The atypical antipsychotic aripiprazole alters the outcome of disseminated Candida albicans infections.

Invasive fungal infections impose an enormous clinical, social, and economic burden on humankind. One of the most common species responsible for invasive fungal infections is Candida albicans. More than 30% of patients with disseminated candidiasis fail therapy with existing antifungal drugs, including the widely used azole class. We previously identified a collection of 13 medications that antagonize the activity of the azoles on C. albicans. Although gain-of-function mutations responsible for antifungal resistance are often associated with reduced fitness and virulence, it is currently unknown how exposure to azole antagonistic drugs impacts C. albicans physiology, fitness, or virulence. In this study, we examined how exposure to seven azole antagonists affects C. albicans phenotype and capacity to cause disease. Most of the azole antagonists appear to have little impact on fungal growth, morphology, stress tolerance, or gene transcription. However, aripiprazole had a modest impact on C. albicans hyphal growth and increased cell wall chitin content. It also aggravated the disseminated C. albicans infections in mice. This effect was abrogated in immunosuppressed mice, indicating that it is at least in part dependent upon host immune responses. Collectively, these data provide proof of principle that unanticipated drug-fungus interactions have the potential to influence the incidence and outcomes of invasive fungal disease.

Unravelling the Molecular Dialogue of Beneficial Microbe-Plant Interactions.

Plants are an intrinsic part of the soil community, which is comprised of a diverse range of organisms that interact in the rhizosphere through continuous molecular communications. The molecular dialogue within the plant microbiome involves a complex repertoire of primary and secondary metabolites that interact within different liquid matrices and biofilms. Communication functions are likely to involve membrane-less organelles formed by liquid-liquid phase separation of proteins and natural deep eutectic solvents that play a role as alternative media to water. We discuss the chemistry of inter-organism communication and signalling within the biosphere that allows plants to discriminate between harmful, benign and beneficial microorganisms. We summarize current information concerning the chemical repertoire that underpins plant-microbe communication and host-range specificity. We highlight how the regulated production, perception and processing of reactive oxygen species (ROS) is used in the communication between plants and microbes and within the communities that shape the soil microbiome.

Early-responsive molecular signatures associated with halophytic adaptation in Sesuvium portulacastrum (L.).

Sesuvium portulacastrum (L.) is a halophyte, adapted to grow naturally under saline environments. The ability to use Na and K interchangeably indicated its facultative halophyte nature. No significant growth reduction occurs in seedlings up to 250 mM NaCl, except for curling of the youngest leaf. Within 8 h of salt treatment, seedlings accumulate proline, glycine betaine and other amino acids in both root and shoot. Despite a continued increase of tissue Na content, the number of differentially expressed genes (DEGs) decreases between 8 and 24 h of salt exposure, indicating transcriptional restoration after the initial osmotic challenge. At 8 h, upregulated genes mainly encode transporters and transcription factors, while genes in growth-related pathways such as photosynthesis and ribosome-associated biogenesis are suppressed. Overexpression of SpRAB18 (an ABA-responsive dehydrin), one of the most strongly induced DEGs, in soybean was found to increase biomass in control conditions and the growth benefit was maintained when plants were grown in 100 mM NaCl, indicating conservation of function in halophyte and glycophyte. An open-access transcriptome database "SesuviumKB" (https://cb.imsc.res.in/sesuviumkb/) was developed to involve the scientific community in wide-scale functional studies of S. portulacastrum genes, that could pave the way to engineer salt tolerance in crops.

Ascorbic acid: a metabolite switch for designing stress-smart crops.

Plant growth and productivity are continually being challenged by a diverse array of abiotic stresses, including: water scarcity, extreme temperatures, heavy metal exposure, and soil salinity. A common theme in these stresses is the overproduction of reactive oxygen species (ROS), which disrupts cellular redox homeostasis causing oxidative damage. Ascorbic acid (AsA), commonly known as vitamin C, is an essential nutrient for humans, and also plays a crucial role in the plant kingdom. AsA is synthesized by plants through the d-mannose/l-galactose pathway that functions as a powerful antioxidant and protects plant cells from ROS generated during photosynthesis. AsA controls several key physiological processes, including: photosynthesis, respiration, and carbohydrate metabolism, either by acting as a co-factor for metabolic enzymes or by regulating cellular redox-status. AsA's multi-functionality uniquely positions it to integrate and recalibrate redox-responsive transcriptional/metabolic circuits and essential biological processes, in accordance to developmental and environmental cues. In recognition of this, we present a systematic overview of current evidence highlighting AsA as a central metabolite-switch in plants. Further, a comprehensive overview of genetic manipulation of genes involved in AsA metabolism has been provided along with the bottlenecks and future research directions, that could serve as a framework for designing "stress-smart" crops in future.

Design, classification, and adverse effects of NSAIDs: A review on recent advancements.

Inflammation is a hallmark of many diseases, including cancer, neurodegenerative diseases like Alzheimer's, type II diabetes, rheumatoid arthritis, and asthma. Nonsteroidal anti-inflammatory drugs (NSAIDs) have been a cornerstone in the management of various inflammatory, pain, and fever-related conditions. As a result, NSAIDs have found their applications in new therapeutic areas. NSAIDs are known to act by inhibiting the cyclooxygenase (COX) pathway. In recent years, new strategies have been proposed to counter inflammation and develop safer COX inhibitors. This review discusses the design of new COX inhibitors, the derivatization of conventional NSAIDs, and their biological applications. The review also presents an integrated classification of NSAIDs incorporating both traditional chemical-based and function-based approaches, including a brief overview of the NSAIDs of natural origins. Additionally, the review addresses adverse effects associated with different NSAIDs, including effects associated with cardiovascular, renal, and hepatic complications emphasizing the need for the development of new and safer COX inhibitors.

Candidaemia and Central Line-Associated Candidaemia in a Network of Indian ICUs: Impact of COVID-19 Pandemic.

BACKGROUND AND OBJECTIVES: Candidaemia is a potentially life-threatening emergency in the intensive care units (ICUs). Surveillance using common protocols in a large network of hospitals would give meaningful estimates of the burden of candidaemia and central line associated candidaemia in low resource settings. We undertook this study to understand the burden and epidemiology of candidaemia in multiple ICUs of India, leveraging the previously established healthcare-associated infections (HAI) surveillance network. Our aim was also to assess the impact that the pandemic of COVID-19 had on the rates and associated mortality of candidaemia. METHODS: This study included adult patients from 67 Indian ICUs in the AIIMS-HAI surveillance network that conducted BSI surveillance in COVID-19 and non-COVID-19 ICUs during and before the COVID-19 pandemic periods. Hospitals identified healthcare-associated candidaemia and central line associated candidaemia and reported clinical and microbiological data to the network as per established and previously published protocols. RESULTS: A total of 401,601 patient days and 126,051 central line days were reported during the study period. A total of 377 events of candidaemia were recorded. The overall rate of candidaemia in our network was 0.93/1000 patient days. The rate of candidaemia in COVID-19 ICUs (2.52/1000 patient days) was significantly higher than in non-COVID-19 ICUs (1.05/patient days) during the pandemic period. The rate of central line associated candidaemia in COVID-19 ICUs (4.53/1000 central line days) was also significantly higher than in non-COVID-19 ICUs (1.73/1000 central line days) during the pandemic period. Mortality in COVID-19 ICUs associated with candidaemia (61%) was higher than that in non-COVID-19 ICUs (41%). A total of 435 Candida spp. were isolated. C. tropicalis (26.7%) was the most common species. C. auris accounted for 17.5% of all isolates and had a high mortality. CONCLUSION: Patients in ICUs with COVID-19 infections have a much higher risk of candidaemia, CLAC and its associated mortality. Network level data helps in understanding the true burden of candidaemia and will help in framing infection control policies for the country.

First Report of Melon Severe Mosaic Orthotospovirus infecting cucurbits in the United States.

Cucurbits (family Cucurbitaceae) includes globally important fruit and vegetable crops. Virus diseases pose a serious threat to cucurbits, limiting crop quality and yield (Regina et al. 2021). In fall 2023, leaf and fruit samples from two squash plants with chlorotic mosaic symptoms and fruit distortion from Monroe and Pope counties in Arkansas were received for diagnosis at the University of Arkansas Division of Agriculture Plant Clinic. Based on symptoms, samples were assessed for melon severe mosaic orthotospovirus (MeSMV) using the ImmunoStrip® developed for detection of the virus (Agdia® Inc., Elkhart, Indiana). The presence of MeSMV was also confirmed by RT-PCR using the Agdia Tospovirus group PCR primers. An amplicon was sequenced and showed 91% sequence identity to the MESMV type isolate (NC_033834, VE440-A). To further verify the results, nucleic acids from a squash sample from Pope County were extracted as described by Poudel et al. (2013), DNase treated, and sequenced on an Oxford Nanopore MinION as described by Liefting et al. (2021). A total of 25,914 raw reads were analyzed using VirFind (Ho and Tzanetakis 2014), which identified 112 reads mapping to the three segments of MeSMV. Primers for all three RNAs were developed and amplified 638, 650, and 1153 nt of the S, M, and L segments of the virus respectively. The amplicons were sequenced bidirectionally and show 89-93% identity to the type isolate from Mexico (GenBank accessions PP301332-4). MeSMV has only been identified in Mexico and can cause significant losses to honeydew melon, zucchini, and cucumber (Ciuffo et al. 2009). Thus, this is the first report of MeSMV outside Mexico. Given the severity of the symptoms observed in cucurbit crops, the virus poses a potential threat to the cucurbit industry in the United States. Growers should be aware of this virus and take the necessary precautions to prevent its spread in the field.

Circulating serotypes and genotypes of dengue virus in North India: An observational study.

BACKGROUND OBJECTIVES: This study reports observation on circulating serotypes and genotypes of Dengue Virus in North India. METHODS: Serum samples were obtained from suspected cases of dengue referred to the virus diagnostic laboratory during 2014 to 2022. All samples were tested for anti-dengue virus IgM antibodies and NS1Ag by ELISA. NS1Ag positive samples were processed for serotyping and genotyping. RESULTS: Total 41,476 dengue suspected cases were referred to the laboratory of which 12,292 (29.6%) tested positive. Anti-Dengue Virus IgM antibodies, NS1Ag, both IgM and NS1Ag, were positive in 7007 (57.4%); 3200 (26.0%) and 2085 (16.0%) cases respectively. Total 762 strains were serotyped during 9-year period. DENV-1, DENV-2, DENV-3 and DENV-4 serotypes were found in 79 (10.37%), 506 (66.40%), 151 (19.82%) and 26 (3.41%) cases respectively. DENV-1, DENV-2 and DENV-3 were in circulation throughout. Total 105 strains were genotyped. Genotype IV of DENV-1 serotype was circulating till 2014 which was later replaced by genotype V. A distinct seasonality with increase in number of cases in post-monsoon period was seen. INTERPRETATION CONCLUSION: DENV-1, DENV-2 and DENV-3 were found to be in circulation in North India. Predominant serotype/genotype changed at times, but not at regular intervals.

Novel protocol for fouling detection of reverse osmosis membrane based on methylene blue colorimetric method by image processing technique.

In the current study, a novel methylene blue (MB)-based colorimetric method for a quick, inexpensive, and facile approach for the determination of fouling intensity of reverse osmosis (RO) membrane has been reported. This technique is based on the interaction of MB with the organic foulants and shows the corresponding change in the colour intensity depending on the severity of fouling. The organic foulants, such as albumin, sodium alginate, and carboxymethyl cellulose (CMC), were chosen as model foulants, and the membranes were subjected to foul under extreme fouling conditions. The fouled membranes underwent an MB treatment followed by image-processing analyses. The severity of surface fouling of membranes was evaluated in terms of fouling intensity and correlated with the corresponding decline of permeate flux. The maximum fouling intensity of the albumin, sodium alginate, and CMC sodium were found to be 8.83, 23.38, and 9.19%, respectively, for the definite concentration of foulants. The physico-chemical interactions of the given foulants and MB were confirmed by changes in zeta potentials and increased sizes of the foulant by the dynamic light scattering technique. The surface fouling over the membrane surface was confirmed by the characterization of membranes.

CIPK9 targets VDAC3 and modulates oxidative stress responses in Arabidopsis.

Calcium (Ca2+ ) is widely recognized as a key second messenger in mediating various plant adaptive responses. Here we show that calcineurin B-like interacting protein kinase CIPK9 along with its interacting partner VDAC3 identified in the present study are involved in mediating plant responses to methyl viologen (MV). CIPK9 physically interacts with and phosphorylates VDAC3. Co-localization, co-immunoprecipitation, and fluorescence resonance energy transfer experiments proved their physical interaction in planta. Both cipk9 and vdac3 mutants exhibited a tolerant phenotype against MV-induced oxidative stress, which coincided with the lower-level accumulation of reactive oxygen species in their roots. In addition, the analysis of cipk9vdac3 double mutant and VDAC3 overexpressing plants revealed that CIPK9 and VDAC3 were involved in the same pathway for inducing MV-dependent oxidative stress. The response to MV was suppressed by the addition of lanthanum chloride, a non-specific Ca2+ channel blocker indicating the role of Ca2+ in this pathway. Our study suggest that CIPK9-VDAC3 module may act as a key component in mediating oxidative stress responses in Arabidopsis.

"Mitochondrial pathogenic mutations and metabolic alterations associated with COVID-19 disease severity".

The severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) caused global pandemic and drastically affected the humankind. Mitochondrial mutations have been found to be associated with several respiratory diseases. Missense mutation and pathogenic mitochondrial variants might unveil the potential involvement of the mitochondrial genome in coronavirus disease 2019 (COVID-19) pathogenesis. The present study aims to elucidate the role of mitochondrial DNA (mtDNA) mutations, mitochondrial haplogroup, and energy metabolism in disease severity. The study was performed on 58 subjects comprising COVID-19-positive (n = 42) and negative (n = 16) individuals. COVID-19-positive subjects were further categorized into severe deceased (SD), severe recovered (SR), moderate (Mo), and mild (Mi) patients, while COVID-19-negative subjects were healthy control (HC) for the study. High throughput next-generation sequencing was done to investigate mtDNA mutations and haplogroups. The computational approach was applied to study the effect of mtDNA mutations on protein secondary structure. Real time polymerase chain reaction was used for mtDNA copy number determination and mitochondrial function parameters were also analyzed. We found 15 mtDNA mutations in MT-ND5, MT-ND4, MT-ND2, and MT-COI genes uniquely associated with COVID-19 severity affecting the secondary structure of proteins in COVID-19-positive subjects. Haplogroup analysis suggests that mtDNA haplogroups M3d1a and W3a1b might be potentially associated with COVID-19 pathophysiology. The mitochondrial function parameters were significantly altered in severe patients (SD and SR; p < 0.05). No significant relationship was found between mtDNA mutations and oxidative stress markers (p > 0.05). The study highlights the importance of mitochondrial reprogramming in COVID-19 patients and may provide a feasible approach toward finding a path for therapeutic interventions to COVID-19 disease.

Profiling of conserved orthologs and miRNAs for understanding their role in salt tolerance mechanism of Sesuvium portulacastrum L.

BACKGROUND: Sesuvium portulacastrum is a facultative halophyte capable of thriving in a saline environment. Despite molecular studies conducted to unravel its salt adaptation mechanism, there is a paucity of information on the role of salt-responsive orthologs and microRNAs (miRNAs) in this halophyte. Here, we searched the orthology to identify salt-responsive orthologs and miRNA targets of Sesuvium using the Arabidopsis genome. METHODS: The relative fold change of orthologs, conserved miRNAs, and miRNA targets of Sesuvium was analyzed under 100 mM (LS) and 250 mM NaCl (HS) treatment at 24 h using qRT-PCR. The comparison between the expression of Sesuvium orthologs and Arabidopsis orthologs (Arabidopsis eFP browser database) was used to identify differentially expressed genes. RESULTS: Upon salt treatment, we found that SpCIPK3 (1.95-fold in LS and 2.90-fold in HS) in Sesuvium roots, and SpNHX7 (1.61-fold in LS and 6.39-fold in HS) and, SpSTPK2 (2.54-fold in LS and 7.65-fold in HS) in Sesuvium leaves were upregulated in a salt concentration-specific manner. In Arabidopsis, these genes were either downregulated or did not show significant variation, implicating its significance in the halophytic nature of Sesuvium. Furthermore, miRNAs like miR394a, miR396a, and miR397a exhibited a negative correlation with their targets-Frigida interacting protein 1, Cysteine proteinases superfamily protein, and Putative laccase, respectively under different salt treatments. CONCLUSION: The study revealed that the high salt tolerance in Sesuvium is associated with distinct transcriptional reprogramming, hence, to gain holistic mechanistic insights, global-scale profiling is required.

Implementing a quality improvement initiative for private healthcare facilities to achieve accreditation: experience from India.

BACKGROUND: The Manyata program is a quality improvement initiative for private healthcare facilities in India which provided maternity care services. Under this initiative, technical assistance was provided to selected facilities in the states of Uttar Pradesh, Jharkhand and Maharashtra which were interested in obtaining 'entry level certification' under the National Accreditation Board for Hospitals and Healthcare Providers (NABH) for provision of quality services. This paper describes the change in quality at those Manyata-supported facilities when assessed by the NABH standards of care. METHODS: Twenty-eight private-sector facilities underwent NABH assessments in the three states from August 2017 to February 2019. Baseline assessment (by program staff) and NABH assessment (by NABH assessors) findings were compared to assess the change in quality of care as per NABH standards of care. The reported performance gaps from NABH assessments were then also classified by thematic areas and suggested corrective actions based on program implementation experience. RESULTS: The overall adherence to NABH standards of care improved from 9% in the baseline assessment to 80% in the NABH assessment. A total of 831 performance gaps were identified by the NABH assessments, of which documentation issues accounted for a majority (70%), followed by training (19%). Most performance gaps could be corrected either by revising existing documentation or creating new documentation (62%), or by orienting facility staff on various protocols (35%). CONCLUSION: While the adherence of facilities to the NABH standards of care improved considerably, certain performance gaps remained, which were primarily related to documentation of facility policies and protocols and training of staff, and required corrective actions for the facilities to achieve NABH entry level certification.

First report of constricta yellow dwarf virus infecting Lobelia in the United States and the world.

Blue cardinal (Lobelia siphilitica L., family: Campanulaceae) is a popular perennial ornamental plant. Lobelia spp. have been reported as hosts of economically important viruses including cucumber mosaic virus (Nameth and Fisher, 2001), turnip mosaic virus (Lockhart et al., 2002), and tomato spotted wilt virus (Brown, 1988). During fall 2022, in a garden in Fayetteville, Arkansas, USA, yellow speckling, chlorosis, and dwarfing were observed on several cardinal plants. Three symptomatic plants were sampled, and RNA was isolated as described in Poudel et al. (2013) and pooled. Material was sequenced using the MinION platform as described by Liefting et al. (2021). A total of 56,700 raw reads (mean-length 326) were analyzed using VirFind (Ho and Tzanetakis, 2014) revealing 23 contigs ranging from 209-12,776 nucleotides (nt) which showed 96.2-98.4% identity with constricta yellow dwarf virus (CYDV; genus Alphanucleorhabdovirus, KY549567) and 16 contigs ranging from 201-531 nt with 83.4-95.7% identity with hydrangea chlorotic mottle virus (HdCMV; genus Carlavirus, EU754720). A total of 6,387 reads were mapped to the CYDV genome (KY549567) with 181x average coverage per nucleotide, and the consensus sequence of 12773 nt shared 98.1% identity to KY549567. The results were verified by RT-PCR and sequencing of the amplicons using primers 8825F: 5'-ACCCTGAGACAGGCATTGTG-3' and L2 9760: 5'-GCCGTACTATGAGAAGGGGC-3' for CYDV and 6495F: 5'-CAAGTACGTCTGTGTGAGGT-3' and 6630R 5'-CTTTTTGATAGTGTCATTGCTACC-3' for HdCMV. RNA was subsequently extracted from eight symptomatic and 12 symptomless samples. All symptomatic samples tested positive for CYDV but none of the 20 was positive for HdCMV indicating that CYDV is possibly the causal agent of the observed symptoms. Amplicons were CYDV specific and showed 91-98% nt identity (99-100% amino acid identity) (accession No. OP998261-63) with the CYDV isolate from Solanum tuberosum (KY549567). To the best of our knowledge, this is the first report of CYDV infecting L. cardinalis in the USA and the world. CYDV has been reported as an important pathogen of potato in the USA and recent reports indicate that emergence and re-emergence of rhabdoviruses on new hosts worldwide may threaten agricultural production (Bejerman et. al., 2021). Given the lack of monitoring of cardinal plants for viruses, this could serve as a reservoir of CYDV for several vegetables and ornamental crops (Jang et al., 2017).

A Novel, Divergent Member of the Rhabdoviridae Family Infects Strawberry.

Strawberry (Fragaria × ananassa) is the most important berry crop worldwide and viruses pose a constant threat to the industry. In this communication, we describe a novel virus in the family Rhabdoviridae referred to as strawberry virus 3 (StrV-3). The virus does not show significant homology when compared with recognized rhabdoviruses and, therefore, the establishment of a new genus should be considered. A triplex reverse-transcription PCR test was developed and successfully employed in a survey of the National Clonal Germplasm Repository Fragaria collection. A CRISPR-Cas-based protocol was also developed and shown to detect the virus in as little as 1 fg of total RNA, a protocol to be used in the detection of the virus in candidate G1 plants. The strawberry aphid (Chaetosiphon fragaefolii) was evaluated-alas, unsuccessfully-as a potential vector of the virus. This work broadens our understanding of the family Rhabdoviridae and assists in the quest of releasing plant material free of viruses.

Inhaled Adjunct Therapy with Second-Line Drug Candidates for Dose Reduction in Chemotherapeutic Regimens for Multi-drug-Resistant Tuberculosis.

Chemotherapy of multi-drug-resistant tuberculosis (TB) requires prolonged administration of multiple drugs. We investigated whether pulmonary delivery of minute doses of drugs, along with reduced oral doses of the same agents, would affect preclinical efficacy. We prepared dry powder inhalation (DPI) formulations comprising sutezolid (SUT), the second-generation pretomanid analog TBA-354 (TBA), or a fluorinated derivative of TBA-354 (32,625) in a matrix of the biodegradable polymer poly(L-lactide). We established formulation characteristics, doses inhaled by healthy mice, and preclinical efficacy in a mouse model of TB. Oral doses of 100 mg/kg/day or DPI doses of 0.25-0.5 mg/kg/day of drugs SUT, TBA-354, or 32,625 administered over 28 days were sub-optimally effective in reducing lung and spleen burden of Mycobacterium tuberculosis (Mtb) in infected mice. The addition of 0.25-0.5 mg/kg/day of SUT, TBA-354, or 32,625 as DPI to oral doses of 50 mg/kg/day was non-inferior in clearing Mtb from the lungs of infected mice. We concluded that adjunct therapy with inhaled second-line agents has the potential to reduce the efficacious oral dose.

Implementation of a large-scale breast cancer early detection program in a resource-constrained setting: real-world experiences from 2 large states in India.

BACKGROUND: The Breast Health Initiative (BHI) was launched to demonstrate a scalable model to improve access to early diagnosis and treatment of breast cancer. METHODS: A package of evidence-based interventions was codesigned and implemented with the stakeholders, as part of the national noncommunicable disease program, through the existing primary health care system. Data from the first 18 months of the BHI are presented. RESULTS: A total of 108,112 women received breast health education; 48% visited the health facilities for clinical breast examination (CBE), 3% had a positive CBE result, and 41% were referred to a diagnostic facility. The concordance of CBE findings between health care providers and adherence to follow-up care improved considerably, with more women visiting the diagnostic facilities and completing diagnostic evaluation within 1 month from initial screening, and with only 9% lost to follow-up. The authors observed a clinically meaningful decrease in time to complete diagnostic evaluation with biopsy, from 37 to 9 days. CONCLUSIONS: The results demonstrate the feasibility and effectiveness of implementing a large-scale, decentralized breast cancer early detection program delivered through the existing primary health care system in India.

Development of robust, indigenous ELISA for detection of IgG antibodies against CoV-2 N and S proteins: mass screening.

The severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) pandemic has adversely affected humankind and caused millions of deaths globally since January 2020. Robust and quick serological tests such as antibody detection assays for SARS-CoV-2 provide relevant information and aid in the process of vaccine development and diagnostics, as well as in sero-epidemiological monitoring of antibody response to the virus. The receptor-binding domain (RBD) of spike and nucleocapsid protein are specific targets for detecting SARS-CoV-2 antibodies. Here, we present the development of a stable spike (S) and nucleocapsid (N) protein-based ELISA antibody detection test "CoroSuchak," with 99% sensitivity, 98% specificity, cost-effective, and detection in a minimum time for serodiagnosis and mass screening of the population for antibodies against SARS-CoV-2. Blood samples were analyzed from 374 SARS-CoV-2 reverse transcription-polymerase chain reaction (RT-PCR) positive, 772 negative and asymptomatic, and 874 random groups of subjects. We found that the antibody titer was significantly higher (p < 0.0001) in infected and vaccinated group compared to the only vaccinated and only infected group. Using enzyme-linked immunosorbent assay (ELISA), we detected SARS-CoV-2 immunoglobulin G (IgG) antibodies in 118/123 (96%) infected individuals, 570/653 (87%) non-infected but vaccinated individuals, 231/237 (97%) individuals who were both infected and vaccinated, and 499/874 (57%) from randomly selected individuals from the first and second waves of the pandemic. Similarly in the third wave, 14/14 (100%) infected and 16/20 (80%) RT-PCR-negative but symptomatic subjects were detected. Thus, the highly sensitive and specific in-house developed ELISA antibody detection kit "CoroSuchak" is extremely useful to determine the seroprevalence of SARS-CoV-2 antibodies in the coronavirus-exposed population. KEY POINTS: •Indigenous kit using a combination of spike and nucleocapsid proteins and peptide sequences. •High sensitivity and specificity to detect variants. •Highly sensitive for mass screening.

Improving quality of intrapartum and immediate postpartum care in public facilities: experiences and lessons learned from Rajasthan state, India.

BACKGROUND: In spite of considerable improvement in maternal and neonatal outcomes over the past decade in India, the current maternal mortality ratio and neonatal mortality rate are far from the Sustainable Development Goal targets due to suboptimal quality of maternity care. A package of interventions for improving quality of intrapartum and immediate postpartum care was co-designed with the Ministry of Health as the Dakshata program and implemented in public sector health facilities in selected districts in the state of Rajasthan of India since June 2015. This article describes the key strategies, interventions, results and challenges from four years of Dakshata program implementation. METHODS: We have conducted secondary analysis of program data (government data) collected from 202 public facilities across 20 districts of Rajasthan state. The data collected between June-August 2015 (baseline) and the data collected between May-August 2019 (latest) were analyzed. The data sources included: facility assessments, service statistics, monthly progress reports. RESULTS: During the period of program implementation, there were 17,94,249 deliveries accounting for 70% of institutional deliveries in intervention districts. As a result of the intervention, there was a notable increase in competency of health care providers, availability of essential resources, achievement of labour room standards and adherence to evidence-based clinical standards. We also observed reductions in the proportion of referrals for pre-eclampsia/eclampsia, postpartum hemorrhage and neonatal asphyxia by 11, 8 and 3 percentage points respectively. Similarly, data revealed a reduction in stillbirth rates in Dakshata intervention facilities (19.3 vs 15.3) compared to non-Dakshata facilities (21.8 vs 18). CONCLUSIONS: Our experience and findings indicate that the quality of intrapartum and immediate postpartum care can be improved in low- and middle-income countries with the approach presented in this paper.

First report of Tobacco rattle virus infecting Brassica oleracea var. botrytis (cauliflower) in India.

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.