Infantile onset Sandhoff disease: clinical manifestation and a novel common mutation in Thai patients.

BACKGROUND: Sandhoff disease (SD) is an autosomal recessive lysosomal storage disorder, resulting in accumulation of GM2 ganglioside, particular in neuronal cells. The disorder is caused by deficiency of ß-hexosaminidase B (HEX-B), due to pathogenic variant of human HEXB gene. METHOD: This study describes clinical features, biochemical, and genetic defects among Thai patients with infantile SD during 2008-2019. RESULTS: Five unrelated Thai patients presenting with developmental regression, axial hypotonia, seizures, exaggerated startle response to noise, and macular cherry red spot were confirmed to have infantile SD based on deficient HEX enzyme activities and biallelic variants of the HEXB gene. In addition, an uncommon presenting feature, cardiac defect, was observed in one patient. All the patients died in their early childhood. Plasma total HEX and HEX-B activities were severely deficient. Sequencing analysis of HEXB gene identified two variants including c.1652G>A (p.Cys551Tyr) and a novel variant of c.761T>C (p.Leu254Ser), in 90 and 10% of the mutant alleles found, respectively. The results from in silico analysis using multiple bioinformatics tools were in agreement that the p.Cys551Tyr and the p.Leu254Ser are likely pathogenic variants. Molecular modelling suggested that the Cys551Tyr disrupt disulfide bond, leading to protein destabilization while the Leu254Ser resulted in change of secondary structure from helix to coil and disturbing conformation of the active site of the enzyme. Genome-wide SNP array analysis showed no significant relatedness between the five affected individuals. These two variants were not present in control individuals. The prevalence of infantile SD in Thai population is estimated 1 in 1,458,521 and carrier frequency at 1 in 604. CONCLUSION: The study suggests that SD likely represents the most common subtype of rare infantile GM2 gangliosidosis identified among Thai patients. We firstly described a potential common variant in HEXB in Thai patients with infantile onset SD. The data can aid a rapid molecular confirmation of infantile SD starting with the hotspot variant and the use of expanded carrier testing.

Effects of 8-Year Treatment of Long-Acting Testosterone Undecanoate on Metabolic Parameters, Urinary Symptoms, Bone Mineral Density, and Sexual Function in Men With Late-Onset Hypogonadism.

INTRODUCTION: The long-term effects of long-acting testosterone undecanoate (TU) and androgen receptor CAG repeat lengths in Thai men with late-onset hypogonadism (LOH) have not been reported. AIM: To analyze the 8-year follow-up effects of intramuscular TU therapy on metabolic parameters, urinary symptoms, bone mineral density, and sexual function and investigate CAG repeat lengths in men with LOH. METHODS: We reviewed the medical records of 428 men with LOH who had been treated with TU and 5 patients were diagnosed with prostate cancer during TU therapy. There were 120 patients (mean age = 65.6 ± 8.9 years) who had 5 to 8 years of continuous TU supplementation and sufficiently completed records for analysis. Genomic DNA was extracted from peripheral blood and the CAG repeat region was amplified by polymerase chain reaction. Fragment analysis, sequencing, electropherography, and chromatography were performed. MAIN OUTCOME MEASURES: The main outcome measure was dynamic parameter changes during testosterone supplementation. RESULTS: TU did not improve all obesity parameters. A statistically significant decrease was found in waist circumference, percentage of body fat, glycated hemoglobin, cholesterol, low-density lipoprotein, and International Prostate Symptom Score (P < .05). TU did not produce differences in body mass index, high-density lipoprotein, triglyceride, or the Aging Male Symptoms score from baseline. However, a statistically significant increase was found in the level of testosterone, prostate-specific antigen, hematocrit, International Index of Erectile Function score, and vertebral and femoral bone mineral density (P < .05). No major adverse cardiovascular events or prostate cancer occurred during this study. The CAG repeat length was 14 to 28 and the median CAG length was 22. There was no association between CAG repeat length and any of the anthropometric measurements. CONCLUSION: Long-term TU treatment in men with LOH for up to 8 years appears to be safe, tolerable, and effective in correcting obesity parameters.

Tremella fuciformis beverage improves glycated hemoglobin A1c and waist circumference in overweight/obese prediabetic subjects: a randomized controlled trial.

BACKGROUND: Prediabetes is increasing worldwide. Previous studies have demonstrated the potential of ß-glucan derived from oat or barley to lower blood glucose, body weight, and plasma lipid levels. These findings offer a potentially attractive strategy for reducing the risk of diabetes in prediabetic individuals. However, the effects of ß-glucan from Tremella fuciformis on glucose metabolism and anthropometric measurements in humans have yet to be studied. We hypothesized that ß-glucan from Tremella fuciformis may improve metabolic parameters in subjects with prediabetes. This study aimed to investigate the effects of a once-daily beverage containing Tremella fuciformis (snow mushroom) on anthropometric measurements, metabolic biomarkers, and insulin sensitivity in overweight/obese subjects with prediabetes. METHODS: In this double-blind RCT, 56 participants were randomly assigned to receive either a Tremella fuciformis beverage or placebo daily for 12 weeks. All parameters were assessed at baseline and after the intervention. RESULTS: After 12 weeks, participants in the intervention group exhibited significant improvements in glycated hemoglobin A1c (HbA1C; 6.03 ± 0.26% at baseline vs. 5.96 ± 0.25% at 12 weeks, p = 0.047, Cohen's d = 0.39) and waist circumference (95.2 ± 12.51 cm at baseline vs. 93.46 ± 11.48 cm at 12 weeks, p = 0.022, Cohen's d = 0.45). There were no adverse events reported. CONCLUSION: This exploratory study demonstrated that Tremella fuciformis beverage consumption may improve HbA1C and waist circumference in overweight/obese prediabetic individuals. Further research, including larger-scale RCTs and mechanistic studies, is needed to confirm these findings and optimize the therapeutic potential of Tremella fuciformis derivatives in managing prediabetes and preventing type 2 diabetes. TRIAL REGISTRATION: Registered in Thai Clinical Trials Registry (14/07/2021, TCTR20210714004).

Conserved expression of the zebrafish syt4 gene in GABAergic neurons in the cerebellum of adult fishes revealed by mammalian SYT4 immunoreactive-like signals.

Synaptotagmin 4 (syt4) belongs to the synaptotagmin protein family, which has 17 and 28 family members in human and zebrafish, respectively. In zebrafish and rodents, syt4 is known to express abundantly in the entire central nervous system in the early developmental stages. In adult rodents, the gene expression shifts to be predominant in the cerebellum, mostly in Purkinje cells, a type of GABAergic neurons. However, there is no report of the expression pattern of syt4 in the adult zebrafish brain. Therefore, we hypothesize that the expression of syt4 is conserved in adult zebrafish and is specific to the GABAergic neurons, likely Purkinje cells, in the cerebellum. To examine the hypothesis, we first show that only one copy of syt4 gene remains in the zebrafish genome, and it is orthologous to the gene in other vertebrates. We further observe mammalian SYT4 antibody immunoreactive-like (mSYT4-ir) signals in several structures in the hindbrain including the medial divisions of the valvula cerebelli and the corpus cerebelli. In addition, our observations indicate the presence of mSYT4-ir signals in GABAergic neurons, most notably in the Purkinje cell layer of the molecular layer in the aforementioned structures. Conversely, mSYT4-ir signals are not observed in glutamatergic or cholinergic neurons. Therefore, we deduce that the syt4 gene in zebrafish exhibits a homologous expression pattern to those of previously studied vertebrate species, which is revealed by the positive immunoreactive-like signals of mammalian SYT4 antibodies.

Saliva and wastewater surveillance for SARS-CoV-2 during school reopening amid COVID-19 pandemic in Thailand.

Objectives: School closure during the coronavirus disease 2019 (COVID-19) pandemic resulted in a negative impact on children. Serial testing of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has been proposed as a measure for safety school reopening. We aimed to study the usefulness of SARS-CoV-2 surveillance by saliva testing and performing wastewater surveillance for SARS-CoV-2 in a day school in a resource-limited setting. Methods: We conducted a cluster randomized study to investigate the potential use of saliva antigen testing compared to saliva pooling for nucleic acid detection in a primary school in Thailand from December 2021 to March 2022. Wastewater surveillance in the school was also performed. Results: A total of 484 participants attended the study. SARS-CoV-2 was detected in two participants from the tests provided by the study (one in the pool nucleic acid test arm, and another in the quantitative antigen test arm). Additional ten participants reported positive results on an additional rapid antigen test (RAT) performed by nasal swab when they had symptoms or household contact. There was no difference among arms in viral detection by intention-to-treat and per protocol analysis (p = 0.304 and 0.894, respectively). We also investigated the feasibility of wastewater surveillance to detect the virus in this setting. However, wastewater surveillance could not detect the virus. Conclusions: In a low COVID-19 prevalence, serial saliva testing and wastewater surveillance for SARS-CoV-2 rarely detected the virus in a day school setting. Performing RAT on nasal swabs when students, teachers or staff have symptoms or household contact might be more reasonable.

The Detection of SARS-CoV2 Antigen in Wastewater Using an Automated Chemiluminescence Enzyme Immunoassay.

The SARS-CoV-2 virus, which is driving the current COVID-19 epidemic, has been detected in wastewater and is being utilized as a surveillance tool to establish an early warning system to aid in the management and prevention of future pandemics. qPCR is the method usually used to detect SARS-CoV-2 in wastewater. There has been no study using an immunoassay that is less laboratory-intensive than qPCR with a shorter turnaround time. Therefore, we aimed to evaluate the performance of an automated chemiluminescence enzyme immunoassay (CLEIA) for SARS-CoV-2 antigen in wastewater. The CLEIA assay achieved 100% sensitivity and 66.7% specificity in a field-captured wastewater sample compared to the gold standard RT-qPCR. Our early findings suggest that the SARS-CoV-2 antigen can be identified in wastewater samples using an automated CLEIA, reducing the turnaround time and improving the performance of SARS-CoV-2 wastewater monitoring during the pandemic.

A Simple Method to Detect SARS-CoV-2 in Wastewater at Low Virus Concentration.

Background: Since its initial appearance in December 2019, coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has spread globally. Wastewater surveillance has been demonstrated as capable of identifying infection clusters early. The purpose of this study was to investigate a quick and simple method to detect SARS-CoV-2 in wastewater in Thailand during the early stages of the second outbreak wave when the prevalence of the disease and the virus concentration in wastewater were low. Methods: Wastewater samples were collected from a hospital caring for patients with COVID-19 and from 35 markets, two of which were associated with recently reported COVID-19 cases. Then, samples were concentrated by membrane filtering prior to SARS-CoV-2 detection by RT-qPCR. Results: SARS-CoV-2 RNA was detected in the wastewater samples from the hospital; the Ct values for the N, ORF1ab, and S genes progressively increased as the number of patients admitted to the treatment floor decreased. Notably, the ORF1ab and S genes were still detectable in wastewater even when only one patient with COVID-19 remained at the hospital. SARS-CoV-2 RNA was detected in the wastewater samples from fresh market where COVID-19 cases were reported. Conclusions: Our findings suggest that wastewater surveillance for SARS-CoV-2 is sensitive and can detect the virus even in places with a high ambient temperature and relatively low prevalence of COVID-19.

Gut Microbiota Characteristics in Children After the Use of Proton Pump Inhibitors.

BACKGROUND/AIMS: Prolonged acid suppression from proton pump inhibitor (PPI) has been shown to cause gut microbiota alteration which may increase risk of various infections in adults. We aimed to characterize gut microbiota profiles in children after a short-term use of PPI. MATERIALS AND METHODS: Children aged 1-18 years who underwent PPI therapy were included during April-December 2017. We excluded children who previously used antibiotics or acid suppressants, had a history of acute gastroenteritis or specific food avoidance one month prior to the enrolment. The stool samples before and after the PPI use were collected for gut microbiota composition. The 16S ribosomal RNA gene sequencing was performed by using Illumina MiSeq. The differences in gut microbiota profile after the use of PPI were compared to pre-PPI period. RESULTS: We completed stool collection in 20 children (median age of 5.8 years and 60% were female). No significant changes in the overall number of species-level taxonomy categories or predominant bacteria phylum (Bacteroidetes) were noted. We found a trend increase in the proportion of phylum Firmicutes among children living in the metropolitan/suburban area (P=.07) and among males (P=.11). In four children with infection-related adverse effects, we noted a non-significant increase in the proportion of phylum Firmicutes after the PPI use (from 35 to 52%, P = .14). CONCLUSION: Even the total number and predominant gut microbiota did not significantly change after a four- to eight-week course of PPI therapy; we found a trend of increased proportion of phylum Firmicutes in certain groups of children.

MITF variants cause nonsyndromic sensorineural hearing loss with autosomal recessive inheritance.

MITF is a known gene underlying autosomal dominant hearing loss, Waardenburg syndrome (WS). Biallelic MITF mutations have been found associated with a rare hearing loss syndrome consisting eye abnormalities and albinism; and a more severe type of WS whose heterozygous parents were affected with classic WS in both cases. The aims of this study were to identify a new candidate gene causing autosomal recessive nonsyndromic hearing loss (ARNSHL) and confirm its causation by finding additional families affected with the candidate gene and supporting evidences from functional analyses. By using whole exome sequencing, we identified a homozygous c.1022G>A: p.Arg341His variant of MITF, which co-segregated with the hearing loss in five affected children of a consanguineous hearing couple. Targeted exome sequencing in a cohort of 130 NSHL individuals, using our in-house gene panel revealed a second family with c.1021C>T: p.Arg341Cys MITF variant. Functional studies confirmed that the Arg341His and Arg341Cys alleles yielded a normal sized MITF protein, with aberrant cytosolic localization as supported by the molecular model and the reporter assay. In conclusion, we demonstrate MITF as a new cause of ARNSHL, with heterozygous individuals free of symptoms. MITF should be included in clinical testing for NSHL, though it is rare.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.