptides, two covalently attached synthetic bacteriochlorins, and a datively bonded BChl-a pair, albeit to a limited extent for ß-B2. The reversible assembly/disassembly of dyad (ß-B2/BChl)2 was examined in aqueous detergent (octyl glucoside) solution by temperature variation (15-35 °C). The energy-transfer efficiency from the synthetic bacteriochlorin to the BChl-a dimer was found to be 0.85 for (ß-B1/BChl)2, 0.40 for (ß-B2/BChl)2, and 0.85 for (ß-B3/BChl)2. Thus, in terms of handling, assembly and energy-transfer efficiency taken together, the amphiphilic design examined herein is more attractive than the prior hydrophilic or hydrophobic designs.

Concomitant nitrene and carbene insertion accompanying ring expansion: spectroscopic, X-ray, and computational studies.

Reinvestigation of the thermolysis of azido-meta-hemipinate (I) yielded, in addition to known II, unusual products III and IV. These products are formed via a rare intramolecular nitrene insertion into an adjacent methoxy C-H bond followed by an intermolecular reaction during a ring-expansion and a ring-extrusion reaction followed by a carbene insertion. The structures of the new compounds were confirmed using a battery of techniques, including HRMS (ESI-QTOF) and 2D NMR as well as X-ray crystallography for compound IV. Density functional theory methods were used to support the proposed mechanism of formation of the products.

Hydrophilic tetracarboxy bacteriochlorins for photonics applications.

Bacteriochlorins absorb strongly in the near-infrared (NIR, 700-900 nm) region and hence are well suited for photophysical studies and photomedical applications, yet such endeavors heretofore have been largely limited by the intrinsic lipophilicity of the bacteriochlorin macrocycle. Here, a new molecular design is investigated wherein 3,5-dicarboxyphenyl units are appended to the ß-pyrrolic positions of the bacteriochlorin. Use of the 3,5-aryl substitution motif places the carboxylic acid groups, which are anionic at neutral pH, above and below the plane of the bacteriochlorin macrocycle. A de novo synthesis has been employed to create five such bacteriochlorins, which uses as intermediates two new 2,12-dibromobacteriochlorin building blocks and a known 3,13-dibromobacteriochlorin. The aryl groups with protected carboxylate moieties were introduced by Suzuki coupling; subsequent deprotection afforded the hydrophilic bacteriochlorins. The latter were characterized by absorption and fluorescence spectroscopy in DMF and in aqueous phosphate buffer (pH 7). In most cases, comparable sharp emission (FWHM of ∼25 nm) and modest fluorescence yields (0.060-0.11) were observed in aqueous phosphate buffer medium and in DMF. Aqueous solubility was examined by absorption spectral interrogation of samples over a 1000-fold concentration range with reciprocal change in pathlength (∼0.5, 5, 50, and 500 µM; 10, 1, 0.1, and 0.01 cm pathlength cuvettes). One hydrophilic bacteriochlorin was prepared that contains a single maleimido-terminated tether for bioconjugation; the tether was installed by the sequence of 15-bromination of the bacteriochlorin, Suzuki coupling, and DCC-mediated amide formation. The maleimido-bacteriochlorin was conjugated to a 48-residue cysteine-containing peptide analogue of a constituent from a bacterial photosynthetic light-harvesting complex. Taken together, the results show a new molecular design and facile de novo synthetic route for obtaining hydrophilic bacteriochlorins including a bioconjugatable group if desired.

First Report of Garlic virus X in Garlic Plants in Brazil.

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5' CTACCACAAYGGNTCVTC 3') and Cpallexi-anti1 (5' CACNGCGTTRAAGAARTC 3') specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5' GCAGAATAARCCCCCYTC 3') and CPBA1 (5' RAAGGGTTTATTCTGTTG 3') obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5' GCCTTCTGAAAATGACTTAG 3') and CPXA1 (5' CTAGGATTTGCTGTTGGG 3') designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil. References: (1) M. S. Fayad-Andre et al. Trop. Plant Pathol. 36:341, 2011. (2) P. A. Melo Filho et al. Pesq. Agropec. Bras. 39:735, 2004. (3) R. J. Nascimento et al. Summa Phytopathol. 34:267, 2008.

Timely delivery of PORT for head and neck squamous cell carcinoma in a county hospital.

Objectives: The objective of this study was to compare the rate of post-operative radiation therapy (PORT) initiation within 6 weeks for head and neck squamous cell carcinoma patients treated at a safety net, academic institutio between 2019 and 2021 versus those treated in 2022 after implementation of a new clinical pathway. Methods: A retrospective case-control study was performed at a single tertiary care, safety-net, academic institution. Patient demographics, tumor characteristics, dates of surgery, and other treatment dates were collected from the electronic medical record. The time from surgery to PORT was calculated. Patients who started radiation treatment within 42 days of surgery were regarded as having started PORT on time. The demographics, tumor characteristics, and rate of timely PORT for the two cohorts of patients were compared. Results: From 2018 to 2021, our rate of PORT initiation within 6 weeks of surgery was 12% (n = 57). In 2022, our rate of timely PORT was 88% (n = 16), p < 0.5. Patient demographics and characteristics were similar with the exception of marital status and use of free-flap reconstruction. The 2022 cohort was more likely to be single (p < 0.5), and all patients underwent free-flap reconstruction in 2022 (p < 0.05). Conclusion: Early referrals, frequent communication, and use of a secure registry were the key to the success found by our group despite the socioeconomic challenges of our underserved, safety-net hospital patient population. The changes made at our institution should serve as a template for other institutions seeking to improve the quality of care for their HNSCC patients.

Room-Temperature Dialkylamination of Chloroheteroarenes Using a Cu(II)/PTABS Catalytic System.

The dimethylamino functionality has significant importance in industrially relevant molecules and methodologies to install these efficiently are highly desirable. We report herein a highly efficient, room-temperature dimethylamination of chloroheteroarenes performed via the in-situ generation of dimethylamine using N,N-dimethylformamide (DMF) as precursor wiith a large substrate scope that includes various heteroarenes, purines as well as commercially relevant drugs such as altretamine, ampyzine and puromycin precursor.

First measurement of the partial widths of 209Bi decay to the ground and to the first excited states.

209Bi alpha decay to the ground and to the first excited state have been recently observed for the first time with a large BGO scintillating bolometer. The half-life of 209Bi is determined to be τ(1/2)=(2.01±0.08)×10(19) yr while the branching ratio for the ground-state to ground-state transition is (98.8±0.3)%.

Regioselective synthesis and antimicrobial studies of ester linked 1,4-disubstituted 1,2,3-bistriazoles.

A series of 1,4-disubstituted 1,2,3-bistriazoles was synthesized via click chemistry by cycloaddition of various bisalkynes with benzyl/2-phenylethyl azide. Synthesized triazoles were characterized by IR, (1)H NMR, (13)C NMR and mass spectral techniques. All the compounds were evaluated for antibacterial/antifungal activities and found to possess moderate to good antimicrobial activities. Further the docking study for the most active compound against DNA Gyrase was also carried out.

Base catalysed synthesis of thiochromans and azo-linked chromenes using allenylphosphonates.

An efficient base catalysed approach to the synthesis of thiochromans/chromenes from allenylphosphonates (and an allenoate) and substrates having SH/OH and CHO groups at appropriate positions has been developed. Several azo-linked chromenes that are bright red pigments are also synthesized. This methodology involves the domino reactions of Michael addition and subsequent cyclisation by intramolecular aldol reaction.

A dose-response relationship for time to bone pain resolution after stereotactic body radiotherapy (SBRT) for renal cell carcinoma (RCC) bony metastases.

BACKGROUND: To investigate the utility of stereotactic body radiotherapy (SBRT) in the treatment of painful renal cell carcinoma (RCC) bone metastases, and for a possible dose effect on time to symptom relief. MATERIAL AND METHODS: Eighteen patients with 24 painful osseous lesions from metastatic RCC were treated with SBRT. The most common treatment regimens were 24 Gy in 3 fractions and 40 Gy in 5 fractions. The times from treatment to first reported pain relief and time to symptom recurrence were evaluated. Median follow-up was 38 weeks (1-156 weeks). RESULTS: Seventy-eight percent of all patients had pain relief. Patients treated with a BED > 85 Gy achieved faster and more durable pain relief compared to those treated with a BED < 85 Gy. There was decrease in time to pain relief after a change in treatment regimen to 8 Gy × 5 fractions (BED = 86). There was only one patient with grade 1 skin toxicity. No neurological or other toxicity was observed. CONCLUSIONS: SBRT can safely and effectively treat painful RCC bony metastases. There appears to be a relationship between radiation dose and time to stable pain relief.