First report of Fusarium cugenangense causing root rot of tea plants (Camellia sinensis) in China.

Root rot is an important disease of tea plants owing to its unobvious early symptoms and permanent damage (Huu et al. 2016). In 2019, 5% of tea plants displayed symptoms consistent with root rot in a tea plantation (28°09'N, 113°13'E) located in Changsha city, Hunan province of China. The symptoms of the diseased tea plants ranged from wilting leaves to entirely dead. The roots had black lesions and rot typical of this disease. Symptomatic roots were collected, washed with water and disinfected with 75% ethanol, then cut into pieces and sterilized with 0.1% mercuric chloride for 30 s, 75% ethanol for 1 min, and rinsed with sterile water five times. After drying on sterilized filter paper, root tissues were cultured on potato dextrose agar (PDA) medium at 25 oC for 7 days in the dark. Four isolates, CAGF1, CAGF2, CAGF3, and CAGF4 were purified by selecting single spores. All isolates were subjected to a pathogenicity test. A conidial suspension of each strain was collected at a concentration of 2×106 conidia/mL. For the pathogenicity test, two-year-old field grown tea plants were transplanted in plastic pots containing 240 g of the rice grain-bran mixture (inoculated with 4 mL of conidial suspension and cultured for 14 days) and 960 g of sterilized soil (Huu et al. 2016). The pots without inoculated mixture served as control group. All the pots were kept in illumination incubators at 25 oC and a 12L:12D photoperiod. The pathogenicity test for each strain was repeated three times with three repetitions. Only strain CAGF1 exhibited pathogenicity to tea plants. Symptoms appeared on the third day post inoculation (dpi) and gradually worsened by the 7 dpi. On the 14 dpi, most leaves had died and the roots were black and partially rotten, similar to field symptoms. The reisolated fungus from potted roots was identified as CAGF1 based on ITS region and colony morphology, while isolation was attempted, CAGF1 was not isolated from the control plants, which fulfilled Koch's postulates. On PDA, the colony center of CAGF1 was purple with white margin, while on carnation leaf agar (CLA) medium was white. On CLA medium, macroconidia have 0 to 3 septa, measured 19.1 µm to 41.2 µm × 4.2 µm to 5.4 µm (mean= 31.2 µm × 4.8 µm, n=30). The microconidia were measured as 6.7 µm to 12.8 µm × 2.4 µm to 4.9 µm (mean= 10.1 µm × 3.3 µm, n=30), with 0 to 1 septa. And the chlamydospores were measured as 6.0 to 9.7µm (mean= 7.7µm, n=30). Morphologically, strain CAGF1 was identified as Fusarium oxysporum (Leslie and Summerell 2006). Additionally, the genomic DNA of strain CAGF1 was extracted by cetyltrimethylammonium bromide (CTAB) method, the internal transcribed spacer (ITS), elongation factor 1 alpha (EF-1α) and second largest subunit of RNA polymerase II (RPB2) were amplified using the primers ITS1/ITS4 (White et al. 1990), EF-1/EF-2 (Geiser et al. 2004) and fRPB2-5F/fRPB2-7cR (Liu et al. 1999), respectively. Sequences were deposited in GenBank (ITS, OK178562.1; EF-1α, OK598121.1; RPB2, OP381476.1). BLASTn searches revealed that strain CAGF1 was 100% (ON075522.1 for ITS and JX885464.1 for RPB2) and 99.6% (JQ965440.1 for EF-1α) identical to Fusarium oxysporum species complex (FOSC). Based on phylogenetic analysis, the strain CAGF1 was identified as Fusarium cugenangense, belonging to FOSC. To our knowledge, this is the first report of F. cugenangense causing root rot of tea plants in China. The findings are important for the management of this root rot and the improvement of economic benefits of tea cultivation.

First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China.

Industrial hemp (Cannabis sativa L.) is an important annual herbaceous plant that has great economic value. In March 2020, many small to large galls were observed on the roots of industrial hemp plants growing in a field in Tianya District, Sanya City, Hainan Province, China. The diseased plants did not show obvious aboveground symptoms. Females were obtained by dissecting the galls under a stereomicroscope. Second-stage juveniles (J2s) were collected for 24-48 h from egg masses hatching at 25°C. The morphological characteristics of females and J2s were observed and measured with a Nikon E200 microscope at 100× and 400× magnification. The perineal patterns of females were oval, with coarse and smooth striae, moderately high to high dorsal arches, and lacking distinct lateral lines. Measurements of females (n = 20) included vulval slit length = 26.4 ± 2.7 (23.6 to 31.2) µm, vulval slit to anus distance = 22.1 ± 2.4 (18.9 to 24.7) µm. The J2s had long and narrow tails with bluntly rounded tail tips and distinct hyaline tail termini. Measurements of J2s (n = 20) were body length = 432.4 ± 23.1 (386.8 to 465.3) µm, body width = 16.2 ± 1.8 (14.2 to 18.9) µm, stylet = 12.8 ± 0.5 (11.6 to 13.7) µm, dorsal esophageal gland orifice to stylet base = 3.6 ± 0.4 (3.1 to 4.8) µm, tail = 52.9 ± 3.8 (46.3 to 61.4) µm, hyaline tail length = 15.7 ± 2.6 (12.5 to 19.2) µm. These morphological characteristics were consistent with the original description of M. enterolobii (Yang and Eisenback 1983). Molecular biology analyses were also conducted to confirm species identification. Genomic DNA was extracted from a single J2 (Song et al. 2017). The ITS rRNA gene and D2-D3 region of the 28S rRNA gene were amplified using the primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The ITS rRNA gene sequence (765 bp, GenBank accession No. MT654126) was 100% identical to M. enterolobii sequences previously obtained from Fujian, China (MT406251) and Vietnam (MG773551), and the D2/D3 region sequence of 28S rRNA gene (759 bp, MT654127) revealed 99% identity with M. enterolobii sequences from Fujian (MT193450) and Taiwan (KP411230), China, and South Carolina, USA (MH800969). In addition, species identification was further confirmed using the M. enterolobii-specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) and MK7-F/MK7-R (GATCAGAGGCGGGCGCATTGCGA/CGAACTCGCTCGAACTCGAC), respectively (Long et al. 2006; Tigano et al. 2010). The PCR products had the expected fragment lengths of 236 bp and 520 bp, which were consistent with those previously reported for M. enterolobii (Long et al. 2006; Tigano et al. 2010). The pathogenicity test of this nematode was performed in a greenhouse at 25°C. Ten industrial hemp seedlings (cv. Longma No. 5 ) maintained in 12-cm diameter and 12-cm high pots containing autoclaved soil, were inoculated with 800 freshly hatched J2s of the original population of M. enterolobii per plant, and 8 non-inoculated seedlings were used as controls. At 60 d after inoculation, all inoculated plants exhibited gall symptoms on the roots similar to those in the field, and the nematode reproduction factor (final population density/initial population density) was 18.2. No symptoms were observed on control plants. These results confirmed the pathogenicity of M. enterolobii on industrial hemp. To our knowledge, this is the first report of industrial hemp as a new host of M. enterolobii in China. As M. enterolobii has a broad host range, a strong pathogenicity, and a high reproduction rate, it could become a major threat to industrial hemp production. Further monitoring and research on effective control strategies are needed.

Insight into the soil bacterial community succession of Nicotiana benthamiana in response to Tobacco mosaic virus.

Background: Tobacco mosaic virus (TMV) is one famous plant virus responsible for substantial economic losses worldwide. However, the roles of bacterial communities in response to TMV in the tobacco rhizosphere remain unclear. Methods: We explored the soil physicochemical properties and bacterial community succession of the healthy (YTH) and diseased (YTD) plants with TMV infection by 16S rRNA gene sequencing and bioinformatics analysis. Results: We found that soil pH in the YTD group was significantly lower than in the YTH group, and the soil available nutrients were substantially higher. The bacterial community analysis found that the diversity and structure significantly differed post-TMV disease onset. With TMV inoculated, the alpha diversity of the bacterial community in the YTD was markedly higher than that in the YTH group at the early stage. However, the alpha diversity in the YTD group subsequently decreased to lower than in the YTH group. The early bacterial structure of healthy plants exhibited higher susceptibility to TMV infection, whereas, in the subsequent stages, there was an enrichment of beneficial bacterial (e.g., Ramlibacter, Sphingomonas, Streptomyces, and Niastella) and enhanced energy metabolism and nucleotide metabolism in bacteria. Conclusion: The initial soil bacterial community exhibited susceptibility to TMV infection, which might contribute to strengthening resistance of Tobacco to TMV.

Geochip-based analysis of microbial communities in alpine meadow soils in the Qinghai-Tibetan plateau.

BACKGROUND: GeoChip 3.0, a microbial functional gene array, containing ~28,000 oligonucleotide probes and targeting ~57,000 sequences from 292 functional gene families, provided a powerful tool for researching microbial community structure in natural environments. The alpine meadow is a dominant plant community in the Qinghai-Tibetan plateau, hence it is important to profile the unique geographical flora and assess the response of the microbial communities to environmental variables. In this study, Geochip 3.0 was employed to understand the microbial functional gene diversity and structure, and metabolic potential and the major environmental factors in shaping microbial communities structure of alpine meadow soil in Qinghai-Tibetan Plateau. RESULTS: A total of 6143 microbial functional genes involved in carbon degradation, carbon fixation, methane oxidation and production, nitrogen cycling, phosphorus utilization, sulphur cycling, organic remediation, metal resistance, energy process and other category were detected in six soil samples and high diversity was observed. Interestingly, most of the detected genes associated with carbon degradation were derived from cultivated organisms. To identify major environmental factors in shaping microbial communities, Mantel test and CCA Statistical analyses were performed. The results indicated that altitude, C/N, pH and soil organic carbon were significantly (P < 0.05) correlated with the microbial functional structure and a total of 80.97% of the variation was significantly explained by altitude, C/N and pH. The C/N contributed 38.2% to microbial functional gene variation, which is in accordance with the hierarchical clustering of overall microbial functional genes. CONCLUSIONS: High overall functional genes and phylogenetic diversity of the alpine meadow soil microbial communities existed in the Qinghai-Tibetan Plateau. Most of the genes involved in carbon degradation were derived from characterized microbial groups. Microbial composition and structures variation were significantly impacted by local environmental conditions, and soil C/N is the most important factor to impact the microbial structure in alpine meadow in Qinghai-Tibetan plateau.

Efficacy of Streptomyces melanosporofaciens strain X216 at controlling clubroot disease on oilseed rape.

Oilseed rape (Brassica napus L.) is highly susceptible to infection from the soilborne pathogen Plasmodiophora brassicae Woronin that causes clubroot disease and deleteriously affects production throughout the world. In this study, biological control resources were explored by isolating 237 strains of bacteria from fields of oilseed rape using the gradient dilution coating method. A strain with strong antagonistic ability was screened using a plate confrontation test and designated X216. It was identified as Streptomyces melanosporofaciens owing to its morphological characteristics and 16S rRNA gene sequence. This study also examined the lethality of strain X216 to the resting spores of P. brassicae, its influence on infection in root hairs, and its ability to control clubroot on oilseed rape. The corrected lethality rate on resting spores after strain X216 had been used for 14 days was 56.59% ± 1.97%, which was significantly higher than the use of 75% of the fungicides chlorothalonil WP and 20% Fluazinam SC. Significantly fewer root hairs were infected after this treatment. A pot test showed that X216 was 62.14% effective at controlling the disease, which was not significantly different from that of the fungicide 100 g L-1 cyazofamid SC diluted 1,000-fold but significantly higher than those of 75% chlorothalonil and 50% carbendazim WP. Strain X216 controlled 43.16% of the incidence of clubroot in the field, which could significantly reduce the disease index of oilseed rape clubroot. Therefore, strain X216 is promising to study for the biological control of oilseed rape clubroot.

Efficacy of Plant Growth-Promoting Bacteria Bacillus cereus YN917 for Biocontrol of Rice Blast.

Bacillus cereus YN917, obtained from a rice leaf with remarkable antifungal activity against Magnaporthe oryzae, was reported in our previous study. The present study deciphered the possible biocontrol properties. YN917 strain exhibits multiple plant growth-promoting and disease prevention traits, including production of indole-3-acetic acid (IAA), ACC deaminase, siderophores, protease, amylase, cellulase, and ß-1,3-glucanase, and harboring mineral phosphate decomposition activity. The effects of the strain YN917 on growth promotion and disease prevention were further evaluated under detached leaf and greenhouse conditions. The results revealed that B. cereus YN917 can promote seed germination and seedling plant growth. The growth status of rice plants was measured from the aspects of rice plumule, radicle lengths, plant height, stem width, root lengths, fresh weights, dry weights, and root activity when YN917 was used as inoculants. YN917 significantly reduced rice blast severity under detached leaf and greenhouse conditions. Genome analysis revealed the presence of gene clusters for biosynthesis of plant promotion and antifungal compounds, such as IAA, tryptophan, siderophores, and phenazine. In summary, YN917 can not only be used as biocontrol agents to minimize the use of chemical substances in rice blast control, but also can be developed as bio-fertilizers to promote the rice plant growth.