First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay.

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

Incursions of divergent genotypes, evolution of virulence and host jumps shape a continental clonal population of the stripe rust pathogen Puccinia striiformis.

Long-distance migration and host adaptation by transboundary plant pathogens often brings detrimental effects to important agroecosystems. Efficient surveillance as a basis for responding to the dynamics of such pathogens is often hampered by a lack of information on incursion origin, evolutionary pathways and the genetic basis of rapidly evolving virulence across larger timescales. Here, we studied these genetic features by using historical isolates of the obligate biotrophic pathogen Puccinia striiformis f. sp. tritici (Pst), which causes one of the most widespread and devastating diseases, stripe (yellow) rust, of wheat. Through a combination of genotypic, phenotypic and genomic analyses, we assigned eight Pst isolates representing putative exotic Pst incursions into Australia to four previously defined genetic groups, PstS0, PstS1, PstS10 and PstS13. We showed that isolates of an additional incursion of P. striiformis, known locally as P. striiformis f. sp. pseudo-hordei, had a new and unique multilocus SSR genotype (MLG). We provide results of overall genomic variation of representative Pst isolates from each genetic group by comparative genomic analyses. We showed that isolates within the PstS1 and PstS13 genetic groups are most distinct at the whole-genome variant level from isolates belonging to genetic group PstS0, whereas the isolate from the PstS10 genetic group is intermediate. We further explored variable gene content, including putative effectors, representing both shared but also unique genetic changes that have occurred following introduction, some of which may additionally account for local adaptation of these isolates to triticale. Our genotypic and genomic data revealed new genetic insights into the evolution of diverse phenotypes of rust pathogens following incursion into a geographically isolated continental region.

MARPLE, a point-of-care, strain-level disease diagnostics and surveillance tool for complex fungal pathogens.

BACKGROUND: Effective disease management depends on timely and accurate diagnosis to guide control measures. The capacity to distinguish between individuals in a pathogen population with specific properties such as fungicide resistance, toxin production and virulence profiles is often essential to inform disease management approaches. The genomics revolution has led to technologies that can rapidly produce high-resolution genotypic information to define individual variants of a pathogen species. However, their application to complex fungal pathogens has remained limited due to the frequent inability to culture these pathogens in the absence of their host and their large genome sizes. RESULTS: Here, we describe the development of Mobile And Real-time PLant disEase (MARPLE) diagnostics, a portable, genomics-based, point-of-care approach specifically tailored to identify individual strains of complex fungal plant pathogens. We used targeted sequencing to overcome limitations associated with the size of fungal genomes and their often obligately biotrophic nature. Focusing on the wheat yellow rust pathogen, Puccinia striiformis f.sp. tritici (Pst), we demonstrate that our approach can be used to rapidly define individual strains, assign strains to distinct genetic lineages that have been shown to correlate tightly with their virulence profiles and monitor genes of importance. CONCLUSIONS: MARPLE diagnostics enables rapid identification of individual pathogen strains and has the potential to monitor those with specific properties such as fungicide resistance directly from field-collected infected plant tissue in situ. Generating results within 48 h of field sampling, this new strategy has far-reaching implications for tracking plant health threats.

Evaluation of Spray and Point Inoculation Methods for the Phenotyping of Puccinia striiformis on Wheat.

The fungus Puccinia striiformis causes yellow (stripe) rust on wheat worldwide. In the present article, new methods utilizing an engineered fluid (Novec 7100) as a carrier of urediniospores were compared with commonly used inoculation methods. In general, Novec 7100 facilitated a faster and more flexible application procedure for spray inoculation and it gave highly reproducible results for virulence phenotyping. Six point inoculation methods were compared to find the most suitable for assessment of pathogen aggressiveness. The use of Novec 7100 and dry dilution with Lycopodium spores gave an inoculation success rate of 100% in two independent trials, which was significantly higher and more consistent than for spore suspension in Soltrol 170, water, water + Tween 20, and Noble agar + Tween 20. Both Soltrol 170 and Novec 7100 allowed precise quantification of inoculum, which is important for the assessment of quantitative epidemiological parameters. New protocols for spray and point inoculation of P. striiformis on wheat are presented, along with the prospect for applying these in rust research and resistance breeding activities.

Scald resistance in hybrid rye (Secale cereale): genomic prediction and GWAS.

Rye (Secale cereale L.) is an important cereal crop used for food, beverages, and feed, especially in North-Eastern Europe. While rye is generally more tolerant to biotic and abiotic stresses than other cereals, it still can be infected by several diseases, including scald caused by Rhynchosporium secalis. The aims of this study were to investigate the genetic architecture of scald resistance, to identify genetic markers associated with scald resistance, which could be used in breeding of hybrid rye and to develop a model for genomic prediction for scald resistance. Four datasets with records of scald resistance on a population of 251 hybrid winter rye lines grown in 2 years and at 3 locations were used for this study. Four genomic models were used to obtain variance components and heritabilities of scald resistance. All genomic models included additive genetic effects of the parental components of the hybrids and three of the models included additive-by-additive epistasis and/or dominance effects. All models showed moderate to high broad sense heritabilities in the range of 0.31 (SE 0.05) to 0.76 (0.02). The model without non-additive genetic effects and the model with dominance effects had moderate narrow sense heritabilities ranging from 0.24 (0.06) to 0.55 (0.08). None of the models detected significant non-additive genomic variances, likely due to a limited data size. A genome wide association study was conducted to identify markers associated with scald resistance in hybrid winter rye. In three datasets, the study identified a total of twelve markers as being significantly associated with scald resistance. Only one marker was associated with a major quantitative trait locus (QTL) influencing scald resistance. This marker explained 11-12% of the phenotypic variance in two locations. Evidence of genotype-by-environment interactions was found for scald resistance between one location and the other two locations, which suggested that scald resistance was influenced by different QTLs in different environments. Based on the results of the genomic prediction models and GWAS, scald resistance seems to be a quantitative trait controlled by many minor QTL and one major QTL, and to be influenced by genotype-by-environment interactions.

Global dispersal and diversity of rust fungi in the context of plant health.

Long-distance dispersal of plant pathogens at the continental scale may have strong implications on plant health, in particular when incursions result in spread of disease to new territories where the disease was previously absent or insignificant. These dispersions may be caused by airborne transmission of spores or accidental spread via human travel and trade. Recent surveillance efforts of cereal rust fungi have demonstrated that incursion of new strains with superior fitness into areas where the disease is already established may have similar implications on plant health. Since dispersal events are highly stochastic, irrespective of transmission mechanism, critical mitigation efforts include preparedness by coordinated pathogen surveillance activities, host crop diversification, and breeding for disease resistance with low vulnerability to sudden changes in the pathogen population.

Wheat Stem Rust Back in Europe: Diversity, Prevalence and Impact on Host Resistance.

The objective of this study was to investigate the re-emergence of a previously important crop pathogen in Europe, Puccinia graminis f.sp. tritici, causing wheat stem rust. The pathogen has been insignificant in Europe for more than 60 years, but since 2016 it has caused epidemics on both durum wheat and bread wheat in local areas in southern Europe, and additional outbreaks in Central- and West Europe. The prevalence of three distinct genotypes/races in many areas, Clade III-B (TTRTF), Clade IV-B (TKTTF) and Clade IV-F (TKKTF), suggested clonal reproduction and evolution by mutation within these. None of these genetic groups and races, which likely originated from exotic incursions, were detected in Europe prior to 2016. A fourth genetic group, Clade VIII, detected in Germany (2013), was observed in several years in Central- and East Europe. Tests of representative European wheat varieties with prevalent races revealed high level of susceptibility. In contrast, high diversity with respect to virulence and Simple Sequence Repeat (SSR) markers were detected in local populations on cereals and grasses in proximity to Berberis species in Spain and Sweden, indicating that the alternate host may return as functional component of the epidemiology of wheat stem rust in Europe. A geographically distant population from Omsk and Novosibirsk in western Siberia (Russia) also revealed high genetic diversity, but clearly different from current European populations. The presence of Sr31-virulence in multiple and highly diverse races in local populations in Spain and Siberia stress that virulence may emerge independently when large geographical areas and time spans are considered and that Sr31-virulence is not unique to Ug99. All isolates of the Spanish populations, collected from wheat, rye and grass species, were succesfully recovered on wheat, which underline the plasticity of host barriers within P. graminis. The study demonstrated successful alignment of two genotyping approaches and race phenotyping methodologies employed by different laboratories, which also allowed us to line up with previous European and international studies of wheat stem rust. Our results suggest new initiatives within disease surveillance, epidemiological research and resistance breeding to meet current and future challenges by wheat stem rust in Europe and beyond.

Multi-Parental Populations Suitable for Identifying Sources of Resistance to Powdery Mildew in Winter Wheat.

Wheat (Triticum aestivum L.) is one of the world's staple food crops and one of the most devastating foliar diseases attacking wheat is powdery mildew (PM). In Denmark only a few specific fungicides are available for controlling PM and the use of resistant cultivars is often recommended. In this study, two Chinese wheat landraces and two synthetic hexaploid wheat lines were used as donors for creating four multi-parental populations with a total of 717 individual lines to identify new PM resistance genetic variants. These lines and the nine parental lines (including the elite cultivars used to create the populations) were genotyped using a 20 K Illumina SNP chip, which resulted in 8,902 segregating single nucleotide polymorphisms for assessment of the population structure and whole genome association study. The largest genetic difference among the lines was between the donors and the elite cultivars, the second largest genetic difference was between the different donors; a difference that was also reflected in differences between the four multi-parental populations. The 726 lines were phenotyped for PM resistance in 2017 and 2018. A high PM disease pressure was observed in both seasons, with severities ranging from 0 to >50%. Whole genome association studies for genetic variation in PM resistance in the populations revealed significant markers mapped to either chromosome 2A, B, or D in each of the four populations. However, linkage disequilibrium between these putative quantitative trait loci (QTL) were all above 0.80, probably representing a single QTL. A combined analysis of all the populations confirmed this result and the most associated marker explained 42% of the variation in PM resistance. This study gives both knowledge about the resistance as well as molecular tools and plant material that can be utilised in marker-assisted selection. Additionally, the four populations produced in this study are highly suitable for association studies of other traits than PM resistance.

Assessment of Aggressiveness of Puccinia striiformis on Wheat.

A simple point-inoculation method using Novec™ 7100, a volatile engineered fluid, is presented for the assessment of aggressiveness of Puccinia striiformis isolates on seedlings of wheat. The method allows for quantification of the applied inoculum with a minimal risk of cross-contamination of rust from leaves grown side by side. The method is also applicable for the assessment of qualitative differences inferred by compatible and incompatible host-pathogen interactions, and it can be adjusted to other cereal rust and powdery mildew fungi on other host species, and other plant growth stages as appropriate.

Race Typing of Puccinia striiformis on Wheat.

A procedure for virulence phenotyping of isolates of yellow (stripe) rust using spray inoculation of wheat seedlings by spores suspended in an engineered fluid, Novec™ 7100, is presented. Differential sets consisting of near-isogenic Avocet lines, selected lines from the "World" and "European" sets, and additional varieties showing race-specificity facilitate a robust assessment of race, irrespectively of geographical and evolutionary origin of isolates. A simple procedure for purification of samples consisting of multiple races is also presented.

Yellow Rust Epidemics Worldwide Were Caused by Pathogen Races from Divergent Genetic Lineages.

We investigated whether the recent worldwide epidemics of wheat yellow rust were driven by races of few clonal lineage(s) or populations of divergent races. Race phenotyping of 887 genetically diverse Puccinia striiformis isolates sampled in 35 countries during 2009-2015 revealed that these epidemics were often driven by races from few but highly divergent genetic lineages. PstS1 was predominant in North America; PstS2 in West Asia and North Africa; and both PstS1 and PstS2 in East Africa. PstS4 was prevalent in Northern Europe on triticale; PstS5 and PstS9 were prevalent in Central Asia; whereas PstS6 was prevalent in epidemics in East Africa. PstS7, PstS8 and PstS10 represented three genetic lineages prevalent in Europe. Races from other lineages were in low frequencies. Virulence to Yr9 and Yr27 was common in epidemics in Africa and Asia, while virulence to Yr17 and Yr32 were prevalent in Europe, corresponding to widely deployed resistance genes. The highest diversity was observed in South Asian populations, where frequent recombination has been reported, and no particular race was predominant in this area. The results are discussed in light of the role of invasions in shaping pathogen population across geographical regions. The results emphasized the lack of predictability of emergence of new races with high epidemic potential, which stresses the need for additional investments in population biology and surveillance activities of pathogens on global food crops, and assessments of disease vulnerability of host varieties prior to their deployment at larger scales.