Structural and Biological Features of G-Quadruplex Aptamers as Promising Inhibitors of the STAT3 Signaling Pathway.

In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3 signalling pathway. Targeting the STAT3 protein through high-affinity ligands to reduce its levels or activity in cancer has noteworthy therapeutic potential. T40214 (STAT) [(G3C)4] is a G4 aptamer that can influence STAT3 biological outcomes in an efficient manner in several cancer cells. To explore the effects of an extra cytidine in second position and/or of single site-specific replacements of loop residues in generating aptamers that can affect the STAT3 biochemical pathway, a series of STAT and STATB [GCG2(CG3)3C] analogues containing a thymidine residue instead of cytidines was prepared. NMR, CD, UV, and PAGE data suggested that all derivatives adopt dimeric G4 structures like that of unmodified T40214 endowed with higher thermal stability, keeping the resistance in biological environments substantially unchanged, as shown by the nuclease stability assay. The antiproliferative activity of these ODNs was tested on both human prostate (DU145) and breast (MDA-MB-231) cancer cells. All derivatives showed similar antiproliferative activities on both cell lines, revealing a marked inhibition of proliferation, particularly at 72 h at 30 µM. Transcriptomic analysis aimed to evaluate STAT's and STATB's influence on the expression of many genes in MDA-MB-231 cells, suggested their potential involvement in STAT3 pathway modulation, and thus their interference in different biological processes. These data provide new tools to affect an interesting biochemical pathway and to develop novel anticancer and anti-inflammatory drugs.

Improving the Biological Properties of Thrombin-Binding Aptamer by Incorporation of 8-Bromo-2'-Deoxyguanosine and 2'-Substituted RNA Analogues.

Thrombin-binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers. By adopting its peculiar chair-like G4 structure, TBA can efficiently bind to thrombin, thus producing an anticoagulant effect. The major limit to its therapeutic application is represented by its poor thermal and biological resistance. Therefore, numerous research studies have been focused on the design of TBA analogues with chemical modifications to improve its pharmacokinetic and pharmacodynamic properties. To maintain the functional recognition to protein surface on which TBA anticoagulant activity depends, it is essential to preserve the canonical antiparallel topology of the TBA quadruplex core. In this paper, we have designed three TBA variants with modified G-tetrads to evaluate the effects of nucleobase and sugar moiety chemical modifications on biological properties of TBA, preserving its chair-like G-quadruplex structure. All derivatives contain 8-bromo-2'-deoxyguanosine (GBr) in syn positions, while in the anti-positions, locked nucleic acid guanosine (GLNA) in the analogue TBABL, 2'-O-methylguanosine (GOMe) in TBABM, and 2'-F-riboguanosine (GF) in TBABF is present. CD (Circular Dichroism), CD melting, 1H-NMR (Nuclear Magnetic Resonance), and non-denaturing PAGE (Polyacrylamide Gel Electrophoresis), nuclease stability, prothrombin time (PT) and fibrinogen-clotting assays have been performed to investigate the structural and biological properties of these TBA analogues. The most interesting results have been obtained with TBABF, which revealed extraordinary thermal stability (Tm approximately 40 °C higher than that of TBA), anticoagulant activity almost doubled compared to the original aptamer, and, above all, a never-observed resistance to nucleases, as 50% of its G4 species was still present in 50% FBS at 24 h. These data indicate TBABF as one of the best TBA analogue ever designed and investigated, to the best of our knowledge, overcoming the main limitations to therapeutic applications of this aptamer.

Structural properties and anticoagulant/cytotoxic activities of heterochiral enantiomeric thrombin binding aptamer (TBA) derivatives.

The thrombin binding aptamer (TBA) possesses promising antiproliferative properties. However, its development as an anticancer agent is drastically impaired by its concomitant anticoagulant activity. Therefore, suitable chemical modifications in the TBA sequence would be required in order to preserve its antiproliferative over anticoagulant activity. In this paper, we report structural investigations, based on circular dichroism (CD) and nuclear magnetic resonance spectroscopy (NMR), and biological evaluation of four pairs of enantiomeric heterochiral TBA analogues. The four TBA derivatives of the d-series are composed by d-residues except for one l-thymidine in the small TT loops, while their four enantiomers are composed by l-residues except for one d-thymidine in the same TT loop region. Apart from the left-handedness for the l-series TBA derivatives, CD and NMR measurements have shown that all TBA analogues are able to adopt the antiparallel, monomolecular, 'chair-like' G-quadruplex structure characteristic of the natural D-TBA. However, although all eight TBA derivatives are endowed with remarkable cytotoxic activities against colon and lung cancer cell lines, only TBA derivatives of the l-series show no anticoagulant activity and are considerably resistant in biological environments.

Antiproliferative Effects of the Aptamer d(GGGT)4 and Its Analogues with an Abasic-Site Mimic Loop on Different Cancer Cells.

In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing five T30923 variants using the single residue replacement approach of loop thymidine with an abasic site mimic (S). G-rich oligonucleotides (GRO) show interesting anticancer properties because of their capability to adopt G-quadruplex structures (G4s), such as the G4 HIV-1 integrase inhibitor T30923. Considering the multi-targeted effects of G4-aptamers and the limited number of cancer cell lines tested, particularly for T30923, it should be important to find a suitable tumor line, in addition to considering that the effects also strictly depend on G4s. CD, NMR and non-denaturating polyacrylamide gel electrophoresis data clearly show that all modified ODNs closely resemble the dimeric structure of parallel G4s' parent aptamer, keeping the resistance in biological environments substantially unchanged, as shown by nuclease stability assay. The antiproliferative effects of T30923 and its variants are tried in vitro by MTT assays, showing interesting cytotoxic activity, depending on time and dose, for all G4s, especially in MDA-MB-231 cells with a reduction in cell viability approximately up to 30%. Among all derivatives, QS12 results are the most promising, showing more pronounced cytotoxic effects both in MDA-MB-231 and Hela cells, with a decrease in cell viability from 70% to 60%. In summary, the single loop residue S substitution approach may be useful for designing antiproliferative G4s, considering that most of them, characterized by single residue loops, may be able to bind different targets in several cancer cell pathways. Generally, this approach could be of benefit by revealing some minimal functional structures, stimulating further studies aimed at the development of novel anticancer drugs.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Properties and Potential Antiproliferative Activity of Thrombin-Binding Aptamer (TBA) Derivatives with One or Two Additional G-Tetrads.

In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two further derivatives in which one of the small loops at the bottom (TBAG41S) or the large loop at the top (TBAG4GS) of the TBAG4 structure has been completely modified by replacing all loop residues with abasic site mimics. The therapeutical development of the TBA was hindered by its low thermodynamic and nuclease stability, while its potential as an anticancer/antiproliferative molecule is also affected by the anticoagulant activity, being a side effect in this case. In order to obtain suitable TBA analogs and to explore the involvement of specific aptamer regions in biological activity, the antiproliferative capability against DU 145 and MDAMB 231 cancer cell lines (MTT), the anticoagulant properties (PT), the biological degradability (nuclease stability assay) and nucleolin (NCL) binding ability (SPR) of the above described TBA derivatives have been tested. Interestingly, none of the TBA analogs exhibits an anticoagulant activity, while all of them show antiproliferative properties to the same extent. Furthermore, TBAG4 displays extraordinary nuclease stability and promising antiproliferative properties against breast cancer cells binding NCL efficiently. These results expand the range of G4-structures targeting NCL and the possibility of developing novel anticancer and antiviral drugs.

Exploring New Potential Anticancer Activities of the G-Quadruplexes Formed by [(GTG2T(G3T)3] and Its Derivatives with an Abasic Site Replacing Single Thymidine.

In this paper, we report our investigations on five T30175 analogues, prepared by replacing sequence thymidines with abasic sites (S) one at a time, in comparison to their natural counterpart in order to evaluate their antiproliferative potential and the involvement of the residues not belonging to the central core of stacked guanosines in biological activity. The collected NMR (Nuclear Magnetic Resonance), CD (Circular Dichroism), and PAGE (Polyacrylamide Gel Electrophoresis) data strongly suggest that all of them adopt G-quadruplex (G4) structures strictly similar to that of the parent aptamer with the ability to fold into a dimeric structure composed of two identical G-quadruplexes, each characterized by parallel strands, three all-anti-G-tetrads and four one-thymidine loops (one bulge and three propeller loops). Furthermore, their antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against lung and colorectal cancer cells were tested. Although all of the oligodeoxynucleotides (ODNs) investigated here exhibited anti-proliferative activity, the unmodified T30175 aptamer showed the greatest effect on cell growth, suggesting that both its characteristic folding in dimeric form and its presence in the sequence of all thymidines are crucial elements for antiproliferative activity. This straightforward approach is suitable for understanding the critical requirements of the G-quadruplex structures that affect antiproliferative potential and suggests its application as a starting point to facilitate the reasonable development of G-quadruplexes with improved anticancer properties.

Aptamers against the ß-Conglutin Allergen: Insights into the Behavior of the Shortest Multimeric (Intra)Molecular DNA G-Quadruplex.

In previous work, a 93-mer aptamer was selected against the anaphylactic allergen, ß-conglutin and truncated to an 11-mer, improving the affinity by two orders of magnitude, whilst maintaining the specificity. This 11-mer was observed to fold in a G-quadruplex, and preliminary results indicated the existence of a combination of monomeric and higher-order structures. Building on this previous work, in the current study, we aimed to elucidate a deeper understanding of the structural forms of this 11-mer and the effect of the structure on its binding ability. A battery of techniques including polyacrylamide gel electrophoresis, high-performance liquid chromatography in combination with electrospray ionization time-of-flight mass spectrometry, matrix-assisted laser desorption/ionization time-of-flight, thermal binding analysis, circular dichroism and nuclear magnetic resonance were used to probe the structure of both the 11-mer and the 11-mer flanked with TT- at either the 5' or 3' end or at both ends. The TT-tail at the 5' end hinders stacking effects and effectively enforces the 11-mer to maintain a monomeric form. The 11-mer and the TT- derivatives of the 11-mer were also evaluated for their ability to bind its cognate target using microscale thermophoresis and surface plasmon resonance, and biolayer interferometry confirmed the nanomolar affinity of the 11-mer. All the techniques utilized confirmed that the 11-mer was found to exist in a combination of monomeric and higher-order structures, and that independent of the structural form present, nanomolar affinity was observed.

Probing the Importance of the G-Quadruplex Grooves for the Activity of the Anti-HIV-Integrase Aptamer T30923.

In this paper, we report studies concerning four variants of the G-quadruplex forming anti-HIV-integrase aptamer T30923, in which specific 2'-deoxyguanosines have been singly replaced by 8-methyl-2'-deoxyguanosine residues, with the aim to exploit the methyl group positioned in the G-quadruplex grooves as a steric probe to investigate the interaction aptamer/target. Although, the various modified aptamers differ in the localization of the methyl group, NMR, circular dichroism (CD), electrophoretic and molecular modeling data suggest that all of them preserve the ability to fold in a stable dimeric parallel G-quadruplex complex resembling that of their natural counterpart T30923. However, the biological data have shown that the T30923 variants are characterized by different efficiencies in inhibiting the HIV-integrase, thus suggesting the involvement of the G-quadruplex grooves in the aptamer/target interaction.

Metastatic group 3 medulloblastoma is driven by PRUNE1 targeting NME1-TGF-ß-OTX2-SNAIL via PTEN inhibition.

Genetic modifications during development of paediatric groups 3 and 4 medulloblastoma are responsible for their highly metastatic properties and poor patient survival rates. PRUNE1 is highly expressed in metastatic medulloblastoma group 3, which is characterized by TGF-ß signalling activation, c-MYC amplification, and OTX2 expression. We describe the process of activation of the PRUNE1 signalling pathway that includes its binding to NME1, TGF-ß activation, OTX2 upregulation, SNAIL (SNAI1) upregulation, and PTEN inhibition. The newly identified small molecule pyrimido-pyrimidine derivative AA7.1 enhances PRUNE1 degradation, inhibits this activation network, and augments PTEN expression. Both AA7.1 and a competitive permeable peptide that impairs PRUNE1/NME1 complex formation, impair tumour growth and metastatic dissemination in orthotopic xenograft models with a metastatic medulloblastoma group 3 cell line (D425-Med cells). Using whole exome sequencing technology in metastatic medulloblastoma primary tumour cells, we also define 23 common 'non-synonymous homozygous' deleterious gene variants as part of the protein molecular network of relevance for metastatic processes. This PRUNE1/TGF-ß/OTX2/PTEN axis, together with the medulloblastoma-driver mutations, is of relevance for future rational and targeted therapies for metastatic medulloblastoma group 3.10.1093/brain/awy039_video1awy039media15742053534001.

Monomolecular G-quadruplex structures with inversion of polarity sites: new topologies and potentiality.

In this paper, we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy and electrophoresis methods, on three oligonucleotide sequences, each containing one 3'-3' and two 5'-5' inversion of polarity sites, and four G-runs with a variable number of residues, namely two, three and four (mTG2T, mTG3T and mTG4T with sequence 3'-TGnT-5'-5'-TGnT-3'-3'-TGnT-5'-5'-TGnT-3' in which n = 2, 3 and 4, respectively), in comparison with their canonical counterparts (TGnT)4 (n = 2, 3 and 4). Oligonucleotides mTG3T and mTG4T have been proven to form very stable unprecedented monomolecular parallel G-quadruplex structures, characterized by three side loops containing the inversion of polarity sites. Both G-quadruplexes have shown an all-syn G-tetrad, while the other guanosines adopt anti glycosidic conformations. All oligonucleotides investigated have shown a noteworthy antiproliferative activity against lung cancer cell line Calu 6 and colorectal cancer cell line HCT-116 p53-/-. Interestingly, mTG3T and mTG4T have proven to be mostly resistant to nucleases in a fetal bovine serum assay. The whole of the data suggest the involvement of specific pathways and targets for the biological activity.

The "Janus face" of the thrombin binding aptamer: Investigating the anticoagulant and antiproliferative properties through straightforward chemical modifications.

BACKGROUND: The thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative activities. Its chemico-physical and/or biological properties can be tuned by the site-specific replacement of selected residues. METHODS: Four oligodeoxynucleotides (ODNs) based on the TBA sequence (5'-GGTTGGTGTGGTTGG-3') and containing 2'-deoxyuridine (U) or 5-bromo-2'-deoxyuridine (B) residues at positions 4 or 13 have been investigated by NMR and CD techniques. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay) have been tested and compared with two further ODNs containing 5-hydroxymethyl-2'-deoxyuridine (H) residues in the same positions, previously investigated. RESULTS: The CD and NMR data suggest that all the investigated ODNs are able to form G-quadruplexes strictly resembling that of TBA. The introduction of B residues in positions 4 or 13 increases the melting temperature of the modified aptamers by 7 °C. The replacement of thymidines with U in the same positions results in an enhanced anticoagulant activity compared to TBA, also at low ODN concentration. Although all ODNs show antiproliferative properties, only TBA derivatives containing H in the positions 4 and 13 lose the anticoagulant activity and remarkably preserve the antiproliferative one. CONCLUSIONS: All ODNs have shown antiproliferative activities against two cancer cell lines but only those with U and B are endowed with anticoagulant activities similar or improved compared to TBA. GENERAL SIGNIFICANCE: The appropriate site-specific replacement of the residues in the TT loops of TBA with commercially available thymine analogues is a useful strategy either to improve the anticoagulant activity or to preserve the antiproliferative properties by quenching the anticoagulant ones.

Backbone modified TBA analogues endowed with antiproliferative activity.

BACKGROUND: The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. METHODS: Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. RESULTS: CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. CONCLUSIONS: A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. GENERAL SIGNIFICANCE: Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.

Site specific replacements of a single loop nucleoside with a dibenzyl linker may switch the activity of TBA from anticoagulant to antiproliferative.

Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13.

Site-specific replacement of the thymine methyl group by fluorine in thrombin binding aptamer significantly improves structural stability and anticoagulant activity.

Here we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy, molecular modelling, differential scanning calorimetry and prothrombin time assay, on analogues of the thrombin binding aptamer (TBA) in which individual thymidines were replaced by 5-fluoro-2'-deoxyuridine residues. The whole of the data clearly indicate that all derivatives are able to fold in a G-quadruplex structure very similar to the 'chair-like' conformation typical of the TBA. However, only ODNs TBA-F4: and TBA-F13: have shown a remarkable improvement both in the melting temperature (ΔTm ≈ +10) and in the anticoagulant activity in comparison with the original TBA. These findings are unusual, particularly considering previously reported studies in which modifications of T4 and T13 residues in TBA sequence have clearly proven to be always detrimental for the structural stability and biological activity of the aptamer. Our results strongly suggest the possibility to enhance TBA properties through tiny straightforward modifications.

The oxidative damage to the human telomere: effects of 5-hydroxymethyl-2'-deoxyuridine on telomeric G-quadruplex structures.

As part of the genome, human telomeric regions can be damaged by the chemically reactive molecules responsible for oxidative DNA damage. Considering that G-quadruplex structures have been proven to occur in human telomere regions, several studies have been devoted to investigating the effect of oxidation products on the properties of these structures. However only investigations concerning the presence in G-quadruplexes of the main oxidation products of deoxyguanosine and deoxyadenosine have appeared in the literature. Here, we investigated the effects of 5-hydroxymethyl-2'-deoxyuridine (5-hmdU), one of the main oxidation products of T, on the physical-chemical properties of the G-quadruplex structures formed by two human telomeric sequences. Collected calorimetric, circular dichroism and electrophoretic data suggest that, in contrast to most of the results on other damage, the replacement of a T with a 5-hmdU results in only negligible effects on structural stability. Reported results and other data from literature suggest a possible protecting effect of the loop residues on the other parts of the G-quadruplexes.

Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.

In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions.

5-Hydroxymethyl-2'-deoxyuridine residues in the thrombin binding aptamer: investigating anticoagulant activity by making a tiny chemical modification.

We report an investigation into analogues of the thrombin binding aptamer (TBA). Individual thymidines were replaced by the unusual residue 5-hydroxymethyl-2'-deoxyuridine (hmU). This differs from the canonical thymidine by a hydroxyl group on the 5-methyl group. NMR and CD data clearly indicate that all TBA derivatives retain the ability to fold into the "chair-like" quadruplex structure. The presence of the hmU residue does not significantly affect the thermal stability of the modified aptamers compared to the parent, except for analogue H9, which showed a marked increase in melting temperature. Although all TBA analogues showed decreased affinities to thrombin, H3, H7, and H9 proved to have improved anticoagulant activities. Our data open up the possibility to enhance TBA biological properties, simply by introducing small chemical modifications.

More than one non-canonical phosphodiester bond in the G-tract: formation of unusual parallel G-quadruplex structures.

In this article, we report an investigation, based on NMR and CD spectroscopic and electrophoretic techniques, of 5'TGGGGT3' analogues containing two or three 3'-3' or 5'-5' inversion sites in the G-run, namely 5'TG3'-3'G5'-5'GGT3' (Q350), 5'TG3'-3'GG5'-5'GT3' (Q305), 5'TGG3'-3'G5'-5'GT3' (Q035), 5'TG3'-3'G5'-5'G3'-3'GT5' (Q353) and 3'TG5'-5'G3'-3'G5'-5'GT3' (Q535). Although the sequences investigated contain either no or only one natural 3'-5' linkage in the G-tract, all modified oligodeoxyribonucleotides (ODNs) have been shown to form stable tetramolecular quadruplex structures. The ability of the 3'-3' or 5'-5' inversion sites to affect the glycosidic conformation of guanosines and, consequently, base stacking, has also been investigated. The results of this study allow us to propose some generalizations concerning strand arrangements and the glycosidic conformational preference of residues adjacent to inverted polarity sites. These rules could be of general interest in the design of modified quadruplex structures, in view of their application as G-wires and modified aptamers.

A straightforward modification in the thrombin binding aptamer improving the stability, affinity to thrombin and nuclease resistance.

Degradation of nucleic acids in biological environments is the major drawback of the therapeutic use of aptamers. Among the approaches used to circumvent this negative aspect, the introduction of 3'-3' inversion of polarity sites at the sequence 3'-end has successfully been proposed. However, the introduction of inversion of polarity at the ends of the sequence has never been exploited for G-quadruplex forming aptamers. In this communication we describe CD, UV, electrophoretic and biochemical investigations concerning thrombin binding aptamer analogues containing one or two inversions of polarity sites at the oligonucleotide ends. Data indicate that, in some cases, this straightforward chemical modification is able to improve, at the same time, the thermal stability, affinity to thrombin and nuclease resistance in biological environments, thus suggesting its general application as a post-SELEX modification also for other therapeutically promising aptamers adopting G-quadruplex structures.