Discovery and Development of Novel Drugs.

Drug discovery and development process is nowadays conducted in relatively standardised sequence of phases, starting with Discovery and being followed by Preclinical, Clinical and Non-Clinical Development. Discovery phase is divided in Hit Finding, Lead generation, Lead Optimisation and Candidate Identification Phase. Main drivers of the whole process are regulatory requirements and the aim to eliminate the unnecessary spending by early elimination of unlikely drug candidates. Marine products, once purified, isolated and produced in required quantities, follow the same route as any other synthetic drug.

The association between proinflammatory cytokine polymorphisms and cerebral palsy in very preterm infants.

Cerebral palsy (CP) is a nonprogressive motor disorder caused by white matter damage in the developing brain and is often accompanied with cognitive and sensory disabilities. The risk of CP is higher among infants born preterm than in more mature infants. Intrauterine infection/inflammation, activation of the cytokine network and elevated levels of proinflammatory cytokines in neonatal blood or in amniotic fluid to which the preterm infant is exposed, has been identified as the most common cause of preterm delivery, periventricular leukomalacia (PVL) and CP. The aim of our study was to evaluate the possible association of four TNFα promoter single nucleotide polymorphisms (SNPs) (-1031 T/C, -857 C/T, -308 G/A and -238 G/A), two IL1ß SNPs (-511 C/T and +3954 C/T) and one IL6 (-174 C/G) polymorphism with susceptibility to CP in very preterm infants. Statistically significant association between TNFα -1031 T/C high expression genotypes (TC and CC) (OR, 2.339; p=0.016) as well as between TNFα -1031 C high expression allele (OR, 2.065; p=0.013) and risk of CP was observed. In addition, statistically significant association was found between TNFα TC, CC, GG, GG -1031/-857/-308/-238 genotypes combination (OR, 3.286; p=0.034) and risk of CP. Statistically significant association between IL1ß TT, CC -511/+3954 genotypes combination and risk of CP (OR, 4.000; p=0.027) was also found. In CP patients with cystic PVL (cPVL) statistically significant association was found between TNFα -1031 T/C high expression genotypes (TC and CC) (OR, 2.361; p=0.038), IL1ß -511 C/T high expression genotype TT (OR, 3.215; p=0.030) as well as IL1ß -511 T high expression allele (OR, 1.956; p=0.019) and risk of CP. Statistically significant association was also found in patients with cPVL between TNFα TC, CC, GG, GG -1031/-857/-308/-238 genotypes combination (OR, 4.107; p=0.024), as well as IL1ß TT, CC -511/+3954 genotypes combination (OR, 7.333; p=0.005) and risk of CP. Our results suggest the role of TNFα and IL1ß polymorphisms which have previously been associated with higher circulating levels of these cytokines in genetic susceptibility to white matter damage and consequently CP in very preterm infants.

A novel class of fast-acting antimalarial agents: Substituted 15-membered azalides.

BACKGROUND AND PURPOSE: Efficacy of current antimalarial treatments is declining as a result of increasing antimalarial drug resistance, so new and potent antimalarial drugs are urgently needed. Azithromycin, an azalide antibiotic, was found useful in malaria therapy, but its efficacy in humans is low. EXPERIMENTAL APPROACH: Four compounds belonging to structurally different azalide classes were tested and their activities compared to azithromycin and chloroquine. in vitro evaluation included testing against sensitive and resistant Plasmodium falciparum, cytotoxicity against HepG2 cells, accumulation and retention in human erythrocytes, antibacterial activity, and mode of action studies (delayed death phenotype and haem polymerization). in vivo assessment enabled determination of pharmacokinetic profiles in mice, rats, dogs, and monkeys and in vivo efficacy in a humanized mouse model. KEY RESULTS: Novel fast-acting azalides were highly active in vitro against P. falciparum strains exhibiting various resistance patterns, including chloroquine-resistant strains. Excellent antimalarial activity was confirmed in a P. falciparum murine model by strong inhibition of haemozoin-containing trophozoites and quick clearance of parasites from the blood. Pharmacokinetic analysis revealed that compounds are metabolically stable and have moderate oral bioavailability, long half-lives, low clearance, and substantial exposures, with blood cells as the preferred compartment, especially infected erythrocytes. Fast anti-plasmodial action is achieved by the high accumulation into infected erythrocytes and interference with parasite haem polymerization, a mode of action different from slow-acting azithromycin. CONCLUSION AND IMPLICATIONS: The hybrid derivatives described here represent excellent antimalarial drug candidates with the potential for clinical use in malaria therapy.

Technological Advances in Preclinical Drug Evaluation: The Role of -Omics Methods.

Preclinical drug development is an essential step in the drug development process where the evaluation of new chemical entities occurs. In particular, preclinical drug development phases include deep analysis of drug candidates' interactions with biomolecules/targets, their safety, toxicity, pharmacokinetics, metabolism by use of assays in vitro and in vivo animal assays. Legal aspects of the required procedures are well-established. Herein, we present a comprehensive summary of current state-of-the art approaches and techniques used in preclinical studies. In particular, we will review the potential of new, -omics methods and platforms for mechanistic evaluation of drug candidates and speed-up of the preclinical evaluation steps.

Loss of heterozygosity testing using real-time PCR analysis of single nucleotide polymorphisms.

PURPOSE: Colon cancer is a genetic disease, caused by mutations in different oncogenes and tumor-suppressor genes. The aim of this study is to evaluate the usefulness of real-time PCR SNP analysis as a new technique in the loss of heterozygosity (LOH) analysis at the E-cadherin gene locus in sporadic colon cancer. METHODS: One-hundred cases of human sporadic colon cancer and corresponding normal tissue samples were analyzed using two flanking polymorphic markers commonly used in the LOH analysis at the E-cadherin gene locus by conventional VNTR-LOH analysis. Two intragenic E-cadherin SNP markers were analyzed using real-time PCR SNP analysis. RESULTS: LOH (17.6%) was detected using flanking markers, however, no LOH was detected when the intragenic E-cadherin SNP markers were introduced into our study. Since these markers are intragenic they more accurately represent the status of the E-cadherin gene than the previously used flanking markers. CONCLUSION: In conclusion, real-time PCR SNP analysis was found to be more accurate, faster, simpler, and a more high-throughput method than the conventional VNTR-LOH analysis.

Influence of H. pylori infection and eradication on p53, c-erbB-2 and Ki-67 in gastric mucosa.

BACKGROUND/AIMS: To evaluate the expression of antigens c-erbB-2, p53, and Ki-67 in gastric biopsy, bacteria density and urease activity in two groups of patients with chronic gastritis separated on the basis of the success or failure of H. pylori eradication. METHODOLOGY: Sixty-five patients with chronic gastritis were split in two groups (n=45/20) related to response to the therapy. The gastric mucosa samples (Sydney system) were analyzed histologically in both groups of patients before and after standard therapy (for eradicated, E group after one cycle; for non-eradicated, NE group after three cycles) for H. pylori infection, urease activity, c-erbB-2, p53 and Ki-67 expression. Sera samples taken before and after treatment were also analyzed for specific antibody against H. pylori. RESULTS: The eradication of H. pylori in patients of the E group was accompanied with significant lower colonization grades of bacteria, urease activity, proliferating rate, p53, and Ki-67 expression while c-erbB-2 expression was unchanged. In the NE group, all parameters were the same before and after therapy with exception of p53, which was slightly higher on both locations. Strong expression of c-erbB-2 in corpus of the NE group was determinate. Serum activity of specific antibodies against H. pylori was lower after the therapy in both groups of patients, but in the eradicated group this change was much stronger that in the non-eradicated. CONCLUSIONS: Long persisting infection is related with higher colonization grades of bacteria, urease activity, p53, c-erbB-2 and Ki-67 expression. Changes of those markers are connected with duration of infection and location where these changes were obtained.

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.

Design, synthesis, and in vitro activity of novel 2'-O-substituted 15-membered azalides.

Malaria remains one of the most widespread human infectious diseases, and its eradication will largely depend on antimalarial drug discovery. Here, we present a novel approach to the development of the azalide class of antimalarials by describing the design, synthesis, and characterization of novel 2'-O-substituted-9-deoxo-9a-methyl-9a-aza-9a-homoerythromycin A derivatives consisting of different quinoline moieties covalently liked to a 15-membered azalide scaffold at position 2'. By multistep straightforward synthesis, 19 new, stable, and soluble compounds were created and biologically profiled. Most active compounds from the 4-amino-7-chloroquinoline series showed high selectivity for P. falciparum parasites, and in vitro antimalarial activity improved 1000-fold over azithromycin. Antimalarial potency was equivalent to chloroquine against the sensitive strain (3D7A) and up to 48-fold enhanced over chloroquine against the chloroquine-resistant strain (W2). Concurrently, the antibacterial activity of the compounds was eliminated, thus facilitating the development of malaria-specific macrolide agents.

Novel hybrid molecules based on 15-membered azalide as potential antimalarial agents.

Malaria remains the most prevalent tropical disease, and due to the spread of resistant parasites novel therapeutics are urgently needed. Azithromycin has shown potential in malaria treatment so we designed hybrid azalide molecules with the aim to improve activity against and selectivity for the malaria parasite. Novel hybrid molecules comprising 4-aminoquinoline moiety covalently liked to 15-membered azalide scaffold at position C-3' were synthesized and biologically evaluated. Antimalarial testing against Plasmodium falciparum sensitive and resistant strains confirmed the improved in vitro activity over azithromycin and chloroquine. Selectivity of the compounds (HepG2 IC(50)/P. falciparum IC(50) ratio) for the parasite was high (100-2700) and their antibacterial activity diminished. Even though oral bioavailability determined for compound 12 was low, novel quinoline C-3'-substituted 15-membered azalides represent an interesting subclass of antimalarial macrolides that need further research and evaluation.

N'-substituted-2'-O,3'-N-carbonimidoyl bridged macrolides: novel anti-inflammatory macrolides without antimicrobial activity.

Macrolide antibiotics, like erythromycin, clarithromycin, and azithromycin, possess anti-inflammatory properties. These properties are considered fundamental to the efficacy of these three macrolides in the treatment of chronic inflammatory diseases like diffuse panbronchiolitis and cystic fibrosis. However, long-term treatment with macrolide antibiotics presents a considerable risk for promotion of bacterial resistance. We have examined antibacterial and anti-inflammatory effects of a novel macrolide class: N'-substituted 2'-O,3'-N-carbonimidoyl bridged erythromycin-derived 14- and 15-membered macrolides. A small focused library was prepared, and compounds without antimicrobial activity, which inhibited IL-6 production, were selected. Data analysis led to a statistical model that could be used for the design of novel anti-inflammatory macrolides. The most promising compound from this library retained the anti-inflammatory activity observed with azithromycin in lipopolysaccharide-induced pulmonary neutrophilia in vivo. Importantly, this study strongly suggests that antimicrobial and anti-inflammatory activities of macrolides are independent and can be separated, which raises development plausibility of novel anti-inflammatory therapeutics.

Antimalarial activity of 9a-N substituted 15-membered azalides with improved in vitro and in vivo activity over azithromycin.

Novel classes of antimalarial drugs are needed due to emerging drug resistance. Azithromycin, the first macrolide investigated for malaria treatment and prophylaxis, failed as a single agent and thus novel analogues were envisaged as the next generation with improved activity. We synthesized 42 new 9a-N substituted 15-membered azalides with amide and amine functionalities via simple and inexpensive chemical procedures using easily available building blocks. These compounds exhibited marked advances over azithromycin in vitro in terms of potency against Plasmodium falciparum (over 100-fold) and high selectivity for the parasite and were characterized by moderate oral bioavailability in vivo. Two amines and one amide derivative showed improved in vivo potency in comparison to azithromycin when tested in a mouse efficacy model. Results obtained for compound 6u, including improved in vitro potency, good pharmacokinetic parameters, and in vivo efficacy higher than azithromycin and comparable to chloroquine, warrant its further development for malaria treatment and prophylaxis.

Synthesis, activity and pharmacokinetics of novel antibacterial 15-membered ring macrolones.

Synthesis, antibacterial activity and pharmacokinetic properties of a novel class of macrolide antibiotics-macrolones-derived from azithromycin, comprising oxygen atom(s) in the linker and either free or esterified quinolone 3-carboxylic group, are reported. Selected compounds showed excellent antibacterial potency towards key erythromycin resistant respiratory pathogens. However, the majority of compounds lacked good bioavailability. The isopropyl ester, compound 35, and a macrolone derivative with an elongated linker 29 showed the best oral bioavailability in rats, both accompanied with an excellent overall microbiology profile addressing inducible and constitutive MLSb as well as efflux mediated macrolide resistance in streptococci, while compound 29 is more potent against staphylococci.

Synthesis, structure-activity relationship, and antimalarial activity of ureas and thioureas of 15-membered azalides.

Azithromycin, a first member of the azalide family of macrolides, while having substantial antimalarial activity, failed as a single agent for malaria prophylaxis. In this paper we present the first analogue campaign to identify more potent compounds from this class. Ureas and thioureas of 15-membered azalides, N''-substituted 9a-(N'-carbamoyl-ß-aminoethyl), 9a-(N'-thiocarbamoyl-ß-aminoethyl), 9a-[N'-(ß-cyanoethyl)-N'-(carbamoyl-ß-aminoethyl)], 9a-[N'-(ß-cyanoethyl)-N'-(thiocarbamoyl-ß-aminoethyl)], 9a-{N'-[ß-(ethoxycarbonyl)ethyl]-N'(carbamoyl-ß-aminoethyl)}, and 9a-[N'-(ß-amidoethyl)-N'-(carbamoyl-ß-aminoethyl)] of 9-deoxo-9-dihydro-9a-aza-9a-homoerythromycin A, were synthesized and their biological properties evaluated. The results obtained indicate a substantial improvement of the in vitro activity against P. falciparum (up to 88 times over azithromycin), particularly for compounds containing both sugars on the macrocyclic ring and aromatic moiety on 9a-position. The improved in vitro activity was not confirmed in the mouse model, likely due to an increase in lipophilicity of these analogues leading to a higher volume of distribution. Overall, with increased in vitro activity, promising PK properties, and modest in vivo efficacy, this series of molecules represents a good starting platform for the design of novel antimalarial azalides.

Association of H-ras polymorphisms and susceptibility to sporadic colon cancer.

High incidence of colon cancer worldwide indicates the importance of studying genetic alterations that lead to its carcinogenesis. Two polymorphisms in H-ras gene, hexanucleotide tandem repeats in the first intron and SNP 81T>C in the first exon, that might be connected with susceptibility to cancer have been described. The aim of our study was to investigate these loci in Croatian population and to determine if any of them is connected with susceptibility to colon cancer in our population. Two hundred healthy volunteers and 200 colon cancer patients were genotyped using PCR and RFLP methods. We noted statistically significant difference in genotype distribution at hexanucleotide locus between healthy population and colon cancer patients (p=0.013) but not in allelic distribution. At SNP 81 T>C statistically significant difference in distribution of both genotypes (p=9.15x10(-6)) and alleles (p=2.77x10(-6)) was found. No differences were found between genders.

Influence of Helicobacter pylori infection persistence on bcl-2 expression in gastric mucosa inflammatory cells.

Chronic Helicobacter (H.) pylori infection is an etiological factor related to gastric adenocarcinoma and gastric mucosa-associated lymphoid tissue (MALT) lymphoma. The expression of bcl-2 protein significantly decreases as the grade of MALT lymphoma advances. The aim of this study was to evaluate bcl-2 expression in inflammatory cells in lamina propria in gastric biopsy samples collected from two groups of patients with chronic gastritis divided on the basis of the success or failure of H. pylori eradication. Sixty-five patients with chronic gastritis were divided into two groups of 45 and 20 patients according to their therapeutic response. The gastric mucosa samples were analyzed histologically in both groups of patients before and after standard therapy (for eradicated, after one therapeutic cycle; and for non-eradicated, after three therapeutic cycles) for H. pylori density, urease activity and bcl-2 expression. In the eradicated group of patients, H. pylori eradication was accompanied by significantly lower grades of bacterial colonization and lower urease activity in the corpus and antrum. Bcl-2 expression in inflammatory cells showed no statistically significant changes in either patient group at either location. There was no between-group difference in bcl-2 expression either. In conclusion, persistent long-lasting H. pylori infection is associated with higher grades of bacterial colonization and higher urease activity but not with bcl-2 expression in inflammatory cells.

Effect of indomethacin on E-cadherin and beta-catenin expression in HT-29 colon cancer cells.

Nonsteroidal anti-inflammatory drugs (NSAIDs) lower the incidence of and mortality from colon cancer. Although there is much evidence from epidemiological and laboratory studies that NSAIDs have antitumor activity and reduce the incidence of colon cancer, the mechanism of action remains unknown. In this paper, we present the effect of indomethacin on growth inhibition, induction of apoptosis, and alterations in the expression of several genes involved in Wnt signaling in HT-29 colon cancer cells. We have shown that indomethacin reduces the proliferation rate of HT-29 colon cancer cells and induces apoptosis. Concentrations of indomethacin from 10(-4) to 10(-3) M strongly inhibited the growth of HT-29 cells. The inhibition of growth, as well as induction of apoptosis was dose and time dependent. The treatment of cells with 4 x 10(-4) M indomethacin caused strong inhibition of cell growth (about 70%), enhanced expression of APC, decreased expression of beta-catenin and induced expression of E-cadherin proteins. Expression of beta-catenin was not markedly reduced instead, beta-catenin was translocated from the nucleus and cytoplasm to the plasma membrane. These results were confirmed by real-time RT-PCR analysis on mRNA level. At a concentration of 4 x 10(-4) M indomethacin there was increased expression of APC gene (10.9-fold induction; DeltaDeltaCt = 3.43) and E-cadherin gene (3.5-fold induction; DeltaDeltaCt = 1.79). These results suggest the antiproliferative effect of indomethacin may contribute to enhanced cell adhesion through increased expression of E-cadherin and translocation of beta-catenin from the nucleus to the cell membrane.

Systemically administered bone morphogenetic protein-6 restores bone in aged ovariectomized rats by increasing bone formation and suppressing bone resorption.

Although recombinant human bone morphogenetic proteins (BMPs) are used locally for treating bone defects in humans, their systemic effect on bone augmentation has not been explored. We have previously demonstrated that demineralized bone (DB) from ovariectomized (OVX) rats cannot induce bone formation when implanted ectopically at the subcutaneous site. Here we showed in vitro that 17beta-estradiol (E2) specifically induced expression of Bmp6 mRNA in MC3T3-E1 preosteoblastic cells and that bone extracts from OVX rats lack BMPs. Next we demonstrated that 125I-BMP-6 administered systemically accumulated in the skeleton and also restored the osteoinductive capacity of ectopically implanted DB from OVX rats. BMP-6 applied systemically to aged OVX rats significantly increased bone volume and mechanical characteristics of both the trabecular and cortical bone, the osteoblast surface, serum osteocalcin and osteoprotegerin levels, and decreased the osteoclast surface, serum C-telopeptide, and interleukin-6. E2 was significantly less effective, and was not synergistic with BMP-6. Animals that discontinued BMP-6 therapy maintained bone mineral density gains for another 12 weeks. BMP-6 increased in vivo the bone expression of Acvr-1, Bmpr1b, Smad5, alkaline phosphatase, and collagen type I and decreased expression of Bmp3 and BMP antagonists, chordin and cerberus. These results show, for the first time, that systemically administered BMP-6 restores the bone inductive capacity, microarchitecture, and quality of the skeleton in osteoporotic rats.

APC gene loss of heterozygosity, mutations, E1317Q, and I1307K germ-line variants in sporadic colon cancer in Croatia.

Colorectal carcinomas are characterized by multiple genetic aberrations that occur during tumorigenesis. Several tumor suppressor genes associated with colorectal carcinoma have been identified: MCC, APC, p53, nm23-H1, DCC, DPC4. We examined 73 cases of sporadic human colon cancer and corresponding normal tissue samples to evaluate the loss of heterozygosity (LOH) at the APC gene loci. The purpose of this study was also to evaluate whether the LOH at the APC gene is associated with clinicopathological characteristics in sporadic colon cancer. We also investigated presence and the frequency of the most common APC gene mutations and APC E1317Q and I1307K germ-line variants in Croatian colorectal cancer patients. Five markers in all patients were found to be heterozygous and informative for LOH analysis. LOH at the APC locus was detected in 30.1% of tumors were examined. The majority of APC gene LOH was observed in Dukes' B (55.6%) and in the moderately differentiated tumors (42.9%). Only 1309 APC gene mutation was detected in our samples. In one tumor sample, a new sporadic mutation of the APC gene in codon 1374 was detected. APC E1317Q and I1307K germ-line variants were not detected in our population. But APC E1317Q sporadic mutation was found in one tumor sample.