Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 22
Filtrar
1.
Genomics ; 116(2): 110784, 2024 03.
Artigo em Inglês | MEDLINE | ID: mdl-38199265

RESUMO

Bacterial wilt (BW) caused by Ralstonia solanacearum is a globally prevalent bacterial soil-borne disease. In this study, transcriptome sequencing were subjected to roots after infection with the R. solanacearum in the resistant and susceptible tobacco variety. DEGs that responded to R. solanacearum infection in both resistant and susceptible tobacco contributed to pectinase and peroxidase development and were enriched in plant hormone signal transduction, signal transduction and MAPK signalling pathway KEGG terms. Core DEGs in the resistant tobacco response to R. solanacearum infection were enriched in cell wall, membrane, abscisic acid and ethylene terms. qRT-PCR indicated that Nitab4.5_0004899g0110, Nitab4.5_0004234g0080 and Nitab4.5_0001439g0050 contributed to the response to R. solanacearum infection in different resistant and susceptible tobacco. Silencing the p450 gene Nitab4.5_0001439g0050 reduced tobacco resistance to bacterial wilt. These results improve our understanding of the molecular mechanism of BW resistance in tobacco and solanaceous plants.


Assuntos
Ralstonia solanacearum , Ralstonia solanacearum/genética , Perfilação da Expressão Gênica , Reguladores de Crescimento de Plantas/farmacologia , Ácido Abscísico , Nicotiana/genética , Inativação Gênica , Resistência à Doença/genética
2.
J Hum Genet ; 69(5): 197-203, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38374166

RESUMO

CAPZA2 encodes the α2 subunit of CAPZA, which is vital for actin polymerization and depolymerization in humans. However, understanding of diseases associated with CAPZA2 remains limited. To date, only three cases have been documented with neurodevelopmental abnormalities such as delayed motor development, speech delay, intellectual disability, hypotonia, and a history of seizures. In this study, we document a patient who exhibited seizures, mild intellectual disability, and impaired motor development yet did not demonstrate speech delay or hypotonia. The patient also suffered from recurrent instances of respiratory infections, gastrointestinal and allergic diseases. A novel de novo splicing variant c.219+1 G > A was detected in the CAPZA2 gene through whole-exome sequencing. This variant led to exon 4 skipping in mRNA splicing, confirmed by RT-PCR and Sanger sequencing. To our knowledge, this is the third study on human CAPZA2 defects, documenting the fourth unambiguously diagnosed case. Furthermore, this splicing mutation type is reported here for the first time. Our research offers additional support for the existence of a CAPZA2-related non-syndromic neurodevelopmental disorder. Our findings augment our understanding of the phenotypic range associated with CAPZA2 deficiency and enrich the knowledge of the mutational spectrum of the CAPZA2 gene.


Assuntos
Proteína de Capeamento de Actina CapZ , Deficiências do Desenvolvimento , Epilepsia , Heterozigoto , Hipotonia Muscular , Mutação , Pré-Escolar , Feminino , Humanos , Masculino , Deficiências do Desenvolvimento/genética , Deficiências do Desenvolvimento/patologia , Epilepsia/genética , Sequenciamento do Exoma , Deficiência Intelectual/genética , Deficiência Intelectual/patologia , Hipotonia Muscular/genética , Hipotonia Muscular/patologia , Fenótipo , Splicing de RNA/genética , Proteína de Capeamento de Actina CapZ/genética
3.
Plant Dis ; 2023 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-36856647

RESUMO

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar:TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1,MZ555753.1, U42342.1)were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

4.
Molecules ; 27(19)2022 Oct 10.
Artigo em Inglês | MEDLINE | ID: mdl-36235287

RESUMO

Diisocyanates are highly reactive compounds with two functional isocyanate groups. The exposure of diisocyanates is associated with severely adverse health effects, such as asthma, inflammation in the respiratory tract, and cancer. The hydrolysis product from diisocyanates to related diamines is also a potential carcinogen. Here, we developed an effective, accurate, and precise method for simultaneous determination of residual diisocyanates and related diamines in biodegradable mulch films, based on N-ethoxycarbonylation derivatization and gas chromatography-mass spectrometry. The method development included the optimization of ultrasonic hydrolysis and extraction, screening of N-ethoxycarbonylation conditions with ethyl chloroformate, evaluation of the diamines degradation, and analysis of the fragmentation mechanisms. Under the optimum experimental conditions, good linearity was observed with R2 > 0.999. The extraction recoveries were found in the range of 93.9−101.2% with repeatabilities and reproducibilities in 0.89−8.12% and 2.12−10.56%, respectively. The limits of detection ranged from 0.0025 to 0.057 µg/mL. The developed method was applied to commercial polybutylene adipate co-terephthalate (PBAT) biodegradable mulch film samples for analysis of the diverse residual diisocyanates and related diamine additives. The components varied greatly among the sample from different origin. Overall, this study provides a reliable method for assessing safety in biodegradable mulch films.


Assuntos
Diaminas , Isocianatos , Carcinógenos , Cromatografia Gasosa-Espectrometria de Massas
5.
Genomics ; 112(2): 1404-1418, 2020 03.
Artigo em Inglês | MEDLINE | ID: mdl-31430516

RESUMO

Plant respiratory burst oxidase homolog (Rboh) gene family encodes the key enzymatic subunits of reactive oxygen species (ROS) production pathways, and play crucial role in plant signaling, development and stress responses. In present work, twenty genes were identified in Nicotiana tabacum Rboh family (NtabRboh) and classified into four phylogenetic groups (I-IV). Fourteen NtabRboh genes were positioned on ten chromosomes (i.e., Ch1, 2, 4, 7-11, 14 and 21), and six scaffolds. Synteny and evolutionary analysis showed that most of the NtabRboh genes have evolved from the genomes of the ancestor species (N. tomentosiformis and N. sylvestris), which afterwards expanded through duplication events. The promoter regions of the NtabRboh genes contained numerous cis-acting regulatory elements for hormones, plant growth, and different biotic and abiotic factors. The NtabRbohF gene transcript comprised target sites for wounding and stress responsive microRNAs: nta-miR166a-d, g and h. The transcript abundance of NtabRboh genes in different tissues reflected their important for plant growth and organ development in tobacco. RT-qPCR-assays demonstrated that the expression of NtabRboh genes are regulated by viral and bacterial pathogens, drought, cold and cadmium stress. The expression levels NtabRbohA, B and C were significantly up-regulated in "black shank and tobacco mosaic virus-inoculated susceptible and transgenic tobacco cultivars, showing that these genes play important roles in disease resistance.


Assuntos
Resistência à Doença , Evolução Molecular , NADPH Oxidases/genética , Nicotiana/genética , Proteínas de Plantas/genética , Estresse Fisiológico , Regulação da Expressão Gênica de Plantas , NADPH Oxidases/metabolismo , Proteínas de Plantas/metabolismo , Elementos de Resposta , Nicotiana/metabolismo
6.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 37(2): 150-152, 2020 Feb 10.
Artigo em Zh | MEDLINE | ID: mdl-32034742

RESUMO

OBJECTIVE: To identify pathological mutation of D4Z4 in a child with facioscapulohumeral muscular dystrophy (FSHD) presented initially as mental retardation. METHODS: Wechsler Intelligence Scale for Children Revised in China (WISC-IV) was used to assess the patient's IQ. Other clinical data was also collected. With genomic DNA extracted from peripheral blood samples, the child and his parents were subjected to medical exome sequencing and copy number variation analysis by next generation sequencing (NGS). The D4Z4 repeats and their origin source were determined by molecular combing. RESULTS: By the WISC-IV test, the child was found to have a total IQ of 41, with a speech comprehension IQ of 45, and perceptual inference index IQ of 52. No pathological mutation was detected by NGS. By molecular combing method, the child was found to carry a D4Z4 spanning 5.2 kb with a copy number of 2. Analysis of his parents indicate that the mutation was de novo. CONCLUSION: The D4Z4 copy number variation may account for the FSHD and mental retardation in the child. The molecular combing method can be used to identify the number of repeat units and facilitate the diagnosis of FSHD.


Assuntos
Deficiência Intelectual , Distrofia Muscular Facioescapuloumeral , Criança , China , Cromossomos Humanos Par 4 , Variações do Número de Cópias de DNA , Humanos , Deficiência Intelectual/genética , Distrofia Muscular Facioescapuloumeral/genética , Mutação
7.
Regul Toxicol Pharmacol ; 103: 181-188, 2019 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-30710578

RESUMO

[Introduction] Seven smoke constituents, including hydrogen cyanide (HCN), ammonia (NH3), phenol, benzo[α]pyrene (B[a]P), carbon monoxide (CO)¸ crotonaldehyde, and 4-(methylnitrosamino)-1- (3-pyridyl)-1-butanone (NNK), are proposed be the most relevant constituents for smoking-related diseases. [Methods] Different combinations of leaf stalk positions, varieties and locations were used to create variable chemistry of cigarette filler and smoke. Experimental cigarettes were measured for emission level of seven smoke toxicants and content of seventy-three filler components. [Results] The ranges of coefficient of variation (CV) for seven smoke toxicants were 15.43%-43.15%. The emission pattern of NNK and crotonaldehyde were different from that of other five smoke toxicants. Most of the seven smoke toxicants were influenced in following order: stalk position > location > variety. The leaf constitutes closely correlated with seven smoke toxicants were analyzed. [Conclusions] The results showed that seven toxicants were significantly influenced by leaf position and location, and closely correlated with leaf components, such as potassium, malate and alkaloid contents. The results provide useful and comprehensive information on the affecting factors and correlating leaf constituents for the variations of seven smoke toxicants.


Assuntos
Substâncias Perigosas/análise , Nicotiana/química , Folhas de Planta/química , Fumaça/análise , Produtos do Tabaco/análise , Substâncias Perigosas/química
9.
Mater Today Bio ; 23: 100859, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-38033368

RESUMO

Background: Reducing Ca2+ content in the sarcoplasmic reticulum (SR) through ryanodine receptors (RyRs) by calcin is a potential intervention strategy for the SR Ca2+ overload triggered by ß-adrenergic stress in acute heart diseases. Methods: OpiCal-PEG-PLGA nanomicelles were prepared by thin film dispersion, of which the antagonistic effects were observed using an acute heart failure model induced by epinephrine and caffeine in mice. In addition, cardiac targeting, self-stability as well as biotoxicity were determined. Results: The synthesized OpiCa1-PEG-PLGA nanomicelles were elliptical with a particle size of 72.26 nm, a PDI value of 0.3, and a molecular weight of 10.39 kDa. The nanomicelles showed a significant antagonistic effect with 100 % survival rate to the death induced by epinephrine and caffeine, which was supported by echocardiography with significantly recovered heart rate, ejection fraction and left ventricular fractional shortening rate. The FITC labeled nanomicelles had a strong membrance penetrating capacity within 2 h and cardiac targeting within 12 h that was further confirmed by immunohistochemistry with a self-prepared OpiCa1 polyclonal antibody. Meanwhile, the nanomicelles can keep better stability and dispersibility in vitro at 4 °C rather than 20 °C or 37 °C, while maintain a low but stable plasma OpiCa1 concentration in vivo within 72 h. Finally, no obvious biotoxicities were observed by CCK-8, flow cytometry, H&E staining and blood biochemical examinations. Conclusion: Our study also provide a novel nanodelivery pathway for targeting RyRs and antagonizing the SR Ca2+ disordered heart diseases by actively releasing SR Ca2+ through RyRs with calcin.

10.
Front Microbiol ; 13: 807057, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35222332

RESUMO

The root-knot nematode (RKN) is an important pathogen that affects the growth of many crops. Exploring the interaction of biocontrol bacteria-pathogens-host root microbes is the theoretical basis for improving colonization and controlling the effect of biocontrol bacteria in the rhizosphere. Therefore, 16S and 18S rRNA sequencing technology was used to explore the microbial composition and diversity of tobacco roots (rhizosphere and endophytic) at different growth stages in typical tobacco RKN-infected areas for 2 consecutive years. We observed that RKN infection changed the α-diversity and microbial composition of root microorganisms and drove the transformation of microorganisms from bacteria to fungi. The abundance of Sphingomonas decreased significantly from 18% to less than 3%, while the abundance of Rhizobiaceae increased from 4 to 15% at the early growth stage during the first planting year, and it promoted the proliferation of Chryseobacterium at the late growth stage in rhizosphere microorganisms with the highest abundance of 17%. The overall trend of rhizosphere microorganisms changed in the early growth stage with increasing growth time. The specific results were as follows: (1) Rhizobiaceae and Chryseobacterium increased rapidly after 75 days, became the main abundant bacteria in the rhizosphere microorganisms. (2) The dominant flora in fungi were Fusarium and Setophoma. (3) Comparing the root microbes in 2017 and 2018, RKN infection significantly promoted the proliferation of Pseudomonas and Setophoma in both the rhizosphere and endophytes during the second year of continuous tobacco planting, increasing the relative abundance of Pseudomonas from 2 to 25%. Pseudomonas was determined to play an important role in plant pest control. Finally, a total of 32 strains of growth-promoting bacteria were screened from tobacco rhizosphere bacteria infected with RKN through a combination of 16S rRNA sequencing and life-promoting tests. The results of this research are helpful for analyzing the relationship between RKNs and bacteria in plants, providing reference data for elucidating the pathogenesis of RKNs and new ideas for the biological control of RKNs. GRAPHICAL ABSTRACT.

11.
Front Plant Sci ; 13: 1023837, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36186049

RESUMO

Root-associated compartments, including the rhizosphere, rhizoplane, and endosphere, live with diverse microbial communities which profoundly affect plant growth and health. However, a systematic understanding of the microbiome assembly across the rhizosphere, rhizoplane, and endosphere under pathogen invasion remains elusive. Using 16S high-throughput sequencing, we studied how bacterial wilt disease affected the variation and assembly of the three continuous root-associated microbiomes of tobacco. The results indicated that microorganisms were gradually filtered from the rhizosphere to the endosphere. With the pathogen invasion, the rhizosphere, rhizoplane and endosphere microbiomes selected and recruited different beneficial bacterial taxa. Some recruited bacteria were also identified as keystone members in networks (i.e., Bosea in the endosphere). The microbiomes of endosphere and rhizoplane were more sensitive to plant disease than the rhizosphere microbiome. Still, response strategies of the rhizoplane and endosphere to disease were obviously different. Microbial networks of the rhizoplane became complex in diseased samples and genes involved in sporulation formation and cell cycle were enriched. However, microbial networks of the diseased endosphere were disrupted, and functional genes related to nitrogen utilization and chemotaxis were significantly increased, indicating the importance of nitrogen resources supply of plants for the endosphere microbiome under pathogen invasion. Our results provide novel insights for understanding the different responses of the root-associated microbiomes to plant disease.

12.
Funct Plant Biol ; 49(10): 887-897, 2022 09.
Artigo em Inglês | MEDLINE | ID: mdl-35798353

RESUMO

We investigated potassium (K) accumulation characteristics and expression of K metabolism related genes in one high-K variety (ND202) and a common variety (NC89) of tobacco (Nicotiana tabacum L.). Results showed that K accumulation and leaf K content in ND202 were higher than those in NC89. The distribution rate and K accumulation in the leaves of ND202 increased significantly, while the distribution rate in the roots and stems had lower values. In addition, the maximum K accumulation rate and high-speed K accumulation duration in ND202 were found to be better than those in NC89. The expression of NKT1 in the upper and middle leaves of ND202 had an advantage, and the relative expression of NtKC1 and NtTPK1 in both the upper and middle leaves, as well as the roots, was also significantly upregulated. Conversely, the expression of NTRK1 in the lower leaves and roots of ND202 was weaker. ND202 had significantly greater expression levels of NtHAK1 than NC89 in the upper and middle leaves and roots; moreover, the expression of NtKT12 in the upper leaves and roots of ND202 was also higher. In comparison with common varieties, high-K varieties had a stronger ability to absorb and accumulate K. They also possessed higher expression of K+ channel- and transporter-related genes and showed a superior K accumulation rate and longer duration of high-speed K accumulation. Furthermore, K accumulation rate at 40-60days can be suggested as an important reference for the selection of high-K tobacco varieties.


Assuntos
Nicotiana , Potássio , Folhas de Planta/genética , Raízes de Plantas/genética , Potássio/metabolismo , Nicotiana/genética
13.
Front Plant Sci ; 13: 1003534, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36212279

RESUMO

Nutritional correlations between plants and pathogens can crucially affect disease severity. As an essential macronutrient, the availability of nitrogen (N) and the types of N content play a fundamental part not only in energy metabolism and protein synthesis but also in pathogenesis. However, a direct connection has not yet been established between differences in the level of resistance and N metabolism. Pertinently, former studies hold ammonia (NH3) accountable for the development of diseases in tobacco (Nicotiana tabacum L.) and in some post-harvest fruits. With a purpose of pinpointing the function of NH3 volatilization on Alternaria alternata (Fries) Keissl pathogenesis and its correlation with both N metabolism and resistance differences to Alternaria alternata infection in tobacco, leaf tissue of two tobacco cultivars with susceptibility (Changbohuang; CBH), or resistance (Jingyehuang; JYH) were analyzed apropos of ammonia compensation point, apoplastic NH4 + concentration, pH value as well as activities of key enzymes and N status. At the leaf age of 40 to 60 d, the susceptible cultivar had a significantly higher foliar apoplastic ammonium (NH4 +) concentration, pH value and NH3 volatilization potential compared to the resistant one accompanied by a significant reduction in glutamine synthetase (GS), which in particular was a primary factor causing the NH3 volatilization. The NH4 + concentration in CBH was 1.44 times higher than that in JYH, and CBH had NH3 compensation points that were 7.09, 6.15 and 4.35-fold higher than those of JYH at 40, 50 and 60 d, respectively. Moreover, the glutamate dehydrogenase (GDH) activity had an upward tendency related to an increased NH4 + accumulation in both leaf tissues and apoplast but not with the NH3 compensation point. Collectively, our results strongly suggest that the accumulation of NH3 volatilization, rather than NH4 + and total N, was the primary factor inducing the Alternaria alternata infection in tobacco. Meanwhile, the susceptible cultivar was characterized by a higher N re-transfer ability of NH3 volatilization, in contrast to the disease-resistant cultivar, and had a stronger capability of N assimilation and reutilization. This study provides a deeper understanding of the pathogenicity mechanism induced by Alternaria alternata, which is useful for breeding Alternaria alternata-resistant varieties of tobacco, at the same time, our research is also conducive to control tobacco brown spot caused by Alternaria alternata in the field.

14.
Front Plant Sci ; 13: 971400, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36212334

RESUMO

Long non-coding RNAs (lncRNAs) regulate many biological processes in plants, including defense against pathogens and herbivores. Recently, many small ORFs embedded in lncRNAs have been identified to encode biologically functional peptides (small ORF-encoded peptides [SEPs]) in many species. However, it is unknown whether lncRNAs mediate defense against herbivore attack and whether there are novel functional SEPs for these lncRNAs. By sequencing Spodoptera litura-treated leaves at six time-points in Nicotiana tabacum, 22,436 lncRNAs were identified, of which 787 were differentially expressed. Using a comprehensive mass spectrometry (MS) pipeline, 302 novel SEPs derived from 115 tobacco lncRNAs were identified. Moreover, 61 SEPs showed differential expression after S. litura attack. Importantly, several of these peptides were characterized through 3D structure prediction, subcellular localization validation by laser confocal microscopy, and western blotting. Subsequent bioinformatic analysis revealed some specific chemical and physical properties of these novel SEPs, which probably represent the largest number of SEPs identified in plants to date. Our study not only identifies potential lncRNA regulators of plant response to herbivore attack but also serves as a valuable resource for the functional characterization of SEP-encoding lncRNAs.

15.
Beijing Da Xue Xue Bao Yi Xue Ban ; 43(3): 455-9, 2011 Jun 18.
Artigo em Zh | MEDLINE | ID: mdl-21681282

RESUMO

OBJECTIVE: To investigate and analyze the clinical manifestations, classification, therapeutic approaches and follow-up of myasthenia gravis (MG) in children in order to improve its management and prognosis. METHODS: Clinical information of 135 children with MG, who were diagnosed between January 1993 to January 2008, were collected and retrospectively analyzed. And prospective following-up of these patients were conducted. RESULTS: Among the 135 cases, 59 were males and 76 females, giving the ratio of M/F around 1:1.3. Totally, 115 cases (85.2%) were type I MG (ocular type), of which only 4.2% developed to generalized type during the subsequent clinical course. Type II MG (generalized type)was found in 18 cases (13.4%) and type III MG in two cases(1.5%). The onset age ranged from 5 month to 15 years, with 50.3% before three years and 80.7% before seven years. Upper respiratory tract infection was presented in 26.7% (36/135) of the sick children before the onset of MG. Among the 106 children being followed up, recurrence of the disease identified in 50.9% and the number of relapse ranged from 1 to 9. Altogether, 40.19% (43/106) of the cases were positive for anti-acetylcholine receptor antibodies (AchR-Ab) on the initial examination, and the AchR-Ab postitive rate showed no difference among different clinical subtypes and states. However, during the follow-up, 53% (9/17) of the recurrent cases, who were negative at the first onset, turned to be positive, and 37.97% (30/79) were positive for repetitive nerve stimulation in electromyogram test. There were 71 % (45/63) of all the cases showed reduced levels of CD4+ and/or CD3+ and/or CD8+. Thymus proliferation was found in 5.93% (8/135) through CT scan and thymoma in 1.48% (2/135). Steroids and anti-cholinesterase administration were effective in most cases with good prognosis. CONCLUSION: Childhood MG, mainly type I, is relatively common in China, with specific characteristics which are different from western patients or adult MG in morbidity, sex distribution, progress, laboratory examination and treatment. The prevalence of myasthenia gravis crisis and mortality rate in MG children is low, and few are accompanied with thymoma. Most MG cases have a satisfied prognosis and few have neuropsychic sequela.


Assuntos
Anticorpos/sangue , Miastenia Gravis/tratamento farmacológico , Neostigmina/uso terapêutico , Prednisona/uso terapêutico , Receptores Colinérgicos/imunologia , Adolescente , Idade de Início , Criança , Pré-Escolar , Feminino , Seguimentos , Humanos , Lactente , Masculino , Miastenia Gravis/sangue , Prognóstico , Recidiva , Estudos Retrospectivos
16.
Funct Plant Biol ; 47(4): 318-326, 2020 03.
Artigo em Inglês | MEDLINE | ID: mdl-32054564

RESUMO

Organic acids secreted from the roots of plants play important roles in nutrient acquisition and metal detoxification; however, the precise underlying mechanisms of these processes remain poorly understood. In the present study we examined the content of organic acids exuded from roots and the effects of these organic acids on the activation of slowly available potassium (K) at different K levels, including normal K supply and K-deficient conditions. In addition, the study system also comprised a high-K tobacco variety (ND202) and two common ones (K326 and NC89). Our results showed that high-K varieties exhibited significantly higher contents of organic acids in its root exudates and available K in both rhizosphere and non-rhizosphere soils than the other varieties. This research also suggested that a cyclic process in which soil was acidified after being complexed by organic acids was involved in the release of slowly available K, and that this process primarily depended on the soil pH at high organic acids concentrations, but the complexation of organic ligands became dominant at low concentrations. In conclusion, tobacco roots secrete organic acids to increase available K content and improve the utilisation rate of soil K. High-K varieties probably enhance slowly available K activation by secreting relatively high amounts of organic acids, thus leading to more available K in soil for absorption by plants.


Assuntos
Nicotiana , Solo , Raízes de Plantas , Potássio , Rizosfera
17.
Exp Ther Med ; 9(4): 1363-1368, 2015 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-25780436

RESUMO

This study aimed to analyze the clinical characteristics, classification and treatment of childhood myasthenia gravis (MG) and address the prognosis through follow-up. The clinical data of 135 children with MG were grouped according to clinical type and therapeutic drugs, retrospectively analyzed and prospectively monitored. Of the 135 MG patients, 85.2% had type I (ocular type), with only 4.2% progressing to systemic MG; 13.4% had type II (general type); and 1.5% had type III (fulminating type). Relapse occurred in 46.1% of the 102 patients that were followed up. The positive rate for the primary acetylcholine receptor antibody was 40.19%, without significant differences among clinical subtypes. The positive rate of the repetitive nerve stimulation frequency test by electromyography was 37.97%. Decreased expression of CD4+, CD8+, or CD3+ was present in 71% of the patients. Thymic hyperplasia was present in 5.93% of the patients, while 1.48% had thymoma. Steroid treatment was effective in the majority of the patients. Ocular type MG was common in this cohort of patients. The incidence and mortality of myasthenia crisis were low, the presence of concurrent thymoma was rare and only a limited number of children developed neurological sequelae.

18.
Gene ; 501(1): 24-32, 2012 Jun 10.
Artigo em Inglês | MEDLINE | ID: mdl-22575711

RESUMO

Tobacco is one of the most important economic and agricultural crops worldwide. miRNAs have been increasingly acknowledged for their important roles in different biological processes of tobacco. However, few miRNAs have been identified so far in tobacco impeding the development of new tobacco strains with better properties. In this study, high-throughput sequencing technology was employed to identify novel tobacco miRNAs. A total of 84 potential miRNAs were obtained in tobacco, including 33 conserved and 51 novel miRNAs. Tissue-specific and topping-related miRNAs were identified. A tobacco miRNA microarray was also constructed to investigate miRNA expression patterns in different tissues, and their expression patterns were further validated by qRT-PCR and Northern Blot. Finally, the potential targets of these miRNAs were predicted based on a sequence homology search. Thus, in the current study, we have performed the comprehensive analysis of tobacco miRNAs, including their identification, expression pattern and target prediction. Our study opens a new avenue for further elucidation for their roles underlying the regulation of diversity of physiological processes.


Assuntos
Sequenciamento de Nucleotídeos em Larga Escala , MicroRNAs/genética , Nicotiana/genética , Análise de Sequência com Séries de Oligonucleotídeos , Northern Blotting , Reação em Cadeia da Polimerase em Tempo Real
19.
Nan Fang Yi Ke Da Xue Xue Bao ; 32(6): 772-7, 2012 Jun.
Artigo em Zh | MEDLINE | ID: mdl-22699052

RESUMO

OBJECTIVE: To develop a hydroponic Nicotiana cultivation system for rapid and high-yield transient expression of recombinant proteins under laboratory conditions. METHODS: To establish the hydroponic cultivation system, several parameters were examined to define the optimal conditions for the expression of recombinant proteins in plants. We used the green fluorescent protein (GFP) and the geminiviral plant transient expression vector as the model protein/expression vector. We examined the impact of Nicotiana species, the density and time of Agrobacterium infiltration, and the post-infiltration growth period on the accumulation of GFP. The expression levels of GFP in Nicotiana leaves were then examined by Western blotting and ELISA. RESULTS: Our data indicated that a hydroponic Nicotiana cultivation system with a light intensity of 9000 LX/layer, a light cycle of 16 h day/8 h night, a temperature regime of 28 degrees celsius; day/21 degrees celsius; night, and a relative humidity of 80% could support the optimal plant growth and protein expression. After agroinfiltration with pBYGFPDsRed.R/LBA4404, high levels of GFP expression were observed in both N. benthamiana and N. tobaccum (cv. Yuyan No.5) plants cultured with this hydroponic cultivation system. An optimal GFP expression was achieved in both Nicotiana species leaves 4 days after infiltration by Agrobacterium with an OD(600) of 0.8. At a given time point, the average biomass of N. tobaccum (cv. Yuyan No.5) was significantly higher than that of N. benthamiana. The leaves from 6-week-old N. benthamiana plants and 5-week-old N. tobaccum (cv. Yuyan No.5) plants could be the optimal material for agroinfiltration. CONCLUSION: We have established a hydroponic cultivation system that allows robust growth of N. benthamiana and N. tobaccum (cv. Yuyan No.5) plants and the optimal GFP expression in the artificial climate box.


Assuntos
Hidroponia/métodos , Nicotiana/genética , Proteínas Recombinantes/biossíntese , Regulação da Expressão Gênica de Plantas , Vetores Genéticos , Proteínas de Fluorescência Verde/biossíntese , Proteínas de Fluorescência Verde/genética , Plantas Geneticamente Modificadas/genética , Proteínas Recombinantes/genética , Nicotiana/crescimento & desenvolvimento
20.
Ying Yong Sheng Tai Xue Bao ; 22(6): 1450-6, 2011 Jun.
Artigo em Zh | MEDLINE | ID: mdl-21941744

RESUMO

By the method of field in situ culture and 15N isotopic tracer technique, and taking flue-cured tobacco (Nicotiana tobacum) cultivar K326 as test material, a field experiment was conducted in the Nanxiong tobacco-planting area of Guangdong Province to study the characteristics of soil nitrogen (N) mineralization, the patterns of N accumulation and allocation in tobacco plants, and the allocation of plant-absorbed fertilizer N applied in current growth season. In the study area, the amount of soil mineralized N increased with tobacco growth, peaked at 75 days after transplanting, and decreased thereafter. The soil mineralized N at each tobacco growth stage was significantly higher in the control than in the N fertilization treatment. The N accumulation in tobacco plant organs was in the order of leaf > stalk > root. Tobacco plants mainly absorbed fertilizer N at rosette stage and topping stage, and mainly absorbed soil N at mature stage. The absorbed N in tobacco whole growth period was mainly derived from soil N, and the absorbed soil N and its proportion to the total absorbed N increased evidently with extending growth stage and ascending leaf position. The fertilizer N use efficiency per plant and the residual rate and loss rate of applied fertilizer N were 30. 8%, 32. 3% , and 36. 9% , respectively. In the study area, soil N mineralization rate was relatively high, and soil N had greater effects on the quality of upper tobacco leaves. Under the application rate of 150 kg N x hm(-2), the residual amount and loss amount of applied fertilizer N were relatively high.


Assuntos
Ecossistema , Nicotiana/metabolismo , Nitrogênio/metabolismo , Solo/análise , Absorção , China , Fertilizantes , Nitrogênio/análise , Nicotiana/crescimento & desenvolvimento
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA