Extended-Release Viloxazine Compared with Atomoxetine for Attention Deficit Hyperactivity Disorder.

BACKGROUND AND OBJECTIVE: In our outpatient pediatric and adult psychiatry centers, we reserve psychostimulants for predominantly inattentive attention deficit hyperactivity disorder (ADHD) due to the potential for appetite and growth suppression, insomnia, wear off, exacerbation of mood, anxiety, and tics, or misuse. We utilize extended-release (ER) alpha-2 agonists primarily for hyperactivity/impulsivity but find them less effective for inattention, and they can cause sedation and hypotension. Oftentimes, we need to combine an alpha-2 agonist for behavior with psychostimulants for inattention. We employ atomoxetine or viloxazine ER (VER) for combined ADHD. However, our patients' insurers mandate a trial of generic atomoxetine prior to covering branded VER. The objective of this study was to determine whether pediatric and adult patients taking atomoxetine for DSM-5-TR ADHD combined type would experience improvement in ADHD symptoms following voluntary, open-label switch to VER. METHODS: 50 patients (35 children) received mean doses of atomoxetine 60 mg (25-100 mg once daily) followed by VER 300 mg (100-600 mg once daily) after a 5-day atomoxetine washout. Both atomoxetine and VER were flexibly titrated according to US Food and Drug Administration (FDA) guidelines. The pediatric ADHD-Rating Scale-5 (ADHD-RS-5) and the Adult Investigator Symptom Rating Scale (AISRS) were completed prior to starting atomoxetine, and 4 weeks after treatment with atomoxetine or upon earlier response or discontinuation due to side effects, whichever occurred first; the same protocol was used after treatment with VER. We conducted a blinded, de-identified, retrospective review of charts from these 50 patients in the regular course of outpatient practice. Statistical analysis was performed using a within-subject, 2-tailed t-test with significance level of p < 0.05. RESULTS: From the baseline total ADHD-RS-5 mean score (40.3 ± 10.3), improvements were greater on VER (13.9 ± 10.2) than atomoxetine (33.1 ± 12.1; t = - 10.12, p < 0.00001) in inattention (t = - 8.57, p < 0.00001) and in hyperactivity/impulsivity (t = - 9.87, p < 0.00001). From the baseline total AISRS mean score (37.3 ± 11.8), improvements were greater on VER (11.9 ± 9.4) than atomoxetine (28.8 ± 14.9; t = - 4.18, p = 0.0009) in inattention (t = - 3.50, p < 0.004) and in hyperactivity/impulsivity (t = - 3.90, p < 0.002). Of patients on VER, 86% reported positive response by 2 weeks versus 14% on atomoxetine. A total of 36% discontinued atomoxetine for side effects, including gastrointestinal (GI) upset (6 patients), irritability (6), fatigue (5), and insomnia (1), versus 4% who discontinued VER due to fatigue. A total of 96% preferred VER over atomoxetine, with 85% (22 out of 26) choosing to taper psychostimulants following stabilization on VER. CONCLUSIONS: Pediatric and adult ADHD patients who have experienced less than optimal response to atomoxetine demonstrate rapid improvement in inattention and in hyperactivity/impulsivity with greater tolerability on extended-release viloxazine.

The Efficacy of Cannabis in Reducing Back Pain: A Systematic Review.

OBJECTIVE: To critically analyze the evidence and efficacy of cannabis to treat surgical and nonsurgical back pain via a Systematic Review. METHODS: We conducted a systematic review to investigate the efficacy of cannabis to treat non-surgical and surgical back pain. A literature search was performed with MEDLINE and Embase databases. Only RCTs and prospective cohort studies with concurrent control were included in this study. Risk of bias and quality grading was assessed for each included study. RESULTS: Database searches returned 1738 non-duplicated results. An initial screening excluded 1716 results. Twenty-two full text articles were assessed for eligibility. Four articles ultimately met pre-determined eligibility and were included in the study. Two studies addressed post-SCI pain while other two studies addressed low back pain. No studies specifically examined the use of cannabis for surgical back pain. The type of cannabis varied between study and included THC, dronabinol, and Nabilone. A total of 110 patients were included in the four studies reviewed. In each study, there was a quantifiable advantage of cannabis therapy for alleviating back pain. There were no serious adverse effects reported. CONCLUSIONS: In all articles, cannabis was shown to be effective to treat back pain with an acceptable side effect profile. However, long-term follow up is lacking. As medicinal cannabis is being used more commonly for analgesic effect and patients are "self-prescribing" cannabis for back pain, additional studies are needed for healthcare providers to confidently recommend cannabis therapy for back pain. STUDY DESIGN: Systematic review.

Cervical Total Disc Replacement: Complications and Complication Avoidance.

Cervical total disc replacement (CTDR) has gained popularity over the last 2 decades. It is a motion-preserving option to ACDF and is becoming more popular with patients and surgeons alike. Understanding complications that are unique to CTDR is crucial to performing successful, durable surgery. Careful patient selection and meticulous surgical technique are key to reducing complications associated with the surgery. Patient's should be followed closely after surgery with routine flexion/extension x-rays for early detection of any complications that may occur. Most complications can be observed with close follow-up. However, it is incumbent on the surgeon to recognize when revision surgery is necessary.

Diffusion Histology Imaging Combining Diffusion Basis Spectrum Imaging (DBSI) and Machine Learning Improves Detection and Classification of Glioblastoma Pathology.

PURPOSE: Glioblastoma (GBM) is one of the deadliest cancers with no cure. While conventional MRI has been widely adopted to examine GBM clinically, accurate neuroimaging assessment of tumor histopathology for improved diagnosis, surgical planning, and treatment evaluation remains an unmet need in the clinical management of GBMs. EXPERIMENTAL DESIGN: We employ a novel diffusion histology imaging (DHI) approach, combining diffusion basis spectrum imaging (DBSI) and machine learning, to detect, differentiate, and quantify areas of high cellularity, tumor necrosis, and tumor infiltration in GBM. RESULTS: Gadolinium-enhanced T1-weighted or hyperintense fluid-attenuated inversion recovery failed to reflect the morphologic complexity underlying tumor in patients with GBM. Contrary to the conventional wisdom that apparent diffusion coefficient (ADC) negatively correlates with increased tumor cellularity, we demonstrate disagreement between ADC and histologically confirmed tumor cellularity in GBM specimens, whereas DBSI-derived restricted isotropic diffusion fraction positively correlated with tumor cellularity in the same specimens. By incorporating DBSI metrics as classifiers for a supervised machine learning algorithm, we accurately predicted high tumor cellularity, tumor necrosis, and tumor infiltration with 87.5%, 89.0%, and 93.4% accuracy, respectively. CONCLUSIONS: Our results suggest that DHI could serve as a favorable alternative to current neuroimaging techniques in guiding biopsy or surgery as well as monitoring therapeutic response in the treatment of GBM.

Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA ß-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.

Hydrocephalus presenting as idiopathic aqueductal stenosis with subsequent development of obstructive tumor: report of 2 cases demonstrating the importance of serial imaging.

The authors describe 2 cases of triventricular hydrocephalus initially presenting as aqueductal stenosis that subsequently developed tumors of the pineal and tectal region. The first case resembled late-onset idiopathic aqueductal stenosis on serial imaging. Subsequent imaging revealed a new tumor in the pineal region causing mass effect on the midbrain. The second case presented in a more typical pattern of aqueductal stenosis during infancy. On delayed follow-up imaging, an enlarging tectal mass was discovered. In both cases hydrocephalus was successfully treated by cerebrospinal fluid diversion prior to tumor presentation. The differential diagnoses, diagnostic testing, and treatment course for these unusual cases are discussed. The importance of follow-up MRI in cases of idiopathic aqueductal stenosis is emphasized by these exemplar cases.

Mutations in glioblastoma oncosuppressive pathways pave the way for oncomodulatory activity of cytomegalovirus.

Over the last decade, cytomegalovirus (CMV) has been suggested to promote the development of glioblastoma multiforme (GBM). Recent evidence demonstrates that CMV contributes to the progression of GBM in the context of oncosuppressor gene mutations. This finding provides further insights into the mechanisms whereby CMV exacerbates the malignancy of GBM.

Cytomegalovirus contributes to glioblastoma in the context of tumor suppressor mutations.

To study the controversial role of cytomegalovirus (CMV) in glioblastoma, we assessed the effects of murine CMV (MCMV) perinatal infection in a GFAP-cre; Nf1(loxP/+); Trp53(-/+) genetic mouse model of glioma (Mut3 mice). Early on after infection, MCMV antigen was predominantly localized in CD45+ lymphocytes in the brain with active viral replication and local areas of inflammation, but, by 7 weeks, there was a generalized loss of MCMV in brain, confirmed by bioluminescent imaging. MCMV-infected Mut3 mice exhibited a shorter survival time from their gliomas than control Mut3 mice perinatally infected with mock or with a different neurotropic virus. Animal survival was also significantly shortened when orthotopic gliomas were implanted in mice perinatally infected with MCMV versus controls. MCMV infection increased phosphorylated STAT3 (p-STAT3) levels in neural stem cells (NSC) harvested from Mut3 mice subventricular zone, and, in vivo, there was increased p-STAT3 in NSCs in MCMV-infected compared with control mice. Of relevance, human CMV (HCMV) also increased p-STAT3 and proliferation of patient-derived glioblastoma neurospheres, whereas a STAT3 inhibitor reversed this effect in vitro and in vivo. These findings thus associate CMV infection to a STAT3-dependent modulatory role in glioma formation/progression in the context of tumor suppressor mutations in mice and possibly in humans.

Cytomegalovirus infection leads to pleomorphic rhabdomyosarcomas in Trp53+/- mice.

Cytomegalovirus (CMV) has been detected in several human cancers, but it has not proven to be oncogenic. However, recent studies have suggested mechanisms through which cytomegalovirus may modulate the tumor environment, encouraging its study as a positive modifier of tumorigenesis. In this study, we investigated the effects of cytomegalovirus infection in Trp53 heterozygous mice. Animals were infected with murine cytomegalovirus (MCMV) after birth at 2 days (P2) or 4 weeks of age and then monitored for tumor formation. Mice injected at 2 days of age developed tumors at a high frequency (43%) by 9 months of age. In contrast, only 3% of mock-infected or mice infected at 4 weeks developed tumors. The majority of tumors from P2 MCMV-infected mice were pleomorphic rhabdomyosarcomas (RMS) harboring MCMV DNA, RNA, and protein. An examination of clinical cases revealed that human RMS (embryonal, alveolar, and pleomorphic) harbored human cytomegalovirus IE1 and pp65 protein as well as viral RNA. Taken together, our findings offer support for the hypothesis that cytomegalovirus contributes to the development of pleomorphic RMS in the context of Trp53 mutation, a situation that occurs with high frequency in human RMS.