Reconstitution of Natural Killer cells after allogeneic hematopoietic stem cell transplantation is facilitated by Huiyang-Guben decoction through activating the Smad7/Stat3 signal pathway.

Natural Killer (NK) cell is the first batch of re-constructed cell populations after allogeneic hematopoietic stem cell transplantation (allo-HSCT), and its delayed reconstitution inevitably causes poor outcome. The traditional Chinese medicine Huiyang-Guben decoction (HYGB) has been clinically used in patients undergoing allo-HSCT, but its effect on NK cell reconstruction is still unclear. 40 patients with allo-HSCT therapy were randomly divided into the control group and the HYGB group, and were given oral administration of normal saline or HYGB for 4 weeks before allo-HSCT, respectively. NK cells were cultured and treated with transforming growth factor ß (TGF-ß) and HYGB in vitro, and cell viability, cell apoptosis, and the function of NK cells were evaluated. Functional verification experiments were performed by knocking down signal transduction molecule 7 (Smad7) in NK cells before TGF-ß and HYGB treatment. Clinical data suggested that HYGB intervention decreased the incidence of acute graft-versus-host disease after allo-HSCT, and increased the proportion of NK cell population. Meanwhile, HYGB improved cell viability, restrained apoptotic cell death, and enhanced cell killing activity of NK cells in patients with allo-HSCT. Notably, we found that HYGB significantly increased the expression level of Smad7 and the phosphorylation level of signal transducer and activator of transcription 3 (Stat3) in NK cells from patients with allo-HSCT. Moreover, HYGB alleviated TGF-ß-induced NK cell impairment and re-activated the Smad7/Stat3 signaling in vitro, while silencing Smad7 reversed the protective effect of HYGB on TGF-ß-treated NK cells. HYGB promotes NK cell reconstruction and improves NK cell function after allo-HSCT through activating the Smad7/Stat3 signaling pathway.

OsTUB1 confers salt insensitivity by interacting with Kinesin13A to stabilize microtubules and ion transporters in rice.

Salt stress is one of the major environmental factors limiting plant growth and development. Although microtubule (MT) organization is known to be involved in response to salt stress, few tubulin genes have been identified that confer salt insensitivity in plants. In this study, we identified a MT encoding gene, OsTUB1, that increased the survival rate of rice plants under salt stress by stabilizing MT organization and ion transporters. We found that OsTUB1 interacted with Kinesin13A protein, which was essential for OsTUB1-regulated MT organization under salt stress. Further molecular evidence revealed that a OsTUB1-Kinesin13A complex protected rice from salt stress by sustaining membrane-localized Na+ transporter OsHKT1;5, a key regulator of ionic homeostasis. Our results shed light on the function of tubulin and kinesin in regulating MT organization and stabilizing Na+ transporters and Na+ flux at the plasma membrane in rice. The identification of the OsTUB1-Kinesin13A complex provides novel genes for salt insensitivity rice breeding in areas with high soil salinity.

Dysregulation of LINC00470 and METTL3 promotes chemoresistance and suppresses autophagy of chronic myelocytic leukaemia cells.

Cytoplasmic lncRNAs have been found to directly interact with target mRNAs and regulate their stability. In this study, we aimed to study the molecular mechanism underlying the function of m6 A as a central regulator in chemoresistance and CML proliferation. In this study, we established three mice groups (control group, ADR-R group and ADR-R + shLINC00470 group). We detected PTEN mRNA expression in the presence of LINC00470 in the mice models, as well as in the KCL22 and K562 cells. LINC00470 was significantly enriched for PTEN mRNA to exhibit a negative regulatory relationship between LINC00470 and PTEN mRNA. However, the alteration of LINC00470 had no effect on the luciferase activity of PTEN promoter, while the half-life of PTEN mRNA was affected. It was further validated that LINC00470 down-regulated PTEN expression by positively regulating the m6A modification of PTEN mRNA via RNA methyltransferase METTL3. Moreover, the relative expression of LC3II, Beclin-1, ATG7 and ATG5 was all decreased in cells treated with LINC00470, and down-regulated PTEN expression was observed in chemo-resistant cells, while the expression of PTEN was rescued by the transfection of shMETTL3 into chemo-resistant cells. Moreover, the knockdown of METTL3 also restored the normal level of PTEN m6 A modification and LINC00470 expression in chemo-resistant cells. In conclusion, our results demonstrated the molecular mechanism underlying the effect of LINC00470 on CML by reducing the PTEN stability via RNA methyltransferase METTL3, thus leading to the inhibition of cell autophagy while promoting chemoresistance in CML.

The Orthotospovirus nonstructural protein NSs suppresses plant MYC-regulated jasmonate signaling leading to enhanced vector attraction and performance.

Pandemics of vector-borne human and plant diseases often depend on the behaviors of their arthropod vectors. Arboviruses, including many bunyaviruses, manipulate vector behavior to accelerate their own transmission to vertebrates, birds, insects, and plants. However, the molecular mechanism underlying this manipulation remains elusive. Here, we report that the non-structural protein NSs of Tomato spotted wilt orthotospovirus, a prototype of the Tospoviridae family and the Orthotospovirus genus, is a key viral factor that indirectly modifies vector preference and increases vector performance. NSs suppresses the biosynthesis of plant volatile monoterpenes, which serve as repellents of the vector western flower thrips (WFT, Frankliniella occidentalis). NSs directly interacts with MYC2, the jasmonate (JA) signaling master regulator and its two close homologs MYC3 and MYC4, to disable JA-mediated activation of terpene synthase genes. The dysfunction of the MYCs subsequently attenuates host defenses, increases the attraction of thrips, and improves thrips fitness. Moreover, MYC2 associated with NSs of Tomato zonate spot orthotospovirus, another Euro/Asian-type orthotospovirus, suggesting that MYC2 is an evolutionarily conserved target of Orthotospovirus species for suppression of terpene-based resistance to promote vector performance. These findings elucidate the molecular mechanism through which an orthotospovirus indirectly manipulates vector behaviors and therefore facilitates pathogen transmission. Our results provide insights into the molecular mechanisms by which Orthotospovirus NSs counteracts plant immunity for pathogen transmission.

A 7-Amino-Acid Motif of Rep Protein Essential for Virulence Is Critical for Triggering Host Defense Against Sri Lankan Cassava Mosaic Virus.

Geminiviruses cause severe damage to agriculture worldwide. The replication (Rep) protein is the indispensable viral protein for viral replication. Although various functional domains of Rep protein in Geminivirus spp. have been characterized, the most carboxyl terminus of Rep protein was not available. We have reported the first cassava-infecting geminivirus, Sri Lankan cassava mosaic virus (SLCMV-HN7 strain), in China. In this study, we reported the second Chinese SLCMV strain, SLCMV-Col, and conducted comparative genomic analysis between these two SLCMV strains. The virulence of SLCMV-Col is much stronger than SLCMV-HN7, indicated by the higher virus titer, more severe symptoms, and more extent host defense. We functionally characterized that Rep protein, a 7-amino-acid motif at the most carboxyl terminus, is essential for Rep protein accumulation and virulence of SLCMV. We also provided evidence suggesting that the motif could also enhance triggering of salicylic acid (SA) defense against SLCMV infection in Nicotiana benthamiana. The significance of the balance between virulence and host SA defense responses in expanding invasions of SLCMV is also discussed.

Exploring the bone marrow micro environment in thalassemia patients: potential therapeutic alternatives.

Genetic mutations in the ß-globin gene lead to a decrease or removal of the ß-globin chain, causing the build-up of unstable alpha-hemoglobin. This condition is referred to as beta-thalassemia (BT). The present treatment strategies primarily target the correction of defective erythropoiesis, with a particular emphasis on gene therapy and hematopoietic stem cell transplantation. However, the presence of inefficient erythropoiesis in BT bone marrow (BM) is likely to disturb the previously functioning BM microenvironment. This includes accumulation of various macromolecules, damage to hematopoietic function, destruction of bone cell production and damage to osteoblast(OBs), and so on. In addition, the changes of BT BM microenvironment may have a certain correlation with the occurrence of hematological malignancies. Correction of the microenvironment can be achieved through treatments such as iron chelation, antioxidants, hypoglycemia, and biologics. Hence, This review describes damage in the BT BM microenvironment and some potential remedies.

[Efficacy and Safety of Ixazomib Combined with Thalidomide and Dexamethasone in Treatment of Multiple Myeloma].

OBJECTIVE: To investigate the efficacy and safety of ixazomib combined with thalidomide and dexamethasone in the treatment of multiple myeloma (MM). METHODS: The clinical data of 60 MM patients admitted to our center from January 2019 to June 2022 were analyzed retrospectively, including 43 newly diagnosed patients and 17 patients with recurrence and progression. All patients were treated with ixazomib combined with thalidomide and dexamethasone, and completed 2 to 7 treatment cycles. RESULTS: The overall response rate (ORR) of all patients was 98.3%. Among them, 53 patients completed 4 treatment cycles, and the ORR was 86.8%. Seventeen patients completed the whole treatment cycle, with curative effect reaching 88.2% achieving very good partial response and above, and 52.9% achieving complete response and above. Albumin and ß2-microglobulin of all patients had been improved rapidly after treatment. The deadline was August 31, 2022. The median follow-up time was 14(3-24) months, and overall survival (OS) rate was 86.67%. The OS rate of patients with recurrence and progression was significantly lower than that of newly diagnosed patients (P < 0.05). The most common adverse reaction of hematology was lymphopenia (53.3%), followed by anemia (33.3%). The most common non-hematological adverse reaction was fatigue (68.33%), followed by peripheral neuropathy (31.67%). CONCLUSION: Ixazomib combined with thalidomide and dexamethasone is effective in the treatment of MM, with good short-term efficacy, survival and safety. However, its long-term efficacy needs further observation.

Recent Advancements in Poor Graft Function Following Hematopoietic Stem Cell Transplantation.

Poor graft function (PGF) is a life-threatening complication that occurs after transplantation and has a poor prognosis. With the rapid development of haploidentical hematopoietic stem cell transplantation, the pathogenesis of PGF has become an important issue. Studies of the pathogenesis of PGF have resulted in some success in CD34+-selected stem cell boosting. Mesenchymal stem cells, N-acetyl-l-cysteine, and eltrombopag have also been investigated as therapeutic strategies for PGF. However, predicting and preventing PGF remains challenging. Here, we propose that the seed, soil, and insect theories of aplastic anemia also apply to PGF; CD34+ cells are compared to seeds; the bone marrow microenvironment to soil; and virus infection, iron overload, and donor-specific anti-human leukocyte antigen antibodies to insects. From this perspective, we summarize the available information on the common risk factors of PGF, focusing on its potential mechanism. In addition, the safety and efficacy of new strategies for treating PGF are discussed to provide a foundation for preventing and treating this complex clinical problem.

Hematopoietic Stem Cell Niche During Homeostasis, Malignancy, and Bone Marrow Transplantation.

Self-renewal and multidirectional differentiation of hematopoietic stem cells (HSCs) are strictly regulated by numerous cellular components and cytokines in the bone marrow (BM) microenvironment. Several cell types that regulate HSC niche have been identified, including both non-hematopoietic cells and HSC-derived cells. Specific changes in the niche composition can result in hematological malignancies. Furthermore, processes such as homing, proliferation, and differentiation of HSCs are strongly controlled by the BM niche and have been reported to be related to the success of hematopoietic stem cell transplantation (HSCT). Single-cell sequencing and in vivo imaging are powerful techniques to study BM microenvironment in hematological malignancies and after HSCT. In this review, we discuss how different components of the BM niche, particularly non-hematopoietic and hematopoietic cells, regulate normal hematopoiesis, and changes in the BM niche in leukemia and after HSCT. We believe that this comprehensive review will provide clues for further research on improving HSCT efficiency and exploring potential therapeutic targets for leukemia.

Anticancer and Anti-inflammatory Effect of Diosmin against Dalton Ascitic Lymphoma Induced Leukemia.

Cancer is the world's biggest health problem and cancer-induced mortality happened all over the planet after the heart disease. The present study was to scrutinize the anti-leukemia effect of diosmin against Dalton Ascitic Lymphoma (DAL) induced leukemia in mice. DAL cell was used for induction the solid tumor. Body weight, life spans, tumor volume and mean survival time was estimated. Antioxidant, biochemical and pro-inflammatory cytokines were estimated. Diosmin showed the cell viability effect at dose dependent manner against the both cell lines. DAL induced solid tumor mice showed the decreased body weight, mean survival days, non viable cell count and increased the tumor volume, viable cell count and diosmin significantly (p < 0.001) reverse the effect of DAL. Diosmin significantly (p < 0.001) altered the hematological, differential leukocytes, antioxidant, biochemical, pro-inflammatory cytokines at dose dependently. Collectively, we can say that diosmin might alter the DAL induced abnormality via antioxidant and anti-inflammatory effects.

Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.

Traditional Chinese medicine compound, Bu Sheng Hui Yang Fang, promotes the proliferation of lymphocytes in the immunosuppressed mice potentially by upregulating IL-4 signaling.

The immune system plays a pivotal role in defending against infection and cancer immunosurveillance during the onset and procession of malignant disease. Cancer patients are frequently immunocompromised and subject to refractory infection and relapse of leukemia, due to the cytotoxic agents and immunosuppressive glucocorticoids in the chemotherapy regimens. Bu Shen Hui Yang Fang (BSHY), a traditional Chinese compound, was widely used in China to enhance the immune system of leukemia patients combined with chemotherapy and effectively lowered their risk of infection, with specific mechanism unknown yet. Thus, we investigated the effects of BSHY on the immune system using immunosuppressive mouse models. By analyzing the immune system of immunosuppressed BALB/C mice induced by hydrocortisone, we found an increase of CD4+ and CD8+ lymphocytes in the spleens of mice after BSHY treatment. Furthermore, we found the enhanced immune system in BSHY treated group was due to increased proliferation and decreased apoptosis of lymphocytes. Cytokine array analysis revealed that interleukin 4 (IL-4) was reduced in the plasma of immunosuppressed mice but returned to a normal level after BSHY treatment. Moreover, we found IL-4 was an adverse prognostic factor in acute myeloid leukemia patients and part of them could be elevated by BSHY. Mechanistically, we found BSHY enhances the proliferation of lymphocytes in a Stat6-dependent manner. In summary, our current study demonstrates that BSHY enhances the proliferation of lymphocytes in the immunosuppressed mice via upregulating IL-4 signaling.

D-Pinitol treatment induced the apoptosis in human leukemia MOLT-4 cells by improved apoptotic signaling pathway.

Cancer is still remain as a global burden with the 18.1 million and 9.6 million new cases and mortlities, respectively estimated globally. Leukemia may arise at all ages varied from the infants to elders. In this exploration, we planned to evaluate the antiproliferative effect of D-pinitol on human leukemia MOLT-4 cells. Anticancer potential of D-pinitol was examined using MTT assay. Reactive oxygen species (ROS) generation was studied by fluorescence microscopic method using DCFH-DA staining. Apoptotic morphological alterations were determined by dual staining (acridine orange and ethidium bromide). Western blot and ELISA methods were employed to study apoptotic protein expression. D-pinitol treatment significantly induced cytotoxicity in human leukemia MOLT-4 cells. We observed that D-pinitol induces the generation of ROS in MOLT-4 cells. Further, we noticed that D-pinitol significantly induced apoptosis in a dosage dependent manner. Moreover, western blot and ELISA based analysis revealed that D-pinitol elevated the Bax, Caspase-3, Caspase-9 and attenuated the Bcl-2 expression in leukemic cancer cell. Our findings suggest that D-pinitol treatment induces the apoptosis in human leukemic cells by generating intracellular ROS and modulating apoptotic protein expression.

Functional co-expression of two insect nicotinic receptor subunits (Nlalpha3 and Nlalpha8) reveals the effects of a resistance-associated mutation (Nlalpha3) on neonicotinoid insecticides.

Neonicotinoid insecticides, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) and are used extensively to control a variety of insect pest species. Previously, we have identified a nAChR point mutation (Y151S) associated with insecticide resistance in the brown planthopper Nilaparvata lugens. Although this mutation has been identified in two different N. lugens nAChR subunits (Nlalpha1 and Nlalpha3) because of difficulties in heterologous expression of Nlalpha3; its influence on agonist potency has been examined only in Nlalpha1-containing nAChRs. Here we describe the cloning of a novel nAChR subunit from N. lugens (Nlalpha8), together with evidence for its co-assembly with Nlalpha3 in native and recombinant nAChRs. This has, for the first time, enabled the functional effects of the Nlalpha3(Y151S) mutation to be examined. The Nlalpha3(Y151S) mutation has little effect on agonist potency of acetylcholine but has a dramatic effect on neonicotinoid insecticides (reducing I(max) values and increasing EC(50) values). The apparent affinity of neonicotinoids was higher and the effect of the Y151S mutation on neonicotinoid agonist potency was more profound in Nlalpha3-containing, rather than Nlalpha1-containing nAChR. We conclude that Nlalpha3- and Nlalpha1-containing nAChRs may be representative of two distinct insect nAChR populations.

Heteromeric co-assembly of two insect nicotinic acetylcholine receptor alpha subunits: influence on sensitivity to neonicotinoid insecticides.

Neonicotinoid insecticides, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) and are used extensively in areas of crop protection and animal health to control a variety of insect pest species. Here, we describe studies performed with nAChR subunits Nlalpha1 and Nlalpha2 cloned from the brown planthopper Nilaparvata lugens, a major insect pest of rice crops in many parts of Asia. The influence of Nlalpha1 and Nlalpha2 subunits upon the functional properties of recombinant nAChRs has been examined by expression in Xenopus oocytes. In addition, the influence of a Nlalpha1 mutation (Y151S), which has been linked to neonicotinoid lab generated resistance in N. lugens, has been examined. As in previous studies of insect alpha subunits, functional expression has been achieved by co-expression with the mammalian beta2 subunit. This approach has revealed a significantly higher apparent affinity of imidacloprid for Nlalpha1/beta2 than for Nlalpha2/beta2 nAChRs. In addition, evidence has been obtained for the co-assembly of Nlalpha1 and Nlalpha2 subunits into 'triplet' nAChRs of subunit composition Nlalpha1/Nlalpha2/beta2. Evidence has also been obtained which demonstrates that the resistance-associated Y151S mutation has a significantly reduced effect on neonicotinoid agonist activity when Nlalpha1 is co-assembled with Nlalpha2 than when expressed as the sole alpha subunit in a heteromeric nAChR. These findings may be of importance in assessing the likely impact of the target-site mutations such as Y151S upon neonicotinoid insecticide resistance in insect field populations.

Ecological toxicity reduction of dinotefuran to honeybee: New perspective from an enantiomeric level.

In last decade, there has been a concerted effort to reduce the potential threats of honeybees' population due to exposure to neonicotinoid pesticides. A new perspective was put forward to reduce the potential ecological toxicity of neonicotinoid dinotefuran to honeybee in terms of an enantiomeric level in the study. Toxicity of dinotefuran was enantioselective, and S-dinotefuran was 41.1- to 128.4-fold more toxic than R-dinotefuran to honeybee Apis mellifera (Apis mellifera Linnaeus), whereas R-dinotefuran exhibited comparative insecticidal activities (1.7-2.4 times) to typical sucking pests Aphis gossypii and Apolygus lucorum compared to racemic mixtures. Our data suggested that use of R-dinotefuran could have a good efficacy in controlling target pests while minimizing hazard to honeybees. The mechanism for chiral specific toxicity to honeybee was further characterized by electrophysiological studies and molecular docking. S-dinotefuran appears to be more toxic by binding to α8 subunit of nAChR of Apis mellifera. The α8 also have a more stable, functional binding cavity to S-dinotefuran with a higher binding score of 7.15, primarily due to an extensive hydrogen bond network. Therefore, new chiral products with a high proportion of or an enantiomeric pure R-dinotefuran are recommended to achieve effective pests control reducing hazard to honeybee populations.

A whitefly effector Bsp9 targets host immunity regulator WRKY33 to promote performance.

Whiteflies, Bemisia tabaci (Hemiptera), are pests causing economic damage to many crops, capable of transmitting hundreds of plant vector-borne viruses. They are believed to secrete salivary protein effectors that can improve vector colonization and reproductive fitness in host plants. However, little is known about effector biology and the precise mechanism of action of whitefly effectors. Here, we report a functional screening of B. tabaci salivary effector proteins (Bsp) capable of modulating plant innate immunity triggered by plant endogenous pattern peptide Pep1. Four immunity suppressors and two elicitors were identified. Bsp9, the most effective immunity suppressor, was further identified to directly interact with an immunity regulator WRKY33. We provide evidence that Bsp9 may suppress plant immune signalling by interfering with the interaction between WRKY33 and a central regulator in the MAPK cascade. The interference by Bsp9 therefore reduces plant resistance to whitefly by inhibiting activation of WRKY33-regulated immunity-related genes. Further detailed analysis based on transgenic plants found that whitefly effector Bsp9 could promote whitefly preference and performance, increasing virus transmission. This study enriches our knowledge on insect effector biology. This article is part of the theme issue 'Biotic signalling sheds light on smart pest management'.

Viruses mobilize plant immunity to deter nonvector insect herbivores.

A parasite-infected host may promote performance of associated insect vectors; but possible parasite effects on nonvector insects have been largely unexplored. Here, we show that Begomovirus, the largest genus of plant viruses and transmitted exclusively by whitefly, reprogram plant immunity to promote the fitness of the vector and suppress performance of nonvector insects (i.e., cotton bollworm and aphid). Infected plants accumulated begomoviral ßC1 proteins in the phloem where they were bound to the plant transcription factor WRKY20. This viral hijacking of WRKY20 spatiotemporally redeployed plant chemical immunity within the leaf and had the asymmetrical benefiting effects on the begomoviruses and its whitefly vectors while negatively affecting two nonvector competitors. This type of interaction between a parasite and two types of herbivores, i.e., vectors and nonvectors, occurs widely in various natural and agricultural ecosystems; thus, our results have broad implications for the ecological significance of parasite-vector-host tripartite interactions.

Genome-wide associated study identifies NAC42-activated nitrate transporter conferring high nitrogen use efficiency in rice.

Over-application of nitrogen fertilizer in fields has had a negative impact on both environment and human health. Domesticated rice varieties with high nitrogen use efficiency (NUE) reduce fertilizer for sustainable agriculture. Here, we perform genome-wide association analysis of a diverse rice population displaying extreme nitrogen-related phenotypes over three successive years in the field, and identify an elite haplotype of nitrate transporter OsNPF6.1HapB that enhances nitrate uptake and confers high NUE by increasing yield under low nitrogen supply. OsNPF6.1HapB differs in both the protein and promoter element with natural variations, which are differentially trans-activated by OsNAC42, a NUE-related transcription factor. The rare natural allele OsNPF6.1HapB, derived from variation in wild rice and selected for enhancing both NUE and yield, has been lost in 90.3% of rice varieties due to the increased application of fertilizer. Our discovery highlights this NAC42-NPF6.1 signaling cascade as a strategy for high NUE and yield breeding in rice.

Amino acids outside of the loops that define the agonist binding site are important for ligand binding to insect nicotinic acetylcholine receptors.

Nicotinic acetylcholine (ACh) receptors (nAChRs) are the targets of several kinds of insecticides. Based on the mutagenesis studies of Torpedo californica nAChRs and solved structure of a molluscan, glial-derived soluble ACh-binding protein, a model of the agonist site was constructed with contributing amino acids from three distinct loops (A, B, and C) of the alpha subunits and another three loops (D, E, and F) of the non-alpha subunits. According to this model, most insect nAChR subunits can form the functional heteromeric or homomeric receptors. Actually, insect subunits themselves did not form any functional receptor at various combinations as yet, and only part of them can form the functional receptors with vertebrate non-alpha subunits. These findings suggested that the agonist binding for insect nAChRs was not only contributed by those key amino acids in six loops, but also some unidentified amino acids from other regions. In our previous studies on nAChRs for Nilaparvata lugens, a target-site mutation (Y151S) was found within two alpha subunits (Nlalpha1 and Nlalpha3). In Drosophila S2 cells and Xenopus oocytes, Nlalpha1 can form functional receptors with rat beta2 subunit. However, the same thing was not observed in Nlalpha3. In the present paper, by exchanging the corresponding regions between Nlalpha1 and Nlalpha3 to generate different chimeras, amino acid residues or residue clusters in the regions outside the six loops were found to play essential roles in agonist binding, especially for the amino acid clusters between loop B and C. This result indicated that the residues in the six loops could be necessary, but not enough for the activity of agonist binding.