Myeloid Heterogeneity Mediates Acute Exacerbations of Pulmonary Fibrosis.

Epidemiological evidence indicates that exposure to particulate matter is linked to the development of idiopathic pulmonary fibrosis (IPF) and increases the incidence of acute exacerbations of IPF. In addition to accelerating the rate of lung function decline, exposure to fine particulate matter (particulate matter smaller than 2.5 µm [PM2.5]) is a risk factor for increased mortality in subjects with IPF. In this article, we show that exposure to PM2.5 mediates monocyte recruitment and fibrotic progression in mice with established fibrosis. In mice with established fibrosis, bronchoalveolar lavage cells showed monocyte/macrophage heterogeneity after exposure to PM2.5. These cells had a significant inflammatory and anti-inflammatory signature. The mixed heterogeneity of cells contributed to the proinflammatory and anti-inflammatory response. Although monocyte-derived macrophages were recruited to the lung in bleomycin-injured mice treated with PM2.5, recruitment of monocytes expressing Ly6Chi to the lung promoted progression of fibrosis, reduced lung aeration on computed tomography, and impacted lung compliance. Ly6Chi monocytes isolated from PM2.5-exposed fibrotic mice showed enhanced expression of proinflammatory markers compared with fibrotic mice exposed to vehicle. Moreover, IPF bronchoalveolar lavage cells treated ex vivo with PM2.5 showed an exaggerated inflammatory response. Targeting Ly6Chi monocyte recruitment inhibited fibrotic progression in mice. Moreover, the adoptive transfer of Ly6Chi monocytes exacerbated established fibrosis. These observations suggest that enhanced recruitment of Ly6Chi monocytes with a proinflammatory phenotype mediates acute exacerbations of pulmonary fibrosis, and targeting these cells may provide a potential novel therapeutic target to protect against acute exacerbations of IPF.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Role of altered immune cells in liver diseases: a review.

Immune cells play an important role in controlling liver tumorigenesis, viral hepatitis, liver fibrosis and contribute to pathogenesis of liver inflammation and injury. Accumulating evidence suggests the effectiveness of natural killer (NK) cells and Kupffer cells (KCs) against viral hepatitis, hepatocellular damage, liver fibrosis, and carcinogenesis. Activation of natural killer cells provides a novel therapeutic strategy to cure liver related diseases. This review discusses the emerging roles of immune cells in liver disorders and it will provide baseline data to scientists to design better therapies for treatment.

Cell Adhesion Molecules in Fibrotic Diseases.

Mechanisms underlying the pathogenesis of tissue fibrosis remain incompletely understood. Emerging evidence suggests that cell adhesion molecules (CAMs) are critical in fibrotic progression in many organs, including lung, kidney, skin, and liver. CAMs promote cell-cell and cell-extracellular matrix (ECM) interactions to maintain tissue architecture and normal function in homeostasis. However, dysregulated expression and function of CAMs can lead to chronic inflammation and tissue fibrosis. The major families of CAMs include integrins, cadherins, selectins, and immunoglobulins. Here, we review the role of the CAMs in fibrosis development across various organs with a focus on integrins and cadherins, and discuss their respective roles in the development of pulmonary fibrosis.

Impaired PPARγ activation by cadmium exacerbates infection-induced lung injury.

Emerging data indicate an association between environmental heavy metal exposure and lung disease, including lower respiratory tract infections (LRTIs). Here, we show by single-cell RNA sequencing an increase in Pparg gene expression in lung macrophages from mice exposed to cadmium and/or infected with Streptococcus pneumoniae. However, the heavy metal cadmium or infection mediated an inhibitory posttranslational modification of peroxisome proliferator-activated receptor γ (PPARγ) to exacerbate LRTIs. Cadmium and infection increased ERK activation to regulate PPARγ degradation in monocyte-derived macrophages. Mice harboring a conditional deletion of Pparg in monocyte-derived macrophages had more severe S. pneumoniae infection after cadmium exposure, showed greater lung injury, and had increased mortality. Inhibition of ERK activation with BVD-523 protected mice from lung injury after cadmium exposure or infection. Moreover, individuals residing in areas of high air cadmium levels had increased cadmium concentration in their bronchoalveolar lavage (BAL) fluid, increased barrier dysfunction, and showed PPARγ inhibition that was mediated, at least in part, by ERK activation in isolated BAL cells. These observations suggest that impaired activation of PPARγ in monocyte-derived macrophages exacerbates lung injury and the severity of LRTIs.

The current status of anti-GPCR drugs against different cancers.

G protein coupled receptors (GPCRs) have emerged as the most potential target for a number of drug discovery programs ranging from control of blood pressure, diabetes, cure for genetic diseases to treatment of cancer. A panel of different ligands including hormones, peptides, ions and small molecules is responsible for activation of these receptors. Molecular genetics has identified key GPCRs, whose mutations or altered expressions are linked with tumorgenicity. In this review, we discussed recent advances regarding the involvement of GPCRs in the development of cancers and approaches to manipulating the mechanism behind GPCRs involved tumor growth and metastasis to treat different types of human cancer. This review provides an insight into the current scenario of GPCR-targeted therapy, progress to date and the challenges in the development of anticancer drugs.

SNPs in folate pathway are associated with the risk of nonsyndromic cleft lip with or without cleft palate, a meta-analysis.

BACKGROUND: Prenatal intake of folic acid is important for prevention of NSCL/P (nonsyndromic cleft lip with or without cleft palate). Associated genes in folate pathway are major enzymes of folic acid metabolism that is crucial for preventing birth defects. The present meta-analysis aims to investigate the association between four SNPs in folate pathway genes and the risk of NSCL/P. METHODS: Comprehensive bioinformatics analysis was used to predict the functional pathogenicity of genetic variation. The PubMed, Embase database and Google Scholar were searched by two researchers. Stata 11.0 software was used to analyze the results. Subgroup analysis was carried out to assess the influence of genetic background. Sensitivity analysis, regression analysis and publication analysis were also conducted to enhance the strength of our results. RESULTS: It is estimated that the probability of two missense mutation rs1801133 in MTHFR and rs1801394 in MTRR are more likely to be damaging by bioinformatics analysis. A significant association between rs1801133 and risk of NSCL/P in two genetic models: TT genotype vs CC genotype (OR = 1.333 95%CI = 1.062-1.674, P = 0.013), and recessive model (OR = 1.325 95%CI = 1.075-1.634, P = 0.008). A significant protective association between rs1801394 GG genotype and NSCL/P in Asian (GG vs AA, OR = 0.520 95%CI = 0.321-0.841, P = 0.008) was observed. Meta-regression, sensitivity analysis, and publication bias analysis confirmed that the results of the present study were statistically significant. CONCLUSIONS: The present study identified that rs1801133 in MTHFR is associated with the risk of NSCL/P, and rs1801394 GG genotype in MTRR play a protective role in Asian. Further, larger studies should be performed to confirm these findings.

Evaluation of a Novel Missense Mutation in ABCB4 Gene Causing Progressive Familial Intrahepatic Cholestasis Type 3.

Progressive familial intrahepatic cholestasis type 3 (PFIC3) is a hepatic disorder occurring predominantly in childhood and is difficult to diagnose. PFIC3, being a rare autosomal recessive disease, is caused by genetic mutations in both alleles of ABCB4, resulting in the disruption of the bile secretory pathway. The identification of pathogenic effects resulting from different mutations in ABCB4 is the key to revealing the internal cause of disease. These mutations cause truncation, instability, misfolding, and impaired trafficking of the MDR3 protein. Here, we reported a girl, with a history of intrahepatic cholestasis and progressive liver cirrhosis, with an elevated gamma-glutamyltransferase level. Genetic screening via whole exome sequencing found a novel homozygous missense mutation ABCB4:c.1195G>C:p.V399L, and the patient was diagnosed with PFIC3. Various computational tools predicted the variant to be deleterious and evolutionary conserved. For functional characterization studies, plasmids, encoding ABCB4 wild-type and selected established mutant constructs, were expressed in human embryonic kidney (HEK-293T) and hepatocellular carcinoma (HepG2) cells. In vitro expression analysis observed a reduced expression of mutant protein compared to wild-type protein. We found that ABCB4 wild type was localized at the apical canalicular membrane, while mutant p.V399L showed intracellular retention. Intracellular mistrafficking proteins usually undergo proteasomal or lysosomal degradation. We found that after treatment with proteasomal inhibitor MG132 and lysosomal inhibitor bafilomycin A1, MDR3 expression of V399L was significantly increased. A decrease in MDR3 expression of mutant V399L protein may be a result of proteasomal or lysosomal degradation. Pharmacological modulator cyclosporin A and intracellular low temperature (30°C) treatment significantly rescued both the folding defect and the active maturation of the mutant protein. Our study identified a novel pathogenic mutation which expanded the mutational spectrum of the ABCB4 gene and may contribute to understanding the molecular basis of PFIC3. Therefore, genetic screening plays a conclusive role in the diagnosis of rare heterogenic disorders like PFIC3.

Combinatorial approach of in silico and in vitro evaluation of MLH1 variant associated with Lynch syndrome like metastatic colorectal cancer.

Colorectal cancer (CRC) is the third most developing cancer worldwide and Lynch syndrome (LS) accounts for 3-4% of CRC. Genetic alteration in any of DNA mismatch repair (MMR) gene is the major cause of LS that disrupt the normal upstream and downstream MMR events. Germline mutation of MLH1 in heterozygous state have an increased risk for CRC. Defective MMR pathway mostly results in microsatellite instability (MSI) that occurs in high percentage of CRC associated tumors. Here, we reported a patient with LS like metastatic CRC (mCRC) associated with other related cancers. Whole exome sequencing (WES) of the proband was performed to identify potential causative gene. Genetic screening validated by Sanger sequencing identified a heterozygous missense mutation in exon 12 of MLH1 (c.1151T>A, p.V384D). The clinical significance of identified variant was elucidated on the basis of clinicopathological data, computational predictions and various in vitro functional analysis. In silico predictions classified the variant to be deleterious and evolutionary conserved. In vitro functional studies revealed a significant decrease in protein expression because of stability defect leading to loss of MMR activity. Mutant residue found in MutL transducer domain of MLH1 that localized in the nucleus but translocation was not found to be significantly disturbed. In conclusion, our study give insight into reliability of combinatorial prediction approach of in silico and in vitro expression analysis. Hence, we highlighted the pathogenic correlation of MLH1 variant with LS associated CRC as well as help in earlier diagnosis and surveillance for improved management and genetic counselling.