RESUMO
A La-doped Ti/SnO2-Sb2O4 electrode with TiO2-NTs intermediate layer (Ti/TiO2-NTs/SnO2-Sb2O4-La) was created via the electrodeposition technique. The physicochemical and electrochemical properties of the electrode were analyzed through FESEM, XRD, XPS, CV, and LSV electrochemical tests. The results showed that TiO2-NTs were tightly packed on the surface of Ti substrate, thus improving the binding force of the SnO2-Sb2O4-La coating, offering greater specific surface area, more active spots, higher current response, and longer lifespan for the degradation of rhodamine B. The lifespan of the Ti/TiO2-NTs/SnO2-Sb2O4-La electrode reached 200 min (1000 mA cm-2, 1 M H2SO4), while the actual service life was up to 3699 h. Under the conditions of initial pH 3.0, Na2SO4 concentration of 0.1 M, current density of 30 mA cm-2, and initial rhodamine B concentration of 20 mg L-1, the color and TOC removal rate of rhodamine B reached 100% and 86.13% within 15 and 30 min, respectively. Rhodamine B was decomposed into acids, esters, and other molecular compounds under the action of â¢OH and SO4â¢- free radicals and electrocatalysis, and finally completely mineralized into CO2 and H2O. It is anticipated that this work will yield a novel research concept for producing DSA electrodes with superior catalytic efficacy and elevated stability.
RESUMO
BACKGROUND: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. METHODS: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. RESULTS: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short ß-strand (residues 63-68 or residues 64-68), thereby forming a conformational change. CONCLUSIONS: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.
Assuntos
Mutação INDEL , Sindactilia , China , Proteínas de Homeodomínio/genética , Humanos , Mutação , Linhagem , Peptídeos , Sindactilia/diagnóstico , Sindactilia/genética , Sindactilia/patologia , Fatores de Transcrição/genéticaRESUMO
PURPOSE: This study aimed to evaluate the clinical features, possible etiology, and surgical outcomes of a rare manifestation of pediatric trigger thumb, extension trigger thumb (ETT). METHODS: We retrospectively reviewed a database of surgically treated trigger thumb patients and identified patients with ETT who had a minimum of 1-year follow-up after surgery from 2012 to 2018. We reviewed demographic and clinical information and recorded active and passive interphalangeal (IP) joint flexion before, during (intraoperative simulated active flexion), and after surgery (at final follow-up). These measurements were compared with those obtained from the unaffected thumb in unilaterally affected patients. RESULTS: Eighteen patients with ETT (21 affected thumbs) were identified. The incidence of ETT was 1%, with an increasing incidence through the years of the study. We found that 14 of 18 ETT patients had a history of fixed flexion trigger thumb managed with nonsurgical treatment. There was an average 38° ± 10° improvement in active IP joint flexion after surgery and at the final follow-up. For unilaterally affected patients, active IP joint flexion improved but did not reach the same level as on the unaffected side. CONCLUSIONS: Extension trigger thumb is a rare manifestation with a low incidence in pediatric trigger thumbs. Surgical release of the A1 pulley achieves a moderate improvement in flexion function at the IP joint. TYPE OF STUDY/LEVEL OF EVIDENCE: Prognostic IV.
Assuntos
Dedo em Gatilho , Criança , Estudos de Coortes , Humanos , Amplitude de Movimento Articular , Estudos Retrospectivos , Polegar/cirurgia , Dedo em Gatilho/cirurgiaRESUMO
BACKGROUND: Delta triphalangeal thumbs (DTPT) and irregular epiphysis thumbs (IET) had different anatomic deformities. Our primary purpose was to evaluate the clinical and radiographic outcomes of surgical treatment in DTPT and IET. METHODS: In total, 43 ulnar-deviated thumbs were included and categorized into 2 types according to x-ray and exploration during surgery, DTPT and IET. Surgical excision of the delta phalanx in DTPT and intraepiphysis osteotomy in IET was conducted. RESULTS: In total, 23 ulnar-deviated thumbs were classified as DTPT and 20 as IET. Ten thumbs that could not be classified initially were followed-up until they could be categorized at the mean age of 24 months. The preoperative mean degrees of ulnar deviation at the interphalangeal joints were 40 and 33 degrees, in DTPT and IET, respectively. The mean degrees were 2 and 5 degrees in final follow-up, showing significant improvement (DTPT, P<0.05; IET, P<0.05). Complications during the study included residual ulnar deviation, overcorrection, and nonunion. The stability and range of movement at the interphalangeal joint were good overall. According to the Japanese Society for Surgery of the Hand scoring system, results were excellent in 29 cases, good in 13, and fair in 1. CONCLUSIONS: Ulnar clinodactyly of the thumb occurs because of different anatomic features such as DTPT or IET. We recommend surgical treatment be postponed until the anatomic abnormality can be ascertained. Furthermore, almost all patients with ulnar-deviated thumbs had significant improvement in clinical and radiographic outcomes after surgery.
Assuntos
Articulações dos Dedos/fisiopatologia , Deformidades Congênitas da Mão , Osteotomia , Complicações Pós-Operatórias , Amplitude de Movimento Articular , Polegar/anormalidades , Pré-Escolar , Epífises/cirurgia , Feminino , Deformidades Congênitas da Mão/diagnóstico , Deformidades Congênitas da Mão/cirurgia , Humanos , Masculino , Osteotomia/efeitos adversos , Osteotomia/métodos , Complicações Pós-Operatórias/diagnóstico , Complicações Pós-Operatórias/etiologia , Complicações Pós-Operatórias/fisiopatologia , Radiografia/métodos , Polegar/diagnóstico por imagem , Polegar/cirurgia , Resultado do TratamentoRESUMO
To improve the efficiency of the Fe(II)/Fe(III) cycle and continuous reactivity of pyrite, a pyrite/H2O2/hydroxylamine (HA) system was proposed to treat rhodamine B (RhB). The results showed that near-complete decolorization and 52.8% mineralization 50 mg L-1 RhB were achieved under its optimum conditions: HA 0.8 mM, H2O2 1.6 mM, pyrite 0.4 g L-1, and initial pH 4.0. The degradation reaction was dominated by an â¢OH radical produced by the reaction of Fe2+ with H2O2 in solution. HA primarily had two roles: in solution, HA could accelerate the Fe(II)/Fe(III) cycle through its strong reducibility to enhance RhB decolorization; on the pyrite surface, HA could improve the continuous reactivity of pyrite by inhibiting the oxidation of pyrite. In addition, the dosing manner of HA had a significant effect on RhB decolorization. In addition, the high decolorization and mineralization efficiency of other dye pollutants suggested that the pyrite/H2O2/HA system might be widely used in textile wastewater treatment.
Assuntos
Peróxido de Hidrogênio , Poluentes Químicos da Água , Compostos Férricos , Hidroxilamina , Hidroxilaminas , Ferro , Oxirredução , Rodaminas , Sulfetos , Poluentes Químicos da Água/análiseRESUMO
Herein, we reported a simple solvothermal and chemical oxidation method to synthesize a magnetic core-shell composite (Fe3O4@UiO-66@PANI) for Cr(VI) removal from wastewater. Due to the porosity and stability of UiO-66 and stability, high acid resistance, and multiple active (reducing and chelating) groups of polyaniline (PANI), Fe3O4@UiO-66@PANI exhibited excellent efficiency, regeneration, and reusability performance for Cr(VI) removal. Its maximum adsorption capacity and removal rate were 474.42 mg·g-1 and 99.90%, respectively. The effects of initial pH values, contact time, and initial Cr(VI) concentration on Cr(VI) removal were investigated. The fitted data showed that the adsorption process was consistent with the pseudo-second-order kinetic model and Langmuir isothermal model. The study of the mechanism shows that the excellent efficiency of Fe3O4@UiO-66@PANI is due to the electrostatic adsorption and reduction of Cr(VI) and the chelation of Cr3+. The results demonstrate that Fe3O4@UiO-66@PANI is a promising adsorbent for the Cr(VI) removal.
RESUMO
BACKGROUND The aim of this study was to provide the first on report on the mechanism and the different treatment measures of metacarpophalangeal joint hyperextension (MCPH) or metacarpophalangeal joint instability (MCPI) in cases of pediatric trigger thumb. Some pediatric trigger thumb patients have disease combined with excessive extension of metacarpophalangeal (MCP) joint or instability of MCP joint. MATERIAL AND METHODS A total of 1083 children with trigger thumb surgery were divided into 2 groups (the MCPH group and the MCPI group) by the extension degree of the MCP joint. After tendon sheath released, the MCPH group was treated by a cast and the MCPI group was treated by a cast and a brace. We compared the differences in baseline data and the further functional activities of interphalangeal (IP) and MCP joint between the 2 groups. RESULTS Among the 1083 cases, 154 cases (185 thumbs) were trigger thumb with MCPH or MCPI, of which 167 thumbs were placed in the MCPH group and 18 thumbs were placed in the MCPI group. The average age of the MCPH group was 2.8 years, with an average duration of disease of 13 months. The average age of the MCPI group was 6.6 years, with an average duration of disease of 33 months. MCPH still existed after cast removal. In the MCPI group, 12 out of 18 thumbs recovered; 6 thumbs relapsed at 2-4 months after brace removal. CONCLUSIONS Trigger thumb with MCPH and MCPI in children is significantly associated with multi-joint laxity. While there was still MCPH after cast treatment, there was no need for further treatment during the short-term follow-up. Cast and brace treatment after surgery was a simple, easy method for treatment of MCPI and had a good effect.
Assuntos
Instabilidade Articular/cirurgia , Articulação Metacarpofalângica/cirurgia , Amplitude de Movimento Articular/fisiologia , Polegar/cirurgia , Dedo em Gatilho/cirurgia , Braquetes , Moldes Cirúrgicos , Criança , Pré-Escolar , Feminino , Humanos , Instabilidade Articular/patologia , Instabilidade Articular/reabilitação , Masculino , Articulação Metacarpofalângica/inervação , Articulação Metacarpofalângica/patologia , Polegar/inervação , Polegar/patologia , Resultado do Tratamento , Dedo em Gatilho/patologiaRESUMO
Simple D-type plastic optical fiber (POF) probes (i.e., sensor, reference, and photochemical probes) were created to accurately monitor the progression and phenol degradation of a Chlorella vulgaris biofilm. The sensor and reference probes were used to monitor the biofilm growth (thickness). The sensor probe, which consisted of a D-shaped POF and Canada balsam doped with GeO2 (CBG) coating, was developed to monitor the biofilm growth and change in the liquid-phase composition and its concentration inside the biofilm. The reference probe, which comprised a D-shaped POF, CBG coating, and glass fiber membrane (to separate the liquids from Chlorella vulgaris), was used to measure the response to changes in the liquid phase. A model was developed to demonstrate the accurate measurement of the biofilm thickness. The photochemical POF probe was coupled with a high-permselectivity phenol polymer membrane to monitor the phenol concentration and analyze the degradation time of 50 mg/L phenol with microalgal biofilms. A fixed relationship was obtained between the biofilm sensor output information and biofilm thickness for a biofilm thickness range of 0-290 µm with a periodic supply of 50 mg/L phenol solution. The highest phenol degradation rate occurred at a biofilm thickness of 191-222 µm. The proposed system can be used to investigate microalgal biomass and can provide a promising avenue for research on renewable resources and pollutant degradation.
Assuntos
Biofilmes/crescimento & desenvolvimento , Tecnologia de Fibra Óptica , Microalgas/metabolismo , Fenol/metabolismo , Tecnologia de Fibra Óptica/instrumentação , Fenol/químicaRESUMO
PURPOSE: To investigate the use of anterior hip ultrasound (van Douveren's method)-assisted Pavlik harness in developmental dysplasia of the hip (DDH). METHODS: Weekly anterior hip ultrasound scanning was performed in children with fixed Pavlik harness to detect whether hip reduction was achieved with the help of harness (the superior ramus of the pubis, the acetabulum, the femoral head, and the femoral neck being depicted in one plane indicated concentric reduction of the hip), and the stability of the reduction was checked by ultrasonography. RESULTS: A total of 39 child patients and 51 dysplastic hips were successfully detected by anterior ultrasound, and stable reduction was achieved in 37 hips (15 Graf type D and 22 type III) right after the help of Pavlik harness, in seven hips (6 type III and 1 type IV) two weeks after the help of Pavlik harness; the remaining seven hips (2 type III and 5 type IV) failed to reach stable reduction after two weeks. CONCLUSION: The anterior hip ultrasound (van Douveren's method) can be used to detect the reduction and stability of hip after Pavlik harness treatment in children with DDH. The majority of Graf type D and III hips can achieve a stable concentric reduction right after the help of Pavlik harness, while severely dislocated type IV hips have a low success rate for harness treatment, and abandonment of harness therapy should be considered in early stage.
Assuntos
Braquetes , Luxação Congênita de Quadril/diagnóstico por imagem , Luxação Congênita de Quadril/terapia , Articulação do Quadril/diagnóstico por imagem , Acetábulo/diagnóstico por imagem , Fixadores Externos , Feminino , Cabeça do Fêmur/diagnóstico por imagem , Colo do Fêmur/diagnóstico por imagem , Luxação Congênita de Quadril/diagnóstico , Humanos , Lactente , Recém-Nascido , Masculino , Procedimentos Ortopédicos/instrumentação , Procedimentos Ortopédicos/métodos , Osso Púbico/diagnóstico por imagem , Estudos Retrospectivos , Resultado do Tratamento , UltrassonografiaRESUMO
PURPOSE: This study aims to investigate risk factors for refracture of the forearm in children treated with elastic stable intramedullary nailing (ESIN). METHODS: Clinical data of 267 patients who had been treated for forearm fractures by ESIN in our hospital from January 2010 to December 2014 were retrospectively reviewed. Risk factors for forearm refractures were determined using logistic regression analysis. RESULTS: Forearm refractures occurred in 11 children. Univariate analysis revealed that age, body weight, number of fractures, open fracture, nail diameter, and immobilization time were not associated with refractures. However, gender (male, P = 0.042) and fracture location (lower third, P = 0.007) were significantly associated with refractures. Multivariate analysis revealed that fracture location was an independent risk factor for forearm refractures (P = 0.031). CONCLUSION: Forearm refracture is uncommon in children treated with ESIN. Fracture location is an independent risk factor for forearm refractures in these patients.
Assuntos
Pinos Ortopédicos/efeitos adversos , Fixação Intramedular de Fraturas/efeitos adversos , Fraturas do Rádio/cirurgia , Fraturas da Ulna/cirurgia , Moldes Cirúrgicos , Criança , Pré-Escolar , Feminino , Traumatismos do Antebraço/diagnóstico por imagem , Traumatismos do Antebraço/cirurgia , Fixação Intramedular de Fraturas/instrumentação , Humanos , Masculino , Fraturas do Rádio/diagnóstico por imagem , Recidiva , Estudos Retrospectivos , Fatores de Risco , Fraturas da Ulna/diagnóstico por imagemRESUMO
BACKGROUND: Polydactyly is a group of congenital limb malformations that show high degree of phenotypic variability and genetic heterogeneity. RESULTS: In the present study, four genomic regions (exons of GLI3, SHH, and noncoding sequences of preZRS and ZRS) involved in hedgehog (Hh) signaling pathway were sequenced for 102 unrelated Chinese children with nonsyndromic polydactyly. Two GLI3 variants (c.2844 G > G/A; c.1486C > C/T) and four preZRS variants (chr7:156585336 A>G; chr7:156585421 C>A; chr7: 156585247 G>C; chr7:156585420 A > C) were observed in 2(2.0%) and 6(5.9%) patients, respectively. These variants are not over-represented in the Chinese healthy population. All the 8 cases showed preaxial polydactyly in hands. Additionally, no specific patterns of malformation predicted mutations in other candidate genes or sequences. CONCLUSIONS: This is the first report of the assessment of the frequency of GLI3/SHH/preZRS/ZRS in Chinese patients to show any higher possibility of mutations or variants for the 4 genes or sequences in China. Developmental Dynamics 246:392-402, 2017. © 2017 Wiley Periodicals, Inc.
Assuntos
Proteínas Hedgehog/genética , Fatores de Transcrição Kruppel-Like/genética , Proteínas de Membrana/genética , Proteínas do Tecido Nervoso/genética , Polidactilia/genética , Adolescente , Criança , Pré-Escolar , Feminino , Frequência do Gene , Testes Genéticos , Deformidades Congênitas da Mão/genética , Proteínas Hedgehog/metabolismo , Humanos , Masculino , Mutação , Polidactilia/epidemiologia , Análise de Sequência de DNA , Transdução de Sinais/genética , Proteína Gli3 com Dedos de ZincoRESUMO
Congenital contractural arachnodactyly (CCA) is an autosomal dominant disorder of connective tissue. CCA is characterized by arachnodactyly, camptodactyly, contrature of major joints, scoliosis, pectus deformities, and crumpled ears. The present study aimed to identify the genetic cause of a three-generation Chinese family with CCA. We successfully identified a novel missense mutation p.G1145D in the fibrillin-2 (FBN2) gene as the pathogenic mutation by whole exome sequencing (WES). The p.G1145D mutation occurs in the 12th calcium-binding epidermal growth factor-like (cbEGF) domain. The p.G1145D mutation caused a hydrophobic to hydrophilic substitution, altering the amino acid property from neutral to acidic. Three-dimensional structural analysis showed that this mutation could alter the conformation of the residue side chain, thereby producing steric clashes with spatially adjacent residues, disrupting the formation of H bonds and causing folding destabilization. Therefore, this amino acid appears to play an important role in the structure and function of FBN2. Our results may also provide new insights into the cause and diagnosis of CCA and may have implications for genetic counseling and clinical management.
Assuntos
Aracnodactilia/genética , Povo Asiático/genética , Contratura/genética , Fibrilina-2/genética , Mutação de Sentido Incorreto , Análise de Sequência de DNA/métodos , Adolescente , Adulto , Sítios de Ligação , Criança , China , Exoma , Feminino , Fibrilina-2/química , Humanos , Masculino , Linhagem , Dobramento de ProteínaRESUMO
Polydactyly is a clinically and genetically heterogeneous disorder. In the current report, we present a five-generation Chinese family with non-syndromic pre-axial polydactyly with thumb polydactyly (pre-axial polydactyly type I (PPD-I)) as a major clinical feature. Using whole-exome sequencing (WES), a novel nonsense mutation c.714T>A (p.Y238*) of the glioma-associated oncogene family zinc-finger 3 gene (GLI3) was identified as the pathogenic mutation for this family. Our study has, for the first time, suggested the possible contribution of GLI3 in the patheogenesis of PPD-I, and demonstrated that WES provided an applicable diagnostic tool for identifying mutations in disorders with highly genetical heterogeneity such as polydactyly.
Assuntos
Códon sem Sentido , Fatores de Transcrição Kruppel-Like/genética , Proteínas do Tecido Nervoso/genética , Polidactilia/diagnóstico , Polidactilia/genética , Polegar/anormalidades , China , Biologia Computacional/métodos , Análise Mutacional de DNA , Exoma , Feminino , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Masculino , Linhagem , Fenótipo , Proteína Gli3 com Dedos de ZincoRESUMO
PURPOSE: To report a modified reconstructive technique for Wassel type IV-D thumb duplication that preserves and transfers the flexor pollicis longus (FPL) from the removed radial portion. METHODS: We analyzed the hands of 16 patients (average age, 2 y) with Wassel IV-D thumb duplication. Patients were treated with ablation of the radial thumb and reconstruction of the ulnar thumb by a series of soft tissue procedures, including FPL rebalancing. The postoperative range of motion and the alignment at the metacarpophalangeal and interphalangeal joints of the affected thumbs were compared with the preoperative measurements. RESULTS: Of 16 cases, 14 were observed for an average of 29 months. Motion at the interphalangeal joint and alignment at metacarpophalangeal and interphalangeal joints showed improvement after surgery. According to the Japanese Society for Surgery of the Hand scoring system, the results were excellent in 2 cases, good in 11, and fair in 1. A disadvantage of this technique proved to be restricted interphalangeal joint motion with an extension lag that averaged 14°. CONCLUSIONS: The FPL rebalancing technique with soft tissue stabilization of the metacarpophalangeal and interphalangeal joints can establish dynamic rebalance of the bifurcated FPL tendon in Wassel IV-D duplicated thumb. It shows excellent results in alignment and joint stability. The long-term results are under evaluation. TYPE OF STUDY/LEVEL OF EVIDENCE: Therapeutic IV.
Assuntos
Músculo Esquelético/cirurgia , Procedimentos Ortopédicos/métodos , Complicações Pós-Operatórias/fisiopatologia , Amplitude de Movimento Articular/fisiologia , Polegar/anormalidades , Polegar/cirurgia , Pré-Escolar , Estética , Feminino , Articulações dos Dedos/fisiopatologia , Seguimentos , Humanos , Lactente , Masculino , Articulação Metacarpofalângica/fisiopatologia , Músculo Esquelético/fisiopatologia , Satisfação do Paciente , Força de Pinça/fisiologia , Polegar/fisiopatologiaRESUMO
The Zn/Fe@N-doped porous graphitic carbon catalyst (Zn/Fe@PCN) was successfully produced through one-step pyrolysis of g-C3N4 and Zn/Fe-MOF and was used for the activation of persulfate (PS) for the degradation of RhB. The Zn/Fe@PCN/PS system was able to degrade 95.92% of RhB in 30 min at a rate of 0.6453 min-1 when RhB was concentrated at 50 mg L-1. The efficient degradation of RhB is primarily realized through the synergistic activation of PS by Zn, Fe, and N to produce reactive oxygen species 1O2, [Formula: see text], [Formula: see text], and ·OH. Zn0/Fe0 in Zn/Fe@PCN forms a galvanic cell with carbon to release electrons to join in the activation of PS. The doping of Zn not only provides sufficient electrons for the activation of PS but also promotes the effective reduction of Fe2+ and thus the Fe2+/Fe3+ cycle. The N doping accelerates the electron transfer during the reaction progress.
Assuntos
Estruturas Metalorgânicas , Rodaminas , Nitrogênio , Carbono , ZincoRESUMO
Peroxymonosulfate (PMS), which is dominated by free radical (SO4â¢-) pathway, has a good removal effect on organic pollutants in complex water matrices. In this article, a new catalyst (CFM@NC) was synthesized by hydrothermal carbonization method with chitosan (CS) as N and C precursors, and used to activate PMS to degrade dye wastewater. CFM@NC/PMS system can degrade 50 mg·L-1 rhodamine B by 99.59 % within 30 min, and the degradation rate remains as high as 97.32 % after 5 cycles. It has good complex background matrices, acid-base anti-interference ability (pH 2.6-10.1), universality and reusability. It can degrade methyl orange and methylene blue by >98 % within 30 min. The high efficiency of the composite is due to the fact that CS-modified MoS2 as a carrier exposes a large number of active sites, which not only disperses CuFe2O4 nanoparticles and improves the stability of the catalyst, but also provides abundant electron rich groups, which promotes the activation of PMS and the production of reactive oxygen species (ROS). PMS is effectively activated by catalytic sites (Cu+/Cu2+, Fe2+/Fe3+, Mo4+/Mo6+, pyridine N, pyrrole N, edge sulfur and hydroxyl group) to produce a large number of radicals to attack RhB molecules, causing chromophore cleavage, ring opening, and mineralization. Among them, free radical SO4â¢- is the main ROS for RhB degradation. This work is expected to provide a new idea for the design and synthesis of environmentally friendly and efficient heterogeneous catalysts.
RESUMO
In this paper, La-doped Ti/SnO2-Sb2O4 electrode was prepared by electrodeposition and used for electrochemical degradation of rhodamine B. The optimum preparation conditions of the electrode were optimized as deposition time of 15 min and calcination at 500 â for 2 h. The water treatment conditions were selected as initial pH 3.0, electrolyte Na2SO4 concentration 0.1 M, current density 30 mA cm-2, and initial rhodamine B concentration 20 mg L-1; the color and TOC removal of RhB reached 99.78% and 82.41% within 30 min. The FESEM, XRD, XPS, CV, LSV, and EIS characterization studies demonstrated that Ti/SnO2-Sb2O4-1%La electrode had a dense structure and the highest oxygen evolution potential (2.14 V) and lowest charge transfer resistance (0.198 Ω cm-2), indicating that doped La has lower energy consumption. Moreover, La doping can expand the specific surface area, active site, performance of pollutant degradation, and service life of the electrode. Especially, the service life of Ti/SnO2-Sb2O4-1%La is increased by three times, and the maximum life span reaches 90 min (1000 mA cm-2, 1 M H2SO4). Free radical quenching experiments show that ·OH plays a major role in the degradation of RhB. The Ti/SnO2-Sb2O4-1%La electrode prepared in this paper and its results will provide data support and reference for the design of efficient electrocatalytic electrode.
Assuntos
Titânio , Titânio/química , Oxirredução , Rodaminas , EletrodosRESUMO
Peroxymonosulfate (PMS), which is dominated by non-free radical pathway, has a good removal effect on organic pollutants in complex water matrices. In this article, a biodegradable cobalt-based catalyst (Co3O4/MoS2@NCS) was synthesized by a simple hydrothermal method with chitosan (CS) as nitrogencarbon precursor and doped with Cobalticcobaltous oxide (Co3O4) and Molybdenum disulfide (MoS2), and was used to activate PMS to degrade dye wastewater. Electrochemical tests showed that Co3O4/MoS2@NCS exhibited higher current density and cycling area than MoS2@NCS and MoS2. In the Co3O4/MoS2@NCS/PMS system, the degradation rate of 30 mg·L-1 rhodamine B (RhB) reached 97.75 % within 5 min, and kept as high as 94.34 % after 5 cycles. Its rate constant was 1.91 and 8.37 times that of MoS2@NCS/PMS and MoS2/PMS, respectively. It had good complex background matrices and acid-base anti-interference ability, and had good universality and reusability. The degradation rate of methyl orange (MO) and methylene blue (MB) were more than 91 % within 5 min at pH 4.8. The experimental results demonstrated that MoS2-modified CS as a carrier exposed a large number of active sites, which not only dispersed Co3O4 nanoparticles and improved the stability of the catalyst, but also provided abundant electron rich groups, and promoted the activation of PMS and the production of reactive oxygen species (ROS). PMS was effectively activated by catalytic sites (Co3+/Co2+, Mo4+/Mo5+/Mo6+, CO, pyridine N, pyrrole N, hydroxyl group and unsaturated sulfur), producing a large number of radicals that attack RhB molecules, causing chromophore cleavage, ring opening, and mineralization. Among them, non-free radical 1O2 was the main ROS for RhB degradation. This work is expected to provide a new idea for the design and synthesis of environmentally friendly and efficient MoS2-modified cobalt-based catalysts.
Assuntos
Carbono , Quitosana , Óxidos , Peróxidos , Carbono/química , Espécies Reativas de Oxigênio/química , Molibdênio/química , Cobalto/químicaRESUMO
Microalgae biochar is potential adsorbents to remove heavy metals from wastewater due to abundant functional groups, high porosity and wide sources, but performance is not fully developed since it depends on microalgae species attributing to distinct morphology and biomass compositions. Here, two microalgae species Chlorella Pyrenoidosa and Scenedesmus Obliquus were used for biochar preparation via KOH-modification, biochar properties and their influences on Ni(II) adsorption were investigated. Ni(II) adsorption performances responding to biochar properties and operating conditions were upgraded via progressive optimization and response surface methodology. Together, adsorption isotherms and kinetics were analyzed to obtain significant factors for Ni(II) removal. As results, 100 % of Ni(II) removal was achieved under 100 mg/L initial Ni(II) concentration as pH was higher than the biochar zero-charge point of 6.87 with low biochar dosage (0.5 g/L), which provides an efficient approach for heavy metal removal from wastewater with microalgae biochar.
Assuntos
Chlorella , Metais Pesados , Microalgas , Poluentes Químicos da Água , Adsorção , Águas Residuárias , Carvão Vegetal/química , CinéticaRESUMO
A fuel cell that functioned as a photo fuel cell (PFC) when irradiated with UV light and as a dye self-photosensitization photo fuel cell (DSPFC) when irradiated with visible light was proposed and investigated in this study. The system included a BiOCl/Ti plate photoanode and a Pt cathode, and dye solutions were employed as fuel. Electricity was generated at the same time as the dyes were degraded. 26.2% and 24.4% Coulombic efficiency were obtained when 20 mL of 10 mg · L(-1) Rhodamine B solution was treated with UV for 2 h and visible light for 3 h, respectively. Irradiation with natural and artificial sunlight was also evaluated. UV and visible light could be utilized at the same time and the photogenerated current was observed. The mechanism of electricity generation in BiOCl/Ti PFC and DSPFC was studied through degradation of the colorless salicylic acid solution. Factors that affect the electricity generation and dye degradation performance, such as solution pH and cathode material, were also investigated and optimized.