Importance of clitellar tissue in the regeneration ability of earthworm Eudrilus eugeniae.

Among the annelids, earthworms are renowned for their phenomenal ability to regenerate the lost segments. The adult earthworm Eudrilus eugeniae contains 120 segments and the body segments of the earthworm are divided into pre-clitellar, clitellar and post-clitellar segments. The present study denoted that clitellum plays vital role in the successful regeneration of the species. We have performed histological studies to identify among the three skin layers of the earthworm, which cellular layer supports the blastema formation and regeneration of the species. The histological evidences denoted that the proliferation of the longitudinal cell layer at the amputation site is crucial for the successful regeneration of the earthworm and it takes place only in the presence of an intact clitellum. Besides we have performed clitellar transcriptome analysis of the earthworm Eudrilus eugeniae to monitor the key differentially expressed genes and their associated functions and pathways controlling the clitellar tissue changes during both anterior and posterior regeneration of the earthworm. A total of 4707 differentially expressed genes (DEGs) were identified between the control clitellum and clitellum of anterior regenerated earthworms and 4343 DEGs were detected between the control clitellum and clitellum of posterior regenerated earthworms. The functional enrichment analysis confirmed the genes regulating the muscle mass shape and structure were significantly downregulated and the genes associated with response to starvation and anterior-posterior axis specification were significantly upregulated in the clitellar tissue during both anterior and posterior regeneration of the earthworm. The RNA sequencing data of clitellum and the comparative transcriptomic analysis were helpful to understand the complex regeneration process of the earthworm.

Draft Genome Sequence of the Earthworm Eudrilus eugeniae.

Background: Earthworms are annelids. They play a major role in agriculture and soil fertility. Vermicompost is the best organic manure for plant crops. Eudrilus eugeniae is an earthworm well suited for efficient vermicompost production. The worm is also used to study the cell and molecular biology of regeneration, molecular toxicology, developmental biology, etc., because of its abilities like high growth rate, rapid reproduction, tolerability toward wide temperature range, and less cost of maintenance. Objective: The whole genome has been revealed only for Eisenia andrei and Eisenia fetida. Methods: In the present work, we sequenced the genome of E. eugeniae using the Illumina platform and generated 160,684,383 paired-end reads. Results: The reads were assembled into a draft genome of size 488 Mb with 743,870 contigs and successfully annotated 24,599 genes. Further, 208 stem cell-specific genes and 3,432 non-coding genes were identified. Conclusion: The sequence and annotation details were hosted in a web application available at https://sudhakar-sivasubramaniam-labs.shinyapps.io/eudrilus_genome/.

The transcriptome of anterior regeneration in earthworm Eudrilus eugeniae.

The oligochaete earthworm, Eudrilus eugeniae is capable of regenerating both anterior and posterior segments. The present study focuses on the transcriptome analysis of earthworm E. eugeniae to identify and functionally annotate the key genes supporting the anterior blastema formation and regulating the anterior regeneration of the worm. The Illumina sequencing generated a total of 91,593,182 raw reads which were assembled into 105,193 contigs using CLC genomics workbench. In total, 40,946 contigs were annotated against the NCBI nr and SwissProt database and among them, 15,702 contigs were assigned to 14,575 GO terms. Besides a total of 9389 contigs were mapped to 416 KEGG biological pathways. The RNA-Seq comparison study identified 10,868 differentially expressed genes (DEGs) and of them, 3986 genes were significantly upregulated in the anterior regenerated blastema tissue samples of the worm. The GO enrichment analysis showed angiogenesis and unfolded protein binding as the top enriched functions and the pathway enrichment analysis denoted TCA cycle as the most significantly enriched pathway associated with the upregulated gene dataset of the worm. The identified DEGs and their function and pathway information can be effectively utilized further to interpret the key cellular, genetic and molecular events associated with the regeneration of the worm.

Finding of novel telomeric repeats and their distribution in the human genome.

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Exploiting the unique phenotypes of the earthworm Eudrilus eugeniae to evaluate the toxicity of chemical substances.

Both the evaluation and the determination of toxicity of chemical substances present in the environment have implications in human health. In this present study, the natural phenomenon named autotomy, a self-defense mechanism employed by several animals against the toxic chemical contaminants, was considered to assess the toxicity of different chemical substances. We investigated the effects of glucose, sodium chloride, kanamycin, mercuric chloride, arsenic trioxide, and lead oxide on the phenotypes of earthworm Eudrilus eugeniae. Depending on the concentration of different chemicals, worms exhibit unique phenotypes. These phenotypes can be used to identify the toxicity as well as the toxic concentration of the chemicals. Upon exposure to toxic chemicals, worms use different mechanical forces at the site of cleavage furrow to detach its segments. During the detachment, there is no apparent blood loss at both the ends of the worm. Our results show that the mercuric chloride is toxic at the concentration above 5 µg when compared to other chemicals. Based on our findings, the toxic effects of a chemical and the toxic concentration of a chemical can be evaluated in both cost and time-efficient manner; in addition, these chemicals can be classified into the following categories: (1) mercuric chloride is extreme-toxic, (2) arsenic trioxide and lead oxide is toxic, (3) kanamycin and sodium chloride is low-toxic, and (4) glucose is non-toxic.

Unique phenotypes in the sperm of the earthworm Eudrilus eugeniae for assessing radiation hazards.

The earthworm, Eudrilus eugeniae is a segmented worm. It has two pairs of testes whose cells are highly proliferative. It was found that the earthworm, which is irradiated with X-ray, shows the following phenotypic changes in its sperm: fragmented acrosome in the head, break in the tail, and the appearance of zigzag sperm tail. Sperm morphology can be used as a tool to study radiation hazards in local areas. These three phenotypes were not observed in the sperm of worms exposed to different concentration of toxic chemicals such as sodium arsenate, lead acetate, and mercuric chloride. In contrast, exposure of worms to ethidium bromide caused fragmented acrosome in the head of their sperm cells.

Preliminary investigation on the impact of engineered PVP-capped and uncapped silver nanoparticles on Eudrilus eugeniae, a terrestrial ecosystem model.

Recently, the production of silver nanoparticles and their commercial products has generated increased concern and caused a hazardous impact on the ecosystem. Therefore, the present study examines the toxic effect of chemically engineered silver nanoparticles (SNPs) and polyvinylpyrrolidone-capped silver nanoparticles (PVP-SNPs) on the earthworm Eudrilus eugeniae (E. eugeniae). The SNPs and PVP-SNPs were synthesized, and their characterization was determined by UV-vis spectroscopy, Fourier transform infrared spectroscopy, X-ray diffraction, and transmission electron microscopy. The toxicity of SNPs and PVP-SNPs was evaluated using E. eugeniae. The present result indicates that the lethal concentration (LC50) of SNPs and PVP-SNPs were achieved at 22.66 and 43.27 µg/mL, respectively. The activity of antioxidant enzymes including superoxide dismutase (SOD) and catalase (CAT) was increased in SNPs compared to PVP-SNPs. Importantly, we have noticed that the E. eugeniae can amputate its body segments after exposure to SNPs and PVP-SNPs. This exciting phenomenon is named "autotomy," which describes a specific feature of E. eugeniae to escape from the toxic contaminants and predators. Accordingly, we have suggested this unique behavior may facilitate to assess the toxic effect of SNPs and PVP-SNPs in E. eugeniae.

Harbingers of Hope: Scientists and the Pursuit of World Peace.

The ongoing wars in many regions-such as the conflict between Israel and Hamas-as well as the effects of war on communities, social services, and mental health are covered in this special editorial. This article emphasizes the need for international efforts to promote peace, offer humanitarian aid, and address the mental health challenges faced by individuals and communities affected by war and violence.

Advances in targeting the WNT/ß-catenin signaling pathway in cancer.

WNT/ß-catenin signaling orchestrates various physiological processes, including embryonic development, growth, tissue homeostasis, and regeneration. Abnormal WNT/ß-catenin signaling is associated with various cancers and its inhibition has shown effective antitumor responses. In this review, we discuss the pathway, potential targets for the development of WNT/ß-catenin inhibitors, available inhibitors, and their specific molecular interactions with the target proteins. We also discuss inhibitors that are in clinical trials and describe potential new avenues for therapeutically targeting the WNT/ß-catenin pathway. Furthermore, we introduce emerging strategies, including artificial intelligence (AI)-assisted tools and technology-based actionable approaches, to translate WNT/ß-catenin inhibitors to the clinic for cancer therapy.

Data on genome annotation and analysis of earthworm Eisenia fetida.

The present article reports the complete draft genome annotation of earthworm Eisenia fetida, obtained from the manuscript entitled "Timing and Scope of Genomic Expansion within Annelida: Evidence from Homeoboxes in the Genome of the Earthworm E. fetida" (Zwarycz et al., 2015) and provides the data on the repetitive elements, protein coding genes and noncoding RNAs present in the genome dataset of the species. The E. fetida protein coding genes were predicted from AUGUSTUS gene prediction and subsequently annotated based on their sequence similarity, Gene Ontology (GO) functional terms, InterPro domains, Clusters of Orthologous Groups (COGs) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways information. The genome wide comparison of orthologous clusters and phylogenomic analysis of the core genes were performed to understand the events of genome evolution and genomic diversity between E. fetida and its related metazoans. In addition, the genome dataset was screened to identify the crucial stem cell markers, regeneration specific genes and immune-related genes and their functionally enriched GO terms were predicted from Fisher׳s enrichment analysis. The E. fetida genome annotation data containing the GFF (general feature format) annotation file, predicted coding gene sequences and translated protein sequences were deposited to the figshare repository under the DOI: https://doi.org/10.6084/m9.figshare.6142322.v1.

Draft Genome Sequence of Escherichia coli Phage CMSTMSU, Isolated from Shrimp Farm Effluent Water.

The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa. Here we report the draft genome sequence, assembly, and annotation of the isolated CMSTMSU phage. This genome resource can be used to utilize the phage as a crucial biocontrol agent in the fish aquaculture sector.

Data on genome sequencing, analysis and annotation of a pathogenic Bacillus cereus 062011msu.

Bacillus species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012) [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production. In the present study, we have performed the whole genome sequencing of the pathogenic isolate using the Ion Torrent sequencing platform and generated 458,944 raw reads with an average length of 198.2 bp. The genome sequence was assembled, annotated and analysed for the genetic islands, metabolic pathways, orthologous groups, virulence factors and antibiotic resistance genes associated with the pathogen. Simultaneously the 16S rRNA sequencing study and genome sequence comparison data confirmed that the strain belongs to the species Bacillus cereus and exhibits 99% sequence homo;logy with the genomes of B. cereus ATCC 10987 and B. cereus FRI-35. Hence, we have renamed the organism as Bacillus cereus 062011msu. The Whole Genome Shotgun (WGS) project has been deposited at DDBJ/ENA/GenBank under the accession NTMF00000000 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA404036(SAMN07629099)).

Annotation of nerve cord transcriptome in earthworm Eisenia fetida.

In annelid worms, the nerve cord serves as a crucial organ to control the sensory and behavioral physiology. The inadequate genome resource of earthworms has prioritized the comprehensive analysis of their transcriptome dataset to monitor the genes express in the nerve cord and predict their role in the neurotransmission and sensory perception of the species. The present study focuses on identifying the potential transcripts and predicting their functional features by annotating the transcriptome dataset of nerve cord tissues prepared by Gong et al., 2010 from the earthworm Eisenia fetida. Totally 9762 transcripts were successfully annotated against the NCBI nr database using the BLASTX algorithm and among them 7680 transcripts were assigned to a total of 44,354 GO terms. The conserve domain analysis indicated the over representation of P-loop NTPase domain and calcium binding EF-hand domain. The COG functional annotation classified 5860 transcript sequences into 25 functional categories. Further, 4502 contig sequences were found to map with 124 KEGG pathways. The annotated contig dataset exhibited 22 crucial neuropeptides having considerable matches to the marine annelid Platynereis dumerilii, suggesting their possible role in neurotransmission and neuromodulation. In addition, 108 human stem cell marker homologs were identified including the crucial epigenetic regulators, transcriptional repressors and cell cycle regulators, which may contribute to the neuronal and segmental regeneration. The complete functional annotation of this nerve cord transcriptome can be further utilized to interpret genetic and molecular mechanisms associated with neuronal development, nervous system regeneration and nerve cord function.

Function of translationally controlled tumor protein (TCTP) in Eudrilus eugeniae regeneration.

TCTP (Translationally Controlled Tumour Protein) is a multifunctional protein that plays a role in the development, immune system, tumour reversion, and maintenance of stem cells. The mRNA of the Tpt1 gene is over-expressed during liver regeneration. But, the function of the protein in regeneration is not known. To study the role of the protein in regeneration, the earthworm Eudrilus eugeniae was chosen. First, the full length cDNA of the Tpt1 gene was sequenced. The size of the cDNA is 504 bp and the protein has 167 amino acids. The highest level of TCTP expression was documented in the worm after three days of regeneration. The protein was found to be expressed specifically in the epithelial layer of the skin. During regeneration, the protein expression was found to be the highest at the tip of blastema. The pharmacological suppression of TCTP using nutlin-3 and TCTP RNAi experiments resulted in the failure of the regeneration process. The suppression of TCTP caused the arrest of proliferation in posterior amputated worms. The severe cell death was documented in the amputated region of nutlin-3 injected worm. The silencing of TCTP has blocked the modification of clitellar segments. The experiments confirm that TCTP has major functions in the upstream signalling of cell proliferation in the early regeneration process in E. eugeniae.

Studies on regeneration of central nervous system and social ability of the earthworm Eudrilus eugeniae.

Earthworms are segmented invertebrates that belong to the phylum Annelida. The segments can be divided into the anterior, clitellar and posterior parts. If the anterior part of the earthworm, which includes the brain, is amputated, the worm would essentially survive even in the absence of the brain. In these brain amputee-derived worms, the nerve cord serves as the primary control center for neurological function. In this current work, we studied changes in the expression levels of anti-acetylated tubulin and serotonin as the indicators of neuro-regenerative processes. The data reveal that the blastemal tissues express the acetylated tubulin and serotonin from day four and that the worm amputated at the 7th segment takes 30 days to complete the regeneration of brain. The ability of self-assemblage is one of the specific functions of the earthworm's brain. The brain amputee restored the ability of self-assemblage on the eighth day.

Cep164 is a mediator protein required for the maintenance of genomic stability through modulation of MDC1, RPA, and CHK1.

The activation of the ataxia telangiectasia mutated (ATM) and ATM/Rad3-related (ATR) kinases triggers a diverse cellular response including the initiation of DNA damage-induced cell cycle checkpoints. Mediator of DNA Damage Checkpoint protein, MDC1, and H2AX are chromatin remodeling factors required for the recruitment of DNA repair proteins to the DNA damage sites. We identified a novel mediator protein, Cep164 (KIAA1052), that interacts with both ATR and ATM. Cep164 is phosphorylated upon replication stress, ultraviolet radiation (UV), and ionizing radiation (IR). Ser186 of Cep164 is phosphorylated by ATR/ATM in vitro and in vivo. The phosphorylation of Ser186 is not affected by RPA knockdown but is severely hampered by MDC1 knockdown. siRNA-mediated silencing of Cep164 significantly reduces DNA damage-induced phosphorylation of RPA, H2AX, MDC1, CHK2, and CHK1, but not NBS1. Analyses of Cep164 knockdown cells demonstrate a critical role of Cep164 in G2/M checkpoint and nuclear divisions. These findings reveal that Cep164 is a key player in the DNA damage-activated signaling cascade.