Taurine dynamics in serum during the oestrous cycle in buffaloes.

Estrus identification is one of the common issues in buffaloes because of their short estrus duration and silent estrus problem. Hence, specific biomarkers facilitating in identifying the estrus stage would be helpful to buffalo farmers and researchers. In our previous studies, taurine, a non-protein amino acid that helps in the secretion of reproductive hormones such as GnRH, was found to be associated with postpartum anestrus in buffaloes. Therefore, the present study was conducted to explore the level of taurine in serum during different stages of the oestrous cycle in healthy cyclic buffaloes. Blood samples were collected from healthy cyclic buffaloes (n = 4), and taurine was estimated at the estrus (0th day), proestrus (-2nd day), metestrus (3rd day) and diestrus (+10th day) stages using TLC method. The days of the oestrous cycle were determined by ultrasonography and observation of behavioural signs by trained professionals. The results revealed that taurine was consistently present in the serum. However, the highest concentration of taurine was observed at the proestrus (0.20 ± 0.03 mg/mL) stage, which was greater (p < .05) than metestrus (0.10 ± 0.05 mg/mL) and diestrus (0.13 ± 0.03 mg/mL) stages, but comparable with the estrus stage. These results were also validated in the simulated population datasets of population size 6 to 10,000. Further, ROC curve analysis for the large simulated population indicated the efficiency of taurine to distinguish proestrus from metestrus and diestrus stages at a lower cutoff value of <0.1643 mg/mL with 60% sensitivity and specificity. Therefore, the present study concludes that serum taurine concentration could help in detecting proestrus stage of buffalo estrous cycle.

Detection of endocrine and metabolism disrupting xenobiotics in milk-derived fat samples by fluorescent protein-tagged nuclear receptors and live cell imaging.

Nuclear receptors (NRs) are ligand-modulated transcription factors that regulate multiple physiological functions in our body. Many NRs in their unliganded state are localized in the cytoplasm. The ligand-inducible nuclear translocation of NRs provides a valuable tool for studying the NR-ligand interactions and their downstream effects. The translocation response of NRs can be studied irrespective of the nature of the interacting ligand (agonist, antagonist, or a small molecule modulator). These nuclear translocation studies offer an advantage over promoter-reporter-based transcription assays where transcription response is observed only with the activating hormones or agonistic ligands. Globally, milk serves as a major dietary source. However, suspected presence of endocrine/metabolism-disrupting chemicals like bisphenols, parabens, organochlorine pesticides, carbamates, non-steroidal anti-inflammatory drugs, chloramphenicol, brominated flame retardants, etc. has been reported. Considering that these chemicals may impart serious developmental and metabolism-related health concerns, it is essential to develop assays suitable for the detection of xenobiotics present at differing levels in milk. Since milk samples cannot be used directly on cultured cells or for microscopy, a combination of screening strategies has been developed herein based on the revelation that i) lipophilic NR ligands can be successfully retrieved in milk-fat; ii) milk-fat treatment of cells is compatible with live-cell imaging studies; and finally, iii) treatment of cells with xenobiotics-spiked and normal milk derived fat provides a visual and quantifiable response of NR translocation in living cells. Utilizing a milk-fat extraction method and Green Fluorescent Protein (GFP) tagged NRs expressed in cultured mammalian cells, followed by an assessment of NR response proved to be an effective approach for screening xenobiotics present in milk samples.HighlightsDiverse endocrine and metabolism-disrupting chemicals are suspected to contaminate milk.Nuclear receptors serve as 'xenosensors' for assessing the presence of xenobiotics in milk.Nuclear import of steroid receptors with (ant)agonist can be examined in live cells.Lipophilic xenobiotics are extracted and observed enriched in milk-fat fraction.A comprehensive cell-based protocol aids in the detection of xenobiotics in milk.

Global footprints of organochlorine pesticides: a pan-global survey.

Organochlorine pesticides (OCPs) are ubiquitous environmental contaminants widely used all over the world. These chlorinated hydrocarbons are toxic and often cause detrimental health effects because of their long shelf life and bioaccumulation in the adipose tissues of primates. OCP exposure to humans occurs through skin, inhalation and contaminated foods including milk and dairy products, whereas developing fetus and neonates are exposed through placental transfer and lactation, respectively. In 1960s, OCPs were banned in most developed countries, but because they are cheap and easily available, they are still widely used in most third world countries. The overuse or misuse of OCPs has been rising continuously which pose threats to environmental and human health. This review reports the comparative occurrence of OCPs in human and bovine milk samples around the globe and portrays the negative impacts encountered through the long history of OCP use.

Regulation of granulosa cell functions through NRP-1 mediated internalization of follicular fluid non-exosomal miR-210.

Crosstalk between follicular fluid (FF) and granulosa cells (GCs) plays a vital role in the regulation of folliculogenesis, ensuring regular reproductive cycle in mammals. This crosstalk is primarily mediated by hormones and signaling molecules, such as cytokines and chemokines. Recently, extracellular microRNAs (miRNAs) have gained a lot of attention in cell-to-cell communication. Extracellular miRNA transportation occurs through exosomes, a kind of micro-vesicles produced from almost all cells. However, the mode of non-exosomal miRNA internalization is not much studied. In the present study, we explored the role of neuropilin-1 (NRP-1) as a receptor in internalizing FF non-exosomal miRNAs in GCs. We first confirmed the expression of NRP-1 in GCs during follicular development followed by its role in the internalization of miR-210, a non-exosomal miRNA. This study showed that incubation of GCs with a non-exosomal fraction of FF increased the content of miR-210 in GCs as compared to their control. To illustrate the role of NRP-1 as a receptor, NRP-1 was knockdown using siRNA. Silencing experimental results showed a significant decrease in uptake of miR-210 in NRP-1 knockdown GCs. Furthermore, downstream expression analysis of miR-210 target genes (CYP19A1, PCNA, and EFNA3) also confirmed the NRP-1 mediated miR-210 internalization. Results of the present study clearly demonstrated that FF non-exosomal miR-210 can be internalized through the NRP-1 receptor. Furthermore, differential expression of NRP-1 in GCs suggests its role in follicular development. Overall, these findings suggest that FF non-exosomal miRNA plays an important role in GC functions and female reproduction.

Transcriptome analysis of buffalo granulosa cells in three dimensional culture systems.

Hanging drop (HD) three-dimensional (3D) culture model for buffalo granulosa cells (GC) was reported to mimic the preovulatory stage of ovarian follicles in our previous study. To further verify its reliability, the present study attempted a comparative transcriptome profile of buffalo GC freshly isolated from ovarian follicles (<8 mm diameter) (FC) and their cultures in normal culture dish (ND or 2D), polyHEMA coated dish (PH) and HD culture systems (3D). Out of 223 significantly (-log2 fold change: >3; p < .0005; false discovery rate [FDR]: <0.1) differentially expressed genes (SDEGs) among different culture systems, 137 were found unannotated, and 94, 29, and 66 were exclusively expressed in FC, PH, and HD, respectively. However, on eliminating the fixed points of p values and FDR from the entire raw data, only 11 genes related to long noncoding RNA, 12 genes related to luteinization, and 3 genes related to follicular maturation were exclusively expressed in FC, PH, and HD culture systems, respectively. The quantitative real time-PCR validation and the next generation sequencing data had more than 90% correlation. Bioinformatics analyses of the exclusively expressed SDEG revealed that the freshly aspirated GCs were a true representative of GCs from small follicles (<8 mm diameter), the GC spheroids under PH maintained mitochondrial function, and those cultured in HD system for 6 days simulated the inflammatory milieu required for ovulation. Therefore, the comparative transcriptome profile also reinforced that HD culture system is better in vitro culture method than the other methods analyzed in this study for buffalo GC.

Effect of Vedic music on steroidogenic gene expression in 3D-cultured buffalo granulosa cell spheroids model system, a pilot study.

Music is known for reducing stress, anxiety and depression, improving cognitive performance, and enhancing oestrogen levels. However, its effect on non-auditory mammalian cell system and the molecular events leading to higher oestrogen levels is less explored. Therefore, the present study targeted to know the direct effects of a peaceful Vedic music on 3D cultured buffalo granulosa cell spheroids. The spheroids were daily exposed to the Mahamrityunjaya mantra, a kind of Vedic chants, for 1.5 hr for 6 days. After 6 days, the music effect was analysed by the expression analysis of steroidogenic (CYP19A1, STAR and HSD17ß1) and proliferative marker (PCNA) genes. Interestingly, the CYP19A1 gene expression was significantly upregulated by 3.464 ± 0.15 folds in the music exposed spheroids than the non-exposed spheroids. However, the expression of other steroidogenic and proliferative genes was unaltered. These observations provided a transcriptional clue for higher estradiol levels by the music and a scope to use Vedic chants for increasing the CYP19A1 expression to help tackle some pathophysiological conditions.

Reverse transcription-loop mediated isothermal amplification (RT-LAMP) assay for detection of AhR receptor responsive xenobiotics.

Dioxins are a group of highly toxic environmental persistent organic pollutants, which are lipophilic in nature. 2, 3, 7, 8- tetrachlorodibenzo-p-dioxin (TCDD) is the most toxic representative of this class. TCDD causes several human health effects like endocrine disruption, carcinogenesis and reproductive toxicity mediated by aryl-hydrocarbon receptor. Current detection methods of dioxins like gas chromatography-mass spectrometry, liquid chromatography-mass spectrometry etc. are costly and time consuming. Therefore, the present study aims to develop a relatively faster and cheaper technique called reverse transcription-loop mediated isothermal amplification (RT-LAMP) assay to detect dioxins. Cultured granulosa cells used as a model system were treated with different doses (5, 10 and 15 pg/mL) of aryl hydrocarbon receptor (AhR)responsive xenobiotic, TCDD, in accordance with maximum residue limit values. Cells were treated for 6, 12 and 24 h, respectively to study the gene expression of TCDD receptor called AhR and AhR responsive genes, CYP1A1 and CYP1B1, in a dose and time dependent manner. All targeted genes expression significantly increased after 6 and 12 h by 1.3-8 folds. For the development of RT-LAMP assay, CYP1A1 gene was used with 6 h TCDD treatment. RT-LAMP assay was standardized with optimal color change at 30 min using 50 ng of cellular RNA. In all the cases, we could distinguish RT-LAMP-positive condition from one sample to another sample due to intensity of color. The method was also validated by spectrometric method. In conclusion, the developed method will be used to screen AhR receptor responsive xenobiotics by observing the color change in RT-LAMP assay like dioxin used in the present study.

Gold nanoparticles modulate the steroidogenic and apoptotic pathway in a buffalo granulosa cell model.

OBJECTIVES: Granulosa cells are associated with steroidogenesis and ovarian function in females. Aims of the study are to understand the effects of gold nanoparticles (AuNP) on steroidogenesis and apoptotic pathway associated genes in buffalo granulosa cells. RESULTS: The AuNP were prepared chemically and thereby characterized by transmission electron microscope (TEM) imaging, absorbance and dynamic light scattering (DLS) measurements for hydrodynamic diameter and zeta potential. The cultured buffalo granulosa cells (BGC) were co-incubated with AuNP in two concentrations (2 × 109 and 2 × 1010 AuNP/ml) for 24 h. Treatment of BGC with AuNP significantly modulated the steroidogenesis associated genes (3ß-Hsd and Cyp19A1) expression and progesterone accumulation in the culture fluid. AuNP affected the apoptotic pathway in BGC by affecting the gene expression of Caspase-3, Bad and Bax. The AuNP did not exert oxidative stress through anti-oxidant induction & lipid peroxidation in the buffalo GC. CONCLUSIONS: AuNP may modulate the endocrine system by having impact on the steroidogenesis pathway and also have the potential to affect apoptotic pathway in a buffalo granulosa cell model.

An efficient method for extracting next-generation sequencing quality RNA from liver tissue of recalcitrant animal species.

The next-generation RNA sequencing technologies expedite the discovery of a large number of novel transcripts and genes associated with various pathophysiological conditions. These technologies involve poly(A) enrichment, which in turn requires micrograms of high-quality total RNA. Unfortunately, the available RNA isolation approaches produce poor quality total RNA from difficult-to-isolate animal tissues, such as the liver with high glycogen content. Moreover, the extraction efficiencies of these approaches vary significantly depending on the animal species. To address this challenge, we optimized a three-step protocol for the extraction of high-yield and high-quality total RNA from the liver tissue (LT). The procedure effectively resolved the problem of glycogen coprecipitation by its stepwise removal. No signs of RNA degradation on gel electrophoresis analysis and RNA integrity number values ≥8.5 indicated that the extracted RNA is suitable for downstream processing, such as poly(A) enrichment and transcriptome profiling. To demonstrate the robustness of the novel protocol, a comparison was made with other currently available RNA extraction approaches from diverse resources. Whereas other protocols yielded partially degraded bands with either decreased or reversed ribosomal RNA (rRNA) ratio, our protocol yielded intact rRNA with a ratio of 2.0 ± 0.1. This optimized protocol was also successfully followed for other animal tissues, such as the bone and muscles. In conclusion, the study has described a highly efficient method for the next-generation sequencing quality RNA isolation from LT across a broad range of animal species, with extended applicability to other difficult-to-isolate tissues.

High serum free fatty acids and low leptin levels: Plausible metabolic indicators of negative energy balance in early lactating Murrah buffaloes.

Lactation is a highly demanding event in mammals, including buffaloes. It modulates the partitioning of nutrients, energy utilization, and food intake of the mother to meet her own and infant's energy needs. Failure to satisfy these energy needs leads to Negative Energy Balance (NEB). Currently, the only available indirect NEB indicator is Body Condition Score (BCS). However, direct dependency of the BCS on the peak depletion of body fat causes its inefficient use in a dairy farm. Thus, to establish objective NEB indicators in buffaloes, the serum levels of biochemical (serum ß-hydroxybutyrate [BHBA] and free fatty acids [FFAs]), and endocrine (Growth Hormone [GH], insulin-like growth factor1 [IGF1], Insulin, and leptin) parameters were estimated in buffaloes. Our results revealed that serum FFA levels were significantly (p < 0.05) higher in high milk yielders (HMY) than low milk yielders (LMY) and heifers (H) during the 3rd and the 4th weeks of postpartum. The serum FFA levels were also significantly (p < 0.001) higher in the postpartum buffaloes with BCS < 3 in the field conditions. Further, serum leptin levels were significantly (p < 0.05) lower in HMY than LMY during the 3rd week of postpartum. However, the BHBA, GH, IGF1, and insulin levels were not significantly different between lactating buffaloes and H. These observations indicated that the NEB condition is probably restricted to the first month of early lactation in buffaloes. In conclusion, the simultaneous higher FFA and lower leptin levels could act as direct plausible metabolic indicators of NEB in buffaloes.

Inhibition of indoleamine 2,3-dioxygenase attenuates endotoxin-mediated tolerance in granulosa cells through kynurenine pathway.

Ovarian granulosa cells (GCs) have been shown to have innate immune capabilities, which modulate their native endocrine functions through toll-like receptors (TLRs). We have recently shown that GCs exposed to lipopolysaccharide (LPS; 1.0 µg/mL) transiently regulate proinflammatory cytokine expression (interleukin 1ß [IL-1ß], IL-6, and tumor necrosis factor α) through chromatin remodeling. In the present study, we have demonstrated that GCs become tolerant to LPS on repeated exposure of LPS. To understand the mechanism of this endotoxin tolerance (ET) phenomenon in buffalo GCs, we have further studied the genome-wide transcriptomic analyses in buffalo GCs (unpublished data) and identified indoleamine 2,3-dioxygenase 1 (IDO1) gene, known to be involved in tryptophan catabolism, was found to be highly upregulated in endotoxin-tolerant GCs. Real-time gene expression analyses also showed similar results. Further analyses of tryptophan and tryptophan metabolite, kynurenine, showed that tryptophan was found to be depleted with the accumulation of kynurenine in the endotoxin-tolerant GCs. The effect of IDO1 induced ET was reversed when cells were pretreated with IDO1 inhibitor (1-methyl tryptophan, 1 mM). To the best of our knowledge, this is the first report describing the role of IDO1 gene in ET in GCs mimicked by repeated endotoxin exposure in vitro. In summary, the present study convincingly demonstrated that the tryptophan catabolism, through the kynurenine pathway, plays a crucial role as an immunomodulatory mechanism of ET in GCs. The finding could be exploited in developing potential therapeutics to treat impaired GCs function due to the ET underlying prolonged uterine or systemic infection leads to accumulation of endotoxin in follicular fluid.

Buffalo liver transcriptome analysis suggests immune tolerance as its key adaptive mechanism during early postpartum negative energy balance.

Females undergo negative energy balance (NEB) during the early postpartum period to meet the lactation demands. The liver, being the key metabolic organ, plays a major role in handling NEB. Dairy animals handling high lactation demands are better models to understand the liver adaptive mechanisms during this phase. Therefore, we analyzed the liver transcriptome of dairy buffaloes during early postpartum. Liver biopsies were performed on three lactating buffaloes on the 15th and the 30th days of early postpartum and three heifers (controls) at the diestrous stage. Paired-end Next Generation Sequencing (NGS) identified 509 significantly differentially expressed genes (SDE) in the liver among the three groups. The SDE with log2 fold change > 3 and the unique SDE revealed the promotion of immune suppression (e.g., TCR), apoptosis (e.g., CCDC103), PGF2α synthesis, fat accumulation (e.g., BGLAP) and liver regeneration (e.g., FGF10) pathways, and the downregulation of antigen presentation (e.g., BOLA-DQA) on the 15th day of lactation. Consistently upregulated genes on the 15th and 30th days of early postpartum indicated the promotion of immune tolerance (e.g., IFITM3), medium and long-chain fatty acids' oxidation (e.g., ACSM3), and lipid accumulation (e.g., INSIG1). However, consistently downregulated genes during early postpartum showed immunosuppression, the downregulation of gluconeogenesis from amino acids (e.g., DDO), and the biosynthesis of taurine (e.g., CSAD) and unsaturated fatty acids (e.g., SCD). Functional annotation and network analyses also indicated the promotion of immune tolerance, fat accumulation and decreased gluconeogenesis from amino acids, and estrogen metabolism on the 15th day of lactation. Overall, the liver showed immune tolerance as an adaptive mechanism during early postpartum of buffaloes.

Three-dimensional culture of buffalo granulosa cells in hanging drop mimics the preovulatory follicle stage.

Granulosa cell (GC) culture models mimicking the intrafollicular environment are limited. Such models have a great potential in reproductive toxicity studies. The buffalo, a monovulatory species like humans, could be a better model than polyovulatory rodents. Therefore, we targeted the development and characterization of three-dimensional (3D) culture systems for buffalo GCs. The GCs from small ovarian follicles (SF) maintained the CYP19 gene expression for 144 hr in a 2D culture system. Hence, GCs from SF were cultured directly in 3D using hanging drop and Poly-([2-hydroxyethyl methacrylate]) (polyHEMA) methods in the DMEM media containing 1 ng/ml FSH and 10 ng/ml IGF-1 for 144 hr. The expression profile of nine GC-specific transcripts; CYP19, TNFAIP6, AMH, PTI, NR4A1, FSHR, RUNX, LHR, and COX2/PTGS2; revealed that 3D-spheroids developed in hanging drop method maintained the GC phenotype of preovulatory follicles. Therefore, hanging drop method is a best method for culturing GCs to mimic the intrafollicular environment.

A highly efficient method for extracting next-generation sequencing quality RNA from adipose tissue of recalcitrant animal species.

The next-generation sequencing (NGS) based RNA sequencing (RNA-Seq) and transcriptome profiling offers an opportunity to unveil complex biological processes. Successful RNA-Seq and transcriptome profiling requires a large amount of high-quality RNA. However, NGS-quality RNA isolation is extremely difficult from recalcitrant adipose tissue (AT) with high lipid content and low cell numbers. Further, the amount and biochemical composition of AT lipid varies depending upon the animal species which can pose different degree of resistance to RNA extraction. Currently available approaches may work effectively in one species but can be almost unproductive in another species. Herein, we report a two step protocol for the extraction of NGS quality RNA from AT across a broad range of animal species.

Reverse transcription loop-mediated isothermal amplification (RT-LAMP), a light for mammalian transcript analysis in low-input laboratories.

Transcript analysis is usually performed by costly, time-consuming, and expertise intensive methods, like real time-PCR, microarray, etc. However, they are not much feasible in low-input laboratories. Therefore, we implemented the reverse transcription loop-mediated isothermal amplification (RT-LAMP) as a means of mammalian transcript analysis. Particularly, RT-LAMP was developed for buffalo aromatase cytochrome P450 (CYP19) transcript, to study its expression in 3D-cultured buffalo granulosa cells, which were exposed to lipopolysaccharide (LPS). The CYP19-RT-LAMP assay rapidly identified the LPS-induced downregulation of the CYP19 gene within 30 min at 63°C in a water bath. The assay was visualized via unaided eye by observing the change in turbidity and fluorescence, which were decreased by increasing the LPS exposure time to granulosa cells. Overall, the developed CYP19-RT-LAMP assay provided a hope on the application of RT-LAMP for mammalian transcript analysis in low-input laboratories.

Curcumin primed exosomes reverses LPS-induced pro-inflammatory gene expression in buffalo granulosa cells.

Curcumin possesses anti-inflammatory properties and provides a promising treatment for inflammation. The aim of the study is to establish that buffalo granulosa cells when primed with curcumin (20 µM), release improved cellular contents through exosome that can mitigate granulosa cell dysfunction. Recently, we have shown that buffalo granulosa cells exposed to LPS (1 µg/mL) in serum free culture, transiently increased the pro-inflammatory cytokine genes (IL-1ß, TNF-α, IL-6) expression followed by the inhibition of CYP19A1 gene expression and estradiol production. Therefore, LPS-treated granulosa cells were used as a model of inflammation and curcumin primed exosomes were utilized to check their potential for reducing granulosa cell dysfunction. Expression level of pro-inflammatory cytokines and CYP19A1 were detected by real time PCR while estradiol levels were measured by ELISA. Exosomes derived from curcumin-treated cells alleviated LPS mediated inflammation. In conclusion, our study potentiates the use of curcumin primed exosomes in mitigating granulosa cell dysfunction. Results show the therapeutic conservatories of curcumin via primed exosomes.

Differentially expressed miRNA-210 during follicular-luteal transition regulates pre-ovulatory granulosa cell function targeting HRas and EFNA3.

Ovarian folliculogenesis, ovulation, and luteinization are an important prerequisite for fertility performance in mammals. Spatial and temporal key factors and proteins for their regulation are well known. Recent advancement in the field of molecular biology led to the discovery of another class of gene regulators, microRNA (miRNA). Previous studies on profiling of miRNA in buffalo ovaries revealed that miRNA-210 (miR-210) is differently expressed in follicular-luteal transition. Therefore, the present study was planned to ascertain the role of miR-210 in buffalo granulosa cells. Cultured granulosa cells were transfected with miR-210 mimic. Effect of overexpression of miR-210 was analyzed on granulosa cell marker genes (CYP19A1 and PCNA) which were significantly downregulated (P < 0.05). Further, target genes of miR-210 were screened using Target Scan software v7.1 and a list of 37 genes with cumulative weight context score (CWCS) > 0.5 was sorted followed by their functional annotation and network analyses using PANTHER and STRING software. Bioinformatics analyses identified HRas gene as a potential hub gene of miR-210 targeted genes. HRas has been shown to be involved in diverse biological pathways regulating ovarian functions. An expression analysis of HRas was further validated both in vitro and in vivo. EFNA3 (EFHRIN-A3), another identified target of miR-210 known to be involved in angiogenesis, was also downregulated in miR-210 transfected granulosa cells. In conclusion, the present study demonstrated that miR-210 can regulate granulosa cell function at preovulatory stage through HRas and EFNA3. Further studies are needed to find the mechanism how miR-210 regulates the granulosa cells function through these targets.

Prediction of shorter oligonucleotide sequences recognizing aflatoxin M1.

Aflatoxin M1 (AFM1) is present in milk of lactating animals fed on aflatoxin B1 contaminated feeds. Aptamers are new emerging ligand molecules and can be employed in assay protocols. Shorter aptamers have several advantages. Untruncated (72-nucleotide long) and truncated (18- to 42-nucleotide long) aptamers were evaluated for AFM1 recognition that was detected by color change in aptamer-conjugated gold nanoparticles in the presence of AFM1. Truncation of 10 aptamers was designed to retain motifs. Untruncated and truncated aptamers recognized AFM1. Binding region on truncated aptamers was predicted by aligning sequences with reported aptamer "ACTGCTAGAGATTTTCCACAT". Aptamer "AFAS3Tr" (ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGA), APM15Tr (CAACGCCAGTCAGTATCTTATATGCTATACTGGCTGGTGTTG), AFA4Tr (AAAA-ACACTATGTAGTGGTGT), AFAM7Tr (CCGGCGGATGCTAATTGCAGAGCAGGTGTGCCGG), and APM6Tr (AAAAATAATTCTAGGTTA) derived from random region of oligonucleotide library had strong homology with 8-nucleotide (ACTGCTAG) sequence at 5' end of reported aptamer. Comparison of sequence alignment of each of five truncated aptamers with reported sequence has allowed concluding that CTGCTCTGACGCTG in AFAS3Tr, ACGCCAG in APM15Tr, ACTATGTAG in AFA4Tr, TGCTA in AFAM7Tr, AATTCTAG in APM6Tr, and ACTGCTAG in reported aptamer are probable binding regions in aptamers. Truncated aptamers APM15Tr, AFAS3Tr, AFAM7Tr, APM6Tr, AFA4Tr, and predicted shorter nucleotide sequences offer promise for further exploitation in developing sensitive methods for AFM1 measurement.

Postpartum uterine infection & ovarian dysfunction.

Postpartum uterine infections such as metritis, endometritis and mastitis have been considered as underlying causes for ovarian dysfunction in mammals. Almost all mammals, particularly dairy animals are susceptible to postpartum uterine infections, resulting in impaired fertility and economic loss. One of the factors for low fertility in females is ovarian dysfunction, which is exhibited as impaired growth and function of ovarian follicles by the postpartum infection. Immune system of mammals provides a host defence mechanism against pathogenic microbes through the recognition of pathogen-associated molecular patterns (PAMPs) and forming inflammasomes. Like immune cells, ovarian granulosa cells also exhibit a similar pattern of cytokine gene expressions on exposure to PAMPs. Genome-wide transcriptomic approaches explored the molecular mechanisms underlying the immune function of buffalo granulosa cells during endotoxin exposure. Understanding the molecular mechanism of ovarian dysfunction due to uterine infection would be helpful to implement various strategies to handle the adverse effects of postpartum uterine disease on fertility by developing potential therapeutics. Therefore, this article focuses on key factors that are responsible for postpartum infection and particularly summarizes the molecular mechanism of infection underlying the ovarian dysfunction in dairy animals.

A syntenic locus on buffalo chromosome 20: novel genomic hotspot for miRNAs involved in follicular-luteal transition.

The developmental reorganization of ovarian follicular granulosa cells (GC) during follicular maturation, ovulation, and luteinization require a well-controlled regulation of dynamic gene expression profiles. Recently, microRNAs (miRNAs) were found to be key players of ovarian follicular dynamics. The current study aimed to understand the miRNA regulatory role in follicular-luteal transition by characterizing the miRNA profile through miRNA-seq at different follicular (small, medium, and large) and luteal (early, mid, and late) stages in Indian water buffaloes, mono-ovulatory animals like humans. A total of 517 miRNAs were identified in follicular granulosa cells (GC) and corpus luteum (CL) together. Among them, 2 unique and 40 novel miRNAs were in GC; 15 unique and 45 novel miRNAs were in CL. Among the remaining 415 annotated common miRNAs between GC and CL, 43 have showed significant (p < 0.05) differential expression between GC and CL. Particularly, 39 and 4 miRNAs showed higher expression in CL and GC, respectively, with respect to each other. Genome mapping analysis revealed that 71.7% of differential miRNAs having higher expression in CL compared to GC, and 93% of the unique miRNAs in CL were mapped to a short chromosomal region of 0.7 Mb (67.4 to 68.1 Mb) on chromosome 21 of cows which is syntenic to the buffalo chromosome 20. Clustering of all these miRNAs at this locus suggests it as a chromosomal hotspot for miRNAs involved in follicular-luteal transition, especially for CL physiological functions.