RESUMO
In the search for novel, effective inhibitors of High-Mobility Group Box1 (HMGB1)-a protein involved in various inflammatory and autoimmune diseases as well as in cancer-we herein discovered a set of anti-HMGB1 G-quadruplex(G4)-forming aptamers by using an in vitro selection procedure applied to a doped library of guanine-rich oligonucleotides. The selected DNA sequences were then studied in a pseudo-physiological buffer mimicking the extracellular medium, where HMGB1 exerts its pathological activity, using spectroscopic, electrophoretic, and chromatographic techniques. All the oligonucleotides proved to fold into monomeric G4s and in some cases also dimeric species, stable at physiological temperature. Remarkably, the protein preferentially recognized the sequences forming dimeric parallel G4 structures, as evidenced by a properly designed chemiluminescent binding assay which also highlighted a good selectivity of these aptamers for HMGB1. Moreover, all aptamers showed anti-HMGB1 activity, inhibiting protein-induced cell migration. The acquired data allowed identifying L12 as the best anti-HMGB1 aptamer, featured by high thermal and enzymatic stability, no toxicity at least up to 5â µM concentration on healthy cells, along with potent anti-HMGB1 activity (IC50 ca. 28â nM) and good binding affinity for the protein, thus indicating it as a very promising lead candidate for in vivo studies.
Assuntos
Aptâmeros de Nucleotídeos , Quadruplex G , Proteína HMGB1 , Aptâmeros de Nucleotídeos/farmacologia , Aptâmeros de Nucleotídeos/químicaRESUMO
Laurus nobilis (bay laurel) is a natural source of biological compounds, and some of its extracts and phytocompounds are also endowed with antiviral activity toward the family of the severe acute respiratory syndrome (SARS)-associated ß-coronaviruses. Some glycosidic laurel compounds such as laurusides were proposed as inhibitors of important protein targets of SARS-CoV-2, which clearly recalls their potential as anti-COVID-19 drugs. Due to the frequent genomic variations of the ß-coronaviruses and the consequent importance of evaluating a new drug candidate with respect to the variants of the target ß-coronavirus, we decided to investigate at an atomistic level the molecular interactions of the potential laurel-derived drugs laurusides 1 and 2 (L01 and L02, respectively) toward a well-conserved and crucial target, the 3C-like protease (Mpro), using the enzymes of both the wild-type of SARS-CoV-2 and of the more recent Omicron variant. Thus, we performed molecular dynamic (MD) simulations of laurusides-SARS-CoV-2 protease complexes to deepen the knowledge on the stability of the interaction and compare the effects of the targeting among the two genomic variants. We found that the Omicron mutation does not significantly impact the lauruside binding and that L02 connects more stably with respect to L01 in the complexes from both variants, even though both compounds prevalently interact within the same binding pocket. Although purely in silico, the current study highlights the potential role of bay laurel phytocompounds in the antiviral and specifically anti-coronavirus research and shows their potential binding toward Mpro, corroborating the important commitment of bay laurel as functional food and disclosing novel scenarios of lauruside-based antiviral therapies.
Assuntos
COVID-19 , SARS-CoV-2 , Humanos , SARS-CoV-2/metabolismo , Simulação de Dinâmica Molecular , Peptídeo Hidrolases/metabolismo , Inibidores de Proteases/química , Proteínas não Estruturais Virais/metabolismo , Cisteína Endopeptidases/metabolismo , Antivirais/química , Simulação de Acoplamento MolecularRESUMO
Some viruses are known to be associated with the onset of specific cancers. These microorganisms, oncogenic viruses or oncoviruses, can convert normal cells into cancer cells by modulating the central metabolic pathways or hampering genomic integrity mechanisms, consequently inhibiting the apoptotic machinery and/or enhancing cell proliferation. Seven oncogenic viruses are known to promote tumorigenesis in humans: human papillomavirus (HPV), hepatitis B and C viruses (HBV, HCV), Epstein-Barr virus (EBV), human T-cell leukemia virus 1 (HTLV-1), Kaposi sarcoma-associated herpesvirus (KSHV), and Merkel cell polyomavirus (MCPyV). Recent research indicates that SARS-CoV-2 infection and COVID-19 progression may predispose recovered patients to cancer onset and accelerate cancer development. This hypothesis is based on the growing evidence regarding the ability of SARS-CoV-2 to modulate oncogenic pathways, promoting chronic low-grade inflammation and causing tissue damage. Herein, we summarize the main relationships known to date between virus infection and cancer, providing a summary of the proposed biochemical mechanisms behind the cellular transformation. Mechanistically, DNA viruses (such as HPV, HBV, EBV, and MCPyV) encode their virus oncogenes. In contrast, RNA viruses (like HCV, HTLV-1) may encode oncogenes or trigger host oncogenes through cis-/-trans activation leading to different types of cancer. As for SARS-CoV-2, its role as an oncogenic virus seems to occur through the inhibition of oncosuppressors or controlling the metabolic and autophagy pathways in the infected cells. However, these effects could be significant in particular scenarios like those linked to severe COVID-19 or long COVID. On the other hand, looking at the SARS-CoV-2âcancer relationship from an opposite perspective, oncolytic effects and anti-tumor immune response were triggered by SARS-CoV-2 infection in some cases. In summary, our work aims to recall comprehensive attention from the scientific community to elucidate the effects of SARS-CoV-2 and, more in general, ß-coronavirus infection on cancer susceptibility for cancer prevention or supporting therapeutic approaches.
Assuntos
COVID-19 , Infecções por Vírus Epstein-Barr , Hepatite C , Neoplasias , Infecções por Papillomavirus , Humanos , SARS-CoV-2 , Infecções por Vírus Epstein-Barr/complicações , Infecções por Papillomavirus/complicações , Síndrome de COVID-19 Pós-Aguda , Herpesvirus Humano 4 , COVID-19/complicações , Neoplasias/patologia , Vírus Oncogênicos/genética , Transformação Celular Neoplásica , Hepatite C/complicaçõesRESUMO
Finding effective antiviral molecular strategies was a main concern in the scientific community when the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) emerged at the end of 2019 as an easily transmissible and potentially deadly ß-coronavirus able to cause the coronavirus disease 19 (COVID-19), which famously led to one of the most worrying pandemics in recent times. Other members of this zoonotic pathogenic family were already known before 2019, but apart from the SARS-CoV, which was responsible of severe acute respiratory syndrome (SARS) pandemic in 2002/2003, and Middle East respiratory syndrome coronavirus (MERS-CoV), whose main impact on humans is geographically restricted to Middle Eastern countries, the other human ß-coronaviruses known at that time were those typically associated with common cold symptoms which had not led to the development of any specific prophylactic or therapeutic measures. Although SARS-CoV-2 and its mutations are still causing illness in our communities, COVID-19 is less deadly than before and we are returning to normality. Overall, the main lesson learnt after the past few years of pandemic is that keeping our bodies healthy and immunity defenses strong using sport, nature-inspired measures, and using functional foods are powerful weapons for preventing the more severe forms of illness caused by SARS-CoV-2 and, from a more molecular perspective, that finding drugs with mechanisms of action involving biological targets conserved within the different mutations of SARS-CoV-2-and possibly within the entire family of ß-coronaviruses-gives more therapeutic opportunities in the scenario of future pandemics based on these pathogens. In this regard, the main protease (Mpro), having no human homologues, offers a lower risk of off-target reactivity and represents a suitable therapeutic target in the search for efficacious, broad-spectrum anti-ß-coronavirus drugs. Herein, we discuss on the above points and also report some molecular approaches presented in the past few years to counteract the effects of ß-coronaviruses, with a special focus on SARS-CoV-2 but also MERS-CoV.
Assuntos
COVID-19 , Resfriado Comum , Coronavírus da Síndrome Respiratória do Oriente Médio , Humanos , SARS-CoV-2 , Antivirais/farmacologiaRESUMO
Raman nanoparticle probes are a potent class of optical labels for the interrogation of pathological and physiological processes in cells, bioassays, and tissues. Herein, we review the recent advancements in fluorescent and Raman imaging using oligodeoxyribonucleotide (ODN)-based nanoparticles and nanostructures, which show promise as effective tools for live-cell analysis. These nanodevices can be used to investigate a vast number of biological processes occurring at various levels, starting from those involving organelles, cells, tissues, and whole living organisms. ODN-based fluorescent and Raman probes have contributed to the achievement of significant advancements in the comprehension of the role played by specific analytes in pathological processes and have inaugurated new possibilities for diagnosing health conditions. The technological implications that have emerged from the studies herein described could open new avenues for innovative diagnostics aimed at identifying socially relevant diseases like cancer through the utilization of intracellular markers and/or guide surgical procedures based on fluorescent or Raman imaging. Particularly complex probe structures have been developed within the past five years, creating a versatile toolbox for live-cell analysis, with each tool possessing its own strengths and limitations for specific studies. Analyzing the literature reports in the field, we predict that the development of ODN-based fluorescent and Raman probes will continue in the near future, disclosing novel ideas on their application in therapeutic and diagnostic strategies.
Assuntos
Nanopartículas , Nanoestruturas , Ácidos Nucleicos , Análise Espectral Raman/métodos , Nanoestruturas/química , Corantes Fluorescentes/química , Imagem Molecular/métodos , Sondas de Ácido NucleicoRESUMO
The present work reports the synthesis of new N4-donor compounds carrying p-xylyl spacers in their structure. Different Schiff base aliphatic N-donors were obtained synthetically and subsequently evaluated for their ability to interact with two models of nucleic acids: calf-thymus DNA (CT-DNA) and the RNA from yeast Saccharomyces cerevisiae (herein simply indicated as RNA). In more detail, by condensing p-xylylenediamine and a series of aldehydes, we obtained the following Schiff base ligands: 2-thiazolecarboxaldehyde (L1), pyridine-2-carboxaldehyde (L2), 5-methylisoxazole-3-carboxaldehyde (L3), 1-methyl-2-imidazolecarboxaldehyde (L4), and quinoline-2-carboxaldehyde (L5). The structural characterisation of the ligands L1-L5 (X-ray, 1H NMR, 13C NMR, elemental analysis) and of the coordination polymers {[CuL1]PF6}n (herein referred to as Polymer1) and {[AgL1]BF4}n, (herein referred to as Polymer2, X-ray, 1H NMR, ESI-MS) is herein described in detail. The single crystal X-ray structures of complexes Polymer1 and Polymer2 were also investigated, leading to the description of one-dimensional coordination polymers. The spectroscopic and in silico evaluation of the most promising compounds as DNA and RNA binders, as well as the study of the influence of the 1D supramolecular polymers Polymer1 and Polymer2 on the proliferation of Escherichia coli bacteria, were performed in view of their nucleic acid-modulating and antimicrobial applications. Spectroscopic measurements (UV-Vis) combined with molecular docking calculations suggest that the thiazolecarboxaldehyde derivative L1 is able to bind CT-DNA with a mechanism different from intercalation involving the thiazole ring in the molecular recognition and shows a binding affinity with DNA higher than RNA. Finally, Polymer2 was shown to slow down the proliferation of bacteria much more effectively than the free Ag(I) salt.
Assuntos
Anti-Infecciosos , Complexos de Coordenação , Simulação de Acoplamento Molecular , RNA , Bases de Schiff/química , DNA/química , Polímeros , Ligantes , Complexos de Coordenação/químicaRESUMO
A new family of Cu(II) and Ni(II) salen complexes was synthesized and fully characterized through various physicochemical methods. Their catalytic activity was evaluated in the phase transfer Cα-alkylation reaction of the Schiff bases of D,L-alanine ester and benzaldehyde derivatives. It was found that the introduction of a chlorine atom into the ortho- and para-positions of the phenyl ring of the substrate resulted in an increase in both the chemical yield and the asymmetric induction (ee 66-98%). The highest enantiomeric excess was achieved in the case of a Cu(II) salen complex based on (S,S)-cyclohexanediamine and salicylaldehyde at -20 °C. The occurrence of a bulky substituent in the ligand present in the complexes led to a drastic decrease in ee and chemical yield. For instance, the introduction of bulky substituents at positions 3 and 5 of the phenyl ring of the catalyst resulted in a complete loss of the stereoselectivity control in the alkylation reaction.
RESUMO
The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic.
Assuntos
COVID-19 , Ácidos Nucleicos , Humanos , Nanomedicina , Ácidos Nucleicos/uso terapêutico , Oligonucleotídeos/química , Oligonucleotídeos/uso terapêutico , SARS-CoV-2RESUMO
Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.
Assuntos
Quadruplex G , Ácidos Nucleicos , DNA/química , Genes myc , Glucosídeos/farmacologia , Simulação de Acoplamento Molecular , Compostos Fitoquímicos , Proteínas Proto-Oncogênicas c-myc/metabolismo , Análise Espectral , EstilbenosRESUMO
The coronavirus disease 2019 (COVID-19) is causing major sanitary and socioeconomic issues, yet some locations are less impacted than others. While densely populated areas are likely to favor viral transmission, we hypothesize that other environmental factors could explain lower cases in some areas. We studied COVID-19 impact and population statistics in highly forested Mediterranean Italian regions versus some northern regions where the amount of trees per capita is much lower. We also evaluated the affinity of Mediterranean plant-emitted volatile organic compounds (VOCs) isoprene, α-pinene, linalool and limonene for COVID-19 protein targets by molecular docking modeling. Results show that while mean death number increased about 4 times from 2020 to 2021, the percentage of deaths per population (0.06-0.10%) was lower in the greener Mediterranean regions such as Sardinia, Calabria and Basilica versus northern regions with low forest coverage, such as Lombardy (0.33%) and Emilia Romagna (0.29%). Data also show that the pandemic severity cannot be explained solely by population density. Modeling reveals that plant organic compounds could bind and interfere with the complex formed by the receptor binding domain of the coronavirus spike protein with the human cell receptor. Overall, our findings are likely explained by sea proximity and mild climate, Mediterranean diet and the abundance of non-deciduous Mediterranean plants which emit immunomodulatory and antiviral compounds. Potential implications include 'forest bathing' as a therapeutic practice, designing nasal sprays containing plant volatile organic compounds, and preserving and increasing forest coverage. SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s10311-021-01309-5.
RESUMO
Old forests containing ancient trees are essential ecosystems for life on earth. Mechanisms that happen both deep in the root systems and in the highest canopies ensure the viability of our planet. Old forests fix large quantities of atmospheric CO2, produce oxygen, create micro-climates and irreplaceable habitats, in sharp contrast to young forests and monoculture forests. The current intense logging activities induce rapid, adverse effects on our ecosystems and climate. Here we review large old trees with a focus on ecosystem preservation, climate issues, and therapeutic potential. We found that old forests continue to sequester carbon and fix nitrogen. Old trees control below-ground conditions that are essential for tree regeneration. Old forests create micro-climates that slow global warming and are irreplaceable habitats for many endangered species. Old trees produce phytochemicals with many biomedical properties. Old trees also host particular fungi with untapped medicinal potential, including the Agarikon, Fomitopsis officinalis, which is currently being tested against the coronavirus disease 2019 (COVID-19). Large old trees are an important part of our combined cultural heritage, providing people with aesthetic, symbolic, religious, and historical cues. Bringing their numerous environmental, oceanic, ecological, therapeutic, and socio-cultural benefits to the fore, and learning to appreciate old trees in a holistic manner could contribute to halting the worldwide decline of old-growth forests.
RESUMO
Strengthening the immune system in order to better withstand the threat of COVID-19 is an important way to ensure the protection of our health against the current pandemic associated with SARS-CoV-2. There are many ways to achieve this, but with current circumstances, certain modalities stand out as being the most valid and are certainly worth greater consideration. Here we review the effects that particular immuno-strengthening activities can have on limiting the severity of COVID-19 disease as well as preventing virus infection. Physical activity, in particular, should not be discounted as an important method of prevention of viral diseases as it triggers many biological processes within the human body which in turn lead to heightened natural defences against viral infections. When exercise is performed in forested areas, these protective health benefits may be increased since many plant species emit biogenic volatile compounds (VOCs) which, when inhaled, have many protective properties. These VOCs have been shown in particular to have immunostimulatory effects on the human body and, thus, they could be of use in the prevention and/or treatment of COVID-19. Being amongst trees may also help to alleviate stress and anxiety, lowering cortisol levels and consequently helping the proper functioning of the immune system. In the following work, we have performed an analysis of the available scientific literature which looks at the effects of physical exercise as well as 'forest-bathing' on the immune system's ability to fight disease, especially of course as it relates to COVID-19. Our review aims at shedding light on the benefits of exercising outdoors in green areas and suggests reforestation as a protective measure against future outbreaks.
RESUMO
Herein we present a mononuclear lanthanum(III) complex obtained in a template cyclocondensation reaction of lanthanum(III) nitrate salt, 1,2-propanediamine, and 2,6-diacetylpyridine (LaPA complex). A preliminary investigation of the biological potential of this compound was conducted using a biomedically relevant target Tel26. We found that, different from parallel G4, antiparallel G4, and duplex DNA, only a hybrid-type G4 structure of Tel26 in a K+ solution was significantly stabilized by ≥7 °C, which emerged in our UV melting studies. Moreover, LaPA induced structural changes in the Tel26 structure in a K+-deprived solution, suggesting that it may also lead to conformational changes in "non-G4" telomeric DNA.
Assuntos
Compostos Aza/química , DNA/química , Lantânio/química , Compostos Macrocíclicos/síntese química , Dicroísmo Circular , Ligantes , Compostos Macrocíclicos/química , Microscopia Eletrônica de Varredura , Conformação de Ácido Nucleico , Espectrometria de Massas por Ionização por Electrospray , Difração de Raios XRESUMO
Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2â³S,3â³R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.
Assuntos
Cálcio/metabolismo , ADP-Ribose Cíclica/análogos & derivados , ADP-Ribose Cíclica/farmacologia , Neurônios/efeitos dos fármacos , Animais , Células Cultivadas , Neurônios/metabolismo , Ratos , Ratos WistarRESUMO
Herein we describe a combined experimental and in silico study of the interaction of a series of pyrazolo[1,2-a]benzo[1,2,3,4]tetrazin-3-one derivatives (PBTs) with parallel G-quadruplex (GQ) DNA aimed at correlating their previously reported anticancer activities and the stabilizing effects observed by us on c-myc oncogene promoter GQ structure. Circular dichroism (CD) melting experiments were performed to characterize the effect of the studied PBTs on the GQ thermal stability. CD measurements indicate that two out of the eight compounds under investigation induced a slight stabilizing effect (2-4 °C) on GQ depending on the nature and position of the substituents. Molecular docking results allowed us to verify the modes of interaction of the ligands with the GQ and estimate the binding affinities. The highest binding affinity was observed for ligands with the experimental melting temperatures (Tms). However, both stabilizing and destabilizing ligands showed similar scores, whilst Molecular Dynamics (MD) simulations, performed across a wide range of temperatures on the GQ in water solution, either unliganded or complexed with two model PBT ligands with the opposite effect on the Tms, consistently confirmed their stabilizing or destabilizing ability ascertained by CD. Clues about a relation between the reported anticancer activity of some PBTs and their ability to stabilize the GQ structure of c-myc emerged from our study. Furthermore, Molecular Dynamics simulations at high temperatures are herein proposed for the first time as a means to verify the stabilizing or destabilizing effect of ligands on the GQ, also disclosing predictive potential in GQ-targeting drug discovery.
Assuntos
DNA/efeitos dos fármacos , Quadruplex G/efeitos dos fármacos , Proteínas Proto-Oncogênicas c-myc/química , Telômero/química , Sítios de Ligação/efeitos dos fármacos , Dicroísmo Circular , Simulação por Computador , DNA/química , DNA/ultraestrutura , Humanos , Ligantes , Simulação de Dinâmica Molecular , Regiões Promotoras Genéticas/genética , Proteínas Proto-Oncogênicas c-myc/ultraestrutura , Telômero/efeitos dos fármacos , Telômero/genéticaRESUMO
The current COronaVIrus Disease 19 (COVID-19) pandemic caused by SARS-CoV-2 infection is enormously affecting the worldwide health and economy. In the wait for an effective global immunization, the development of a specific therapeutic protocol to treat COVID-19 patients is clearly necessary as a short-term solution of the problem. Drug repurposing and herbal medicine represent two of the most explored strategies for an anti-COVID-19 drug discovery. Clove (Syzygium aromaticum L.) is a well-known culinary spice that has been used for centuries in folk medicine in many disorders. Interestingly, traditional medicines have used clove since ancient times to treat respiratory ailments, whilst clove ingredients show antiviral and anti-inflammatory properties. Other interesting features are the clove antithrombotic, immunostimulatory, and antibacterial effects. Thus, in this review, we discuss the potential role of clove in the frame of anti-COVID-19 therapy, focusing on the antiviral, anti-inflammatory, and antithrombotic effects of clove and its molecular constituents described in the scientific literature.
Assuntos
Anti-Inflamatórios não Esteroides/farmacologia , Antivirais/farmacologia , Tratamento Farmacológico da COVID-19 , COVID-19 , Fibrinolíticos/farmacologia , Syzygium/química , Adjuvantes Imunológicos/química , Adjuvantes Imunológicos/farmacologia , Anti-Inflamatórios não Esteroides/química , Antivirais/química , COVID-19/prevenção & controle , Medicina Herbária/métodos , Humanos , Compostos Fitoquímicos/química , Compostos Fitoquímicos/farmacologia , Plantas Medicinais/químicaRESUMO
Peptides and their synthetic analogs are a class of molecules with enormous relevance as therapeutics for their ability to interact with biomacromolecules like nucleic acids and proteins, potentially interfering with biological pathways often involved in the onset and progression of pathologies of high social impact. Nucleobase-bearing peptides (nucleopeptides) and pseudopeptides (PNAs) offer further interesting possibilities related to their nucleobase-decorated nature for diagnostic and therapeutic applications, thanks to their reported ability to target complementary DNA and RNA strands. In addition, these chimeric compounds are endowed with intriguing self-assembling properties, which are at the heart of their investigation as self-replicating materials in prebiotic chemistry, as well as their application as constituents of innovative drug delivery systems and, more generally, as novel nanomaterials to be employed in biomedicine. Herein we describe the properties of nucleopeptides, PNAs and related supramolecular systems, and summarize some of the most relevant applications of these systems.
Assuntos
Nanoestruturas/química , Ácidos Nucleicos Peptídicos/química , Peptídeos/química , DNA/química , RNA/químicaRESUMO
Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action.
Assuntos
Antivirais , Tratamento Farmacológico da COVID-19 , Reposicionamento de Medicamentos , Nucleosídeos , SARS-CoV-2/metabolismo , Síndrome Respiratória Aguda Grave/tratamento farmacológico , Coronavírus Relacionado à Síndrome Respiratória Aguda Grave/metabolismo , Animais , Antivirais/química , Antivirais/uso terapêutico , COVID-19/epidemiologia , COVID-19/metabolismo , Humanos , Nucleosídeos/química , Nucleosídeos/uso terapêutico , Síndrome Respiratória Aguda Grave/epidemiologia , Síndrome Respiratória Aguda Grave/metabolismoRESUMO
The COVID-19 pandemic has induced dramatic effects on the population of the industrialized north of Italy, whereas it has not heavily affected inhabitants of the southern regions. This might be explained in part by human exposure to high levels of fine particulate matter (PM) in the air of northern Italy, thus exacerbating the mortality. Since trees mitigate air pollution by intercepting PM onto plant surfaces and bolster the human immune system by emitting bioactive volatile organic compounds (VOCs), we hypothesize a protective role of evergreen forested areas in southern Italy. We compared the mortality rate due to COVID-19, the death number, the positivity rate and the forest coverage per capita in various Italian regions. Hectares of forest per capita and prevalence of deciduous versus evergreen forestal species were also estimated. In silico docking studies of potentially protective compounds found in Laurus nobilis L., a typical Mediterranean plant, were performed to search for potential antivirals. We found that the pandemic's severity was generally lower in southern regions, especially those with more than 0.3 hectares of forest per capita. The lowest mortality rates were found in southern Italy, mainly in regions like Molise (0.007%) and Basilicata (0.005%) where the forest per capita ratio is higher than 0.5 Ha/person. Our findings suggest that evergreen Mediterranean forests and shrubland plants could have protected the southern population by emission of immuno-modulating VOCs and provision of dietary sources of bioactive compounds. Moreover, in silico studies revealed a potential anti-COVID-19 activity in laurusides, which are unexplored glycosides from bay laurel. Overall, our results highlight the importance of nature conservation and applications to the search for natural antivirals.
RESUMO
Herein, we described the synthesis of two L-phenylalanines α-derivatized with a terminal alkyne moiety whose structures differed by phenyl ring halogen substitution (two o-Cl in 1 vs. one p-Br in 2) and investigated their effect on biological macromolecules and living cells. We explored their interaction with quadruplex DNA (G4 DNA), using tel26 and c-myc as models, and bovine serum albumin (BSA). By CD spectroscopy, we found that 1 caused minor tel26 secondary structure changes, leading also to a slight thermal stabilization of this hybrid antiparallel/parallel G4 structure, while the c-myc parallel topology remained essentially unchanged upon 1 binding. Other CD evidences showed the ability of 1 to bind BSA, while molecular docking studies suggested that the same molecule could be housed into the hydrophobic cavity between sub-domains IIA, IIB, and IIIA of the protein. Furthermore, preliminary aggregation studies, based on concentration-dependent spectroscopic experiments, suggested the ability of 1 to aggregate forming noncovalent polymeric systems in aqueous solution. Differently from 1, the bromine-modified compound was able to bind Cu(II) ion, likely with the formation of a CuL2 complex, as found by UV spectroscopy. Finally, cell tests excluded any cytotoxic effect of both compounds toward normal cells, but showed slight antiproliferative effects of 2 on PC3 cancerous cells at 24 h, and of 1 on both T98G and MDA-MB-231 cancer cells at 48 h.