RESUMO
Developing climate-resilient crops is critical for future food security and sustainable agriculture under current climate scenarios. Of specific importance are drought and soil salinity. Tolerance traits to these stresses are highly complex, and the progress in improving crop tolerance is too slow to cope with the growing demand in food production unless a major paradigm shift in crop breeding occurs. In this work, we combined bioinformatics and physiological approaches to compare some of the key traits that may differentiate between xerophytes (naturally drought-tolerant plants) and mesophytes (to which the majority of the crops belong). We show that both xerophytes and salt-tolerant mesophytes have a much larger number of copies in key gene families conferring some of the key traits related to plant osmotic adjustment, abscisic acid (ABA) sensing and signalling, and stomata development. We show that drought and salt-tolerant species have (i) higher reliance on Na for osmotic adjustment via more diversified and efficient operation of Na+ /H+ tonoplast exchangers (NHXs) and vacuolar H+ - pyrophosphatase (VPPases); (ii) fewer and faster stomata; (iii) intrinsically lower ABA content; (iv) altered structure of pyrabactin resistance/pyrabactin resistance-like (PYR/PYL) ABA receptors; and (v) higher number of gene copies for protein phosphatase 2C (PP2C) and sucrose non-fermenting 1 (SNF1)-related protein kinase 2/open stomata 1 (SnRK2/OST1) ABA signalling components. We also show that the past trends in crop breeding for Na+ exclusion to improve salinity stress tolerance are counterproductive and compromise their drought tolerance. Incorporating these genetic insights into breeding practices could pave the way for more drought-tolerant and salt-resistant crops, securing agricultural yields in an era of climate unpredictability.
Assuntos
Produtos Agrícolas , Melhoramento Vegetal , Produtos Agrícolas/genética , Produtos Agrícolas/metabolismo , Sulfonamidas , Naftalenos , Ácido Abscísico/metabolismo , SecasRESUMO
The graphene-all-around (GAA) structure has been verified to grow directly at 380 °C using hot-wire chemical vapor deposition, within the thermal budget of the back end of the line (BEOL). The cobalt (Co) interconnects with the GAA structure have demonstrated a 10.8% increase in current density, a 27% reduction in resistance, and a 36 times longer electromigration lifetime. X-ray photoelectron spectroscopy and density functional theory calculations have revealed the presence of bonding between carbon and Co, which makes the Co atom more stable to resist external forces. The ability of graphene to act as a diffusion barrier in the GAA structure was confirmed through time-dependent dielectric breakdown measurement. The Co interconnect within the GAA structure exhibits enhanced electrical properties and reliability, which indicates compatibility applications as next-generation interconnect materials in CMOS BEOL.
RESUMO
Subarachnoid hemorrhage (SAH) is a type of stroke caused by bleeding into the subarachnoid space. SAH is a medical emergency and requires prompt treatment to prevent complications such as seizures, stroke, or other brain damage. Treatment options may include surgery, medication, or a combination of both. 2-Cyano-3,12-dioxoolean-1,9-dien-28-oic acid (CDDO), a compound with anti-inflammatory and antioxidant properties, is currently being investigated as a potential treatment for various diseases, including chronic kidney disease and pulmonary arterial hypertension. In this study, the effects of CDDO on rats subjected to SAH were evaluated. Male Sprague-Dawley rats were divided into four groups (n = 6/group): (1) control group, (2) SAH group, (3) SAH + low-dose CDDO (10 mg/kg injected into the subarachnoid space at 24 h after SAH) group, and (4) SAH + high-dose CDDO (20 mg/kg) group. CDDO improved SAH-induced poor neurological outcomes and reduced vasospasm in the basal artery following SAH. It also decreased the SAH-induced expression of proinflammatory cytokines such as TNF-α, IL-1ß, and IL-6 in both the cerebrospinal fluid and serum samples as determined by ELISA. A Western blot analysis confirmed an increase in the p-NF-κB protein level after SAH, but it was significantly decreased with CDDO intervention. Immunofluorescence staining highlighted the proliferation of microglia and astrocytes as well as apoptosis of the neuronal cells after SAH, and treatment with CDDO markedly reduced the proliferation of these glial cells and apoptosis of the neuronal cells. The early administration of CDDO after SAH may effectively mitigate neuronal apoptosis and vasospasm by suppressing inflammation.
RESUMO
BACKGROUND: The myeloblastosis (MYB) transcription factor (TF) family is one of the largest and most important TF families in plants, playing an important role in a life cycle and abiotic stress. RESULTS: In this study, 268 Avena sativa MYB (AsMYB) TFs from Avena sativa were identified and named according to their order of location on the chromosomes, respectively. Phylogenetic analysis of the AsMYB and Arabidopsis MYB proteins were performed to determine their homology, the AsMYB1R proteins were classified into 5 subgroups, and the AsMYB2R proteins were classified into 34 subgroups. The conserved domains and gene structure were highly conserved among the subgroups. Eight differentially expressed AsMYB genes were screened in the transcriptome of transcriptional data and validated through RT-qPCR. Three genes in AsMYB2R subgroup, which are related to the shortened growth period, stomatal closure, and nutrient and water transport by PEG-induced drought stress, were investigated in more details. The AsMYB1R subgroup genes LHY and REV 1, together with GST, regulate ROS homeostasis to ensure ROS signal transduction and scavenge excess ROS to avoid oxidative damage. CONCLUSION: The results of this study confirmed that the AsMYB TFs family is involved in the homeostatic regulation of ROS under drought stress. This lays the foundation for further investigating the involvement of the AsMYB TFs family in regulating A. sativa drought response mechanisms.
Assuntos
Avena , Secas , Homeostase , Filogenia , Proteínas de Plantas , Espécies Reativas de Oxigênio , Fatores de Transcrição , Fatores de Transcrição/genética , Fatores de Transcrição/metabolismo , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Espécies Reativas de Oxigênio/metabolismo , Avena/genética , Avena/metabolismo , Regulação da Expressão Gênica de Plantas , Polietilenoglicóis/farmacologia , Família Multigênica , Estresse Fisiológico/genética , Estudo de Associação Genômica Ampla , Genoma de PlantaRESUMO
A new method of harmonic beam coaxial combination (HBCC) from two intra-cavity frequency doubling branches was demonstrated. Firstly, two identical nanosecond (ns) 532â nm green lasers with high power and good beam quality were created. Each green laser was constructed of an intra-cavity frequency doubling branch based on a laser diode (LD) end-pumped acousto-optical (AO) Q-switched 1064â nm Nd:YVO4 laser in a LiB3O5 (LBO) nonlinear crystal. Each branch generated about 45â W green output at a 50â kHz pulse repetition rate (PRR) with diffraction limited beam quality. The first green beam was injected into the LBO crystal in the second branch, and the pulses from the two branches did not exist simultaneously. Then, the HBCC was performed. Consequently, an 83â W combined green output power at 532â nm was obtained with a combination efficiency of 92.2%. The PRR of the HBCC pulse was doubled to be 100â kHz, with a pulse width of about 22â ns, corresponding to a single pulse energy of 0.83â mJ and a peak power of 37.73â kW. The combined beam quality factor was measured to be M x2 = 1.80 in the x direction and M y2 = 1.71 in the y direction, respectively. Moreover, many more beams could also be combined with this method for further scaling the green power.
RESUMO
Chirality is an essential nature of biological systems. However, it remains obscure how the handedness at the microscale is translated into chiral morphogenesis at the tissue level. Here, we investigate three-dimensional (3D) tissue morphogenesis using an active fluid theory invoking chirality. We show that the coordination of achiral and chiral stresses, arising from microscopic interactions and energy input of individual cells, can engender the self-organization of 3D papillary and helical structures. The achiral active stress drives the nucleation of asterlike topological defects, which initiate 3D out-of-plane budding, followed by rodlike elongation. The chiral active stress excites vortexlike topological defects, which favor the tip spheroidization and twisting of the elongated rod. These results unravel the chiral morphogenesis observed in our experiments of 3D organoids generated by human embryonic stem cells.
Assuntos
Divisão Celular , Humanos , MorfogêneseRESUMO
Acute kidney injury (AKI) is one of the common complications in patients with sepsis. We aimed to investigate the protective mechanism of salidroside (SLDS) on AKI induced by cecal ligation and perforation (CLP). We established a sepsis model using the CLP, and pretreated the mice with SLDS. We used biochemical methods to measure renal function, inflammatory factors and oxidase levels. We used transmission electron microscopy to observe mitochondrial damage, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) to detect apoptosis in renal tubular epithelial cells (TECs), and RT-quantitative PCR (qPCR) to detect the expression of apoptotic genes. CLP induced renal pathological damage and decreased renal function, activated inflammatory factors and oxidases, leading to mitochondrial damage and increased apoptosis of TECs. SLDS pretreatment improved renal pathological damage, reduced tumor necrosis factor (TNF)-α, interleukin (IL)-6 and malondialdehyde levels, and increased the levels of glutathione peroxidase, superoxide dismutase and catalase. Moreover, SLDS stabilized mitochondrial damage induced by CLP, inhibited TECs apoptosis, increased Bcl-2 mRNA level, and decreased Bax and Caspase-3 mRNA levels. SLDS protects CLP induced AKI by inhibiting oxidative stress, mitochondrial damage, and cell apoptosis in TECs.
RESUMO
Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (â¼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (â¼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 µm × 4.1 to 6.1 µm (average 13.9 × 4.8 µm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 µm × 5.9 to 7.8 µm (average 7.7 × 6.6 µm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and ß-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with â¼5 mm2 mycelial discs or aliquots of 10 µl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.
RESUMO
AIM: To investigate the association of long-term care nursing assistants' dual caregiving roles with mental health and to determine whether social support moderates this relationship. DESIGN: A cross-sectional survey. METHODS: We surveyed 962 certified long-term care nursing assistants working in long-term care and medical facilities across Taiwan from October 2022 to July 2023. 'Dual caregiving roles' denote the fulfilment of caregiving duties both at work and within families. Mental health was evaluated using the 5-item Brief Symptom Rating Scale. Logistic regression analysis was utilized to investigate the association of dual caregiving roles and psychological job demands with poor mental health. Moreover, we explored whether family, colleague, and supervisor support moderated the association between dual caregiving roles and poor mental health. RESULTS: Among long-term care nursing assistants, 15% had dual caregiving responsibilities. Individuals with both dual caregiving roles and high psychological job demands faced the highest risk of poor mental health compared to those without dual caregiving roles and low psychological job demands. Having dual caregiving roles was associated with poor mental health compared to workers without such roles. Additionally, support from family, colleagues, and supervisors mitigates the association between caregivers' dual caregiving roles and poor mental health. CONCLUSION: A substantial proportion of long-term care nursing assistants had dual caregiving roles, leading to an additional mental health burden when combined with high psychological job demands. High social support attenuated this association. IMPLICATIONS FOR THE PROFESSION: Long-term care nursing assistants with dual caregiving roles had poorer mental health outcomes. Yet, support from family, colleagues, and supervisors mitigated these effects. These results emphasize the importance of enhancing social support to protect the mental well-being of long-term care nursing assistants managing both formal and informal caregiving duties. REPORTING METHOD: This study adheres to the STROBE guideline of reporting. PATIENT OR PUBLIC CONTRIBUTION: No Patient or Public Contribution.
RESUMO
OBJECTIVES: To investigate the endoscopic ultrasonography (EUS) features of benign esophageal stenosis in children. METHODS: A retrospective analysis was conducted on the medical data of the children who were diagnosed with benign esophageal stenosis from February 2019 to February 2022. The clinical manifestations, EUS findings, and treatment outcome were analyzed to summarize the EUS features of benign esophageal stenosis in children. RESULTS: A total of 42 children with benign esophageal stenosis were included. Among these children, 19 (45%) had anastomotic stenosis after surgery for esophageal atresia, with unclear echogenic boundary of the esophageal walls and uneven thicknesses of the surrounding wall on EUS, and had 0-12 sessions of endoscopic treatment (average 2.1 sessions); 5 children (12%) had corrosive esophageal stenosis and 1 child (2%) had physical esophageal stenosis, with unclear stratification of the esophageal walls on EUS, and they had 2-9 sessions of endoscopic treatment (average 5.3 sessions); 1 child (2%) had patchy irregular hypoechoic areas of the esophageal walls on EUS and was diagnosed with tracheobronchial remnants with reference to pathology; 16 children (38%) had unexplained esophageal stenosis and unclear stratification of the esophageal walls on EUS, among whom 6 received endoscopic treatment. During follow-up, 95% (40/42) of the children had significant alleviation of the symptoms such as vomiting and dysphagia. CONCLUSIONS: For benign esophageal stenosis in children, EUS can help to evaluate the degree of esophageal wall involvement in esophageal stenosis lesions, possible etiologies, and the relationship between the esophagus and the lesion and provide an important basis for selecting treatment modality and avoiding complications, thereby helping to optimize the treatment regimen.
Assuntos
Transtornos de Deglutição , Estenose Esofágica , Criança , Humanos , Estenose Esofágica/diagnóstico por imagem , Estenose Esofágica/etiologia , Estenose Esofágica/terapia , Endossonografia , Estudos RetrospectivosRESUMO
BACKGROUND: Novel endoscopic techniques used in the treatment of gastric lesions with local submucosal fibrosis need preclinical evaluation and training due to safety limitations. Therefore, the purpose of our study was to establish an animal model of gastric local fibrotic target lesions and assess its feasibility in the evaluation and training of endoscopic techniques. METHODS: In six experimental beagles, a 50% glucose solution was injected into three submucosal areas of the fundus, body, and antrum of the stomach to create gastric local fibrotic target lesions (experimental group). On post-injection day (PID) 7, the injection sites were assessed endoscopically to confirm the presence of submucosal fibrosis formation, and the dental floss clip traction assisted endoscopic submucosal dissection (DFC-ESD) procedure was performed on the gastric local fibrotic target lesions to confirm its feasibility after endoscopic observation. The normal gastric mucosa of six control beagles underwent the same procedure (control group). All the resected specimens were evaluated by histological examination. RESULTS: All 12 beagles survived without postoperative adverse events. On PID 7, 16 ulcer changes were observed at the injection sites (16/18) under the endoscope, and endoscopic ultrasonography confirmed the local submucosal fibrosis formation in all ulcer lesions. The subsequent DFC-ESD was successfully performed on the 32 gastric target lesions, and the mean submucosal dissection time in the ulcer lesions was greater than that in the normal gastric mucosa (15.3 ± 5.6 vs. 6.8 ± 0.8 min; P < 0.001). There was no difference in rates of en bloc resection, severe hemorrhage, or perforation between the two groups. Histological analysis of the ulcer lesions showed the absence of epithelial or muscularis mucosae and extensive submucosal fibrous tissue proliferations compared with normal gastric mucosa. Overall, endoscopists had high satisfaction with the realism and feasibility of the animal model. CONCLUSION: We developed a novel animal model of gastric local fibrotic target lesions to simulate difficult clinical situations, which strongly appeared to be suitable for the preclinical evaluation and learning of advanced endoscopic techniques.
Assuntos
Ressecção Endoscópica de Mucosa , Fibrose Oral Submucosa , Neoplasias Gástricas , Cães , Animais , Úlcera/patologia , Fibrose Oral Submucosa/patologia , Mucosa Gástrica/patologia , Endoscopia , Neoplasias Gástricas/patologia , Ressecção Endoscópica de Mucosa/métodos , Resultado do TratamentoRESUMO
Hepatocellular carcinoma (HCC) is among the most prevalent visceral neoplasms. So far, reliable biomarkers for predicting HCC recurrence in patients undergoing surgery are far from adequate. In the aim of searching for genetic biomarkers involved in HCC development, we performed analyses of cDNA microarrays and found that the DNA repair gene NEIL3 was remarkably overexpressed in tumors. NEIL3 belongs to the Fpg/Nei protein superfamily, which contains DNA glycosylase activity required for the base excision repair for DNA lesions. Notably, the other Fpg/Nei family proteins NEIL1 and NEIL2, which have the same glycosylase activity as NEIL3, were not elevated in HCC; NEIL3 was specifically induced to participate in HCC development independently of its glycosylase activity. Using RNA-seq and invasion/migration assays, we found that NEIL3 elevated the expression of epithelial-mesenchymal transition (EMT) factors, including the E/N-cadherin switch and the transcription of MMP genes, and promoted the invasion, migration, and stemness phenotypes of HCC cells. Moreover, NEIL3 directly interacted with the key EMT player TWIST1 to enhance invasion and migration activities. In mouse orthotopic HCC studies, NEIL3 overexpression also caused a prominent E-cadherin decrease, tumor volume increase, and lung metastasis, indicating that NEIL3 led to EMT and tumor metastasis in mice. We further found that NEIL3 induced the transcription of MDR1 (ABCB1) and BRAF genes through the canonical E-box (CANNTG) promoter region, which the TWIST1 transcription factor recognizes and binds to, leading to the BRAF/MEK/ERK pathway-mediated cell proliferation as well as anti-cancer drug resistance, respectively. In the HCC cohort, the tumor NEIL3 level demonstrated a high positive correlation with disease-free and overall survival after surgery. In conclusion, NEIL3 activated the BRAF/MEK/ERK/TWIST pathway-mediated EMT and therapeutic resistances, leading to HCC progression. Targeted inhibition of NEIL3 in HCC individuals with NEIL3 induction is a promising therapeutic approach. © 2022 The Pathological Society of Great Britain and Ireland.
Assuntos
Carcinoma Hepatocelular , DNA Glicosilases , Neoplasias Hepáticas , Animais , Camundongos , Carcinoma Hepatocelular/patologia , Linhagem Celular Tumoral , Movimento Celular , DNA Glicosilases/genética , Transição Epitelial-Mesenquimal/genética , Regulação Neoplásica da Expressão Gênica , Neoplasias Hepáticas/patologia , Sistema de Sinalização das MAP Quinases , Quinases de Proteína Quinase Ativadas por Mitógeno/metabolismo , Proteínas Proto-Oncogênicas B-raf/genética , Proteínas Proto-Oncogênicas B-raf/metabolismo , Transdução de Sinais , MAP Quinases Reguladas por Sinal Extracelular/metabolismo , Fatores de Transcrição Twist/metabolismoRESUMO
Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00â³N, 108°44'00â³E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.
RESUMO
BACKGROUND: Chronic rhinosinusitis (CRS) is a common inflammatory disease in otolaryngology, mainly manifested as nasal congestion, nasal discharge, facial pain/pressure, and smell disorder. CRS with nasal polyps (CRSwNP), an important phenotype of CRS, has a high recurrence rate even after receiving corticosteroids and/or functional endoscopic sinus surgery. In recent years, clinicians have focused on the application of biological agents in CRSwNP. However, it has not reached a consensus on the timing and selection of biologics for the treatment of CRS so far. SUMMARY: We reviewed the previous studies of biologics in CRS and summarized the indications, contraindications, efficacy assessment, prognosis, and adverse effects of biologics. Also, we evaluated the treatment response and adverse reactions of dupilumab, omalizumab, and mepolizumab in the management of CRS and made recommendations. KEY MESSAGES: Dupilumab, omalizumab, and mepolizumab have been approved for the treatment of CRSwNP by the US Food and Drug Administration. Type 2 and eosinophilic inflammation, need for systemic steroids or contraindication to systemic steroids, significantly impaired quality of life, anosmia, and comorbid asthma are required for the use of biologics. Based on current evidence, dupilumab has the prominent advantage in improving quality of life and reducing the risk of comorbid asthma in CRSwNP among the approved monoclonal antibodies. Most patients tolerate biological agents well in general with few major or severe adverse effects. Biologics have provided more options for severe uncontrolled CRSwNP patients or patients who refuse to have surgery. In the future, more novel biologics will be assessed in high-quality clinical trials and applied clinically.
Assuntos
Asma , Produtos Biológicos , Pólipos Nasais , Rinite , Sinusite , Humanos , Asma/tratamento farmacológico , Produtos Biológicos/uso terapêutico , Doença Crônica , Consenso , Pólipos Nasais/complicações , Pólipos Nasais/tratamento farmacológico , Omalizumab/uso terapêutico , Qualidade de Vida , Rinite/complicações , Rinite/tratamento farmacológico , Sinusite/complicações , Sinusite/tratamento farmacológico , Esteroides/uso terapêuticoRESUMO
This study was designed to evaluate the protective effect of CPD1, a novel phosphodiesterase 5 inhibitor, on renal interstitial fibrosis after unilateral renal ischemia-reperfusion injury (UIRI). Male BALB/c mice were subjected to UIRI, and treated with CPD1 once daily (i.g, 5 mg/kg). Contralateral nephrectomy was performed on day 10 after UIRI, and the UIRI kidneys were harvested on day 11. Hematoxylin-eosin (HE), Masson trichrome and Sirius Red staining methods were used to observe the renal tissue structural lesions and fibrosis. Immunohistochemical staining and Western blot were used to detect the expression of proteins related to fibrosis. HE, Sirius Red and Masson trichrome staining showed that CPD1-treated UIRI mice had lower extent of tubular epithelial cell injury and deposition of extracellular matrix (ECM) in renal interstitium compared with those in the fibrotic mouse kidneys. The results from immunohistochemistry and Western blot assay indicated significantly decreased protein expressions of type I collagen, fibronectin, plasminogen activator inhibitor-1 (PAI-1) and α-smooth muscle actin (α-SMA) after CPD1 treatment. In addition, CPD1 dose-dependently inhibited the expression of ECM-related proteins induced by transforming growth factor ß1 (TGF-ß1) in normal rat kidney interstitial fibroblasts (NRK-49F) and human renal tubular epithelial cell line (HK-2). In summary, the novel PDE inhibitor, CPD1, displays strong protective effects against UIRI and fibrosis by suppressing TGF-ß signaling pathway and regulating the balance between ECM synthesis and degradation through PAI-1.
Assuntos
Nefropatias , Inibidores da Fosfodiesterase 5 , Animais , Humanos , Masculino , Camundongos , Ratos , Proteínas da Matriz Extracelular , Fibrose , Rim , Inibidor 1 de Ativador de PlasminogênioRESUMO
This study aimed to compare the diagnostic values of SARC-F (strength, assistance with walking, rising from a chair, climbing stairs, and falls), SARC-Calf (SARC-F combined with calf circumference), CC (calf circumference), and the Yubi-wakka (finger-ring) test for screening for sarcopenia in community-dwelling older adults. The Asian Working Group for Sarcopenia (AWGS) 2019 criteria were used as a standard reference. A total of 209 participants were enrolled, and 40.7% were identified as sarcopenia. The sensitivity, specificity, and AUC were respectively 54.1%, 70.2%, and 0.687 for SARC-F; 76.5%, 73.4% and 0.832 for SARC-calf, 86.7%, 82.4%, and 0.906 for CC in men, and 85.5%, 63.3%, and 0.877 for CC in women. Relative to the "bigger," a significant association between sarcopenia and the Yubi-wakka test ("just fits" OR: 4.1, 95% CI: 1.57-10.98; "small" OR: 27.5, 95% CI: 10.14-74.55) was observed. The overall accuracy of CC was better than SARC-Calf for sarcopenia screening.
Assuntos
Sarcopenia , Masculino , Humanos , Feminino , Idoso , Sarcopenia/diagnóstico , Vida Independente , Perna (Membro) , Caminhada , Avaliação Geriátrica/métodos , Inquéritos e QuestionáriosRESUMO
The lysine succinylation (Ksucc) is involved in many core energy metabolism pathways and affects the metabolic process in mitochondria, making this modification highly valuable for studying diseases related to mitochondrial disorders. In this paper, we used liquid chromatography with tandem mass spectrometry (LC-MS/MS) to perform the first global profiling of succinylation in human lungs under normal physiological conditions. Using an MS-based platform, we identified 1485 Ksucc sites in 568 proteins. We then compared these sites with those previously identified in human succinylome studies to investigate specific succinylated proteins and identify their possible functions in the lung and to explore the substrate preferences of succinylation modifiers in different cell lines and at different subcellular localizations. Our work expands the succinylation database and supplementary materials on the human succinylome and will thus help in further study of the function of Ksucc and regulation under related physiological and pathological conditions.
Assuntos
Lisina , Espectrometria de Massas em Tandem , Cromatografia Líquida , Humanos , Pulmão/metabolismo , Lisina/metabolismo , Processamento de Proteína Pós-Traducional , Proteoma/metabolismoRESUMO
Making a hydrogel-based first-aid bandage with green resources, desirable biocompatibility, universal adhesive properties, low cost and simple production is a long-standing research aspiration. Considering this, three naturally existing organic acids, namely tannic acid, thioctic acid and phytic acid, were used to construct a novel adhesive gel (TATAPA hydrogel) for epidermal tissue bandage applications. This hydrogel could be synthesized under mild conditions with no need for a freeze-thawing shaping procedure, and was transparent, moldable and stretchable with good stability under continuous water immersion. In lap-shear tests, the TATAPA hydrogel could adhere to various hydrophilic and hydrophobic surfaces. Moreover, in the case of skin tissue adhesion, the hydrogel could be easily peeled off from the skin, meeting wearability requirements. Rheological tests showed that the hydrogel possessed thermal sensitive properties derived from multi-supramolecular interactions. The methicillin-resistant Staphylococcus aureus (MRSA)-infected burn wound test demonstrated that the hydrogel had desirable antibacterial activity and was beneficial for wound healing. A femoral artery bleeding assay was also used to reveal that the TATAPA hydrogel could be directly pasted onto the bleeding site for hemostasis. Overall, this hydrogel demonstrates potential as a surgical bioadhesive for a broad range of medical applications.
Assuntos
Bandagens , Hidrogéis , Staphylococcus aureus Resistente à Meticilina , Adesivos/farmacologia , Antibacterianos/química , Antibacterianos/farmacologia , Hidrogéis/química , Ácido Fítico , Taninos , Ácido TiócticoRESUMO
Our study aimed to investigate the immune-enhancing mechanism of the pentadecapeptide (RVAPEEHPVEGRYLV) from Cyclina sinensis (SCSP) in a cyclophosphamide (CTX)-induced murine model of immunosuppression. Our results showed that SCSP treatment significantly increased mouse body weight, immune organ indices, and the production of serum IL-6, IL-1ß, and tumor necrosis factor (TNF)-α in CTX-treated mice. In addition, SCSP treatment enhanced the proliferation of splenic lymphocytes and peritoneal macrophages, as well as phagocytosis of the latter in a dose-dependent manner. Moreover, SCSP elevated the phosphorylation levels of p38, ERK, JNK, PI3K and Akt, and up-regulated IKKα, IKKß, p50 NF-κB and p65 NF-κB protein levels, while down-regulating IκBα protein levels. Our results indicate that SCSP has immune-enhancing activities, and that it can activate the MAPK/NF-κB and PI3K/Akt pathways to enhance immunity in CTX-induced immunosuppressed mice.
Assuntos
Quinase I-kappa B , NF-kappa B , Animais , Ciclofosfamida/toxicidade , Quinase I-kappa B/metabolismo , Quinase I-kappa B/farmacologia , Terapia de Imunossupressão , Interleucina-6 , Camundongos , Inibidor de NF-kappaB alfa/metabolismo , NF-kappa B/metabolismo , Fosfatidilinositol 3-Quinases/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , Transdução de Sinais , Fator de Necrose Tumoral alfa/metabolismoRESUMO
Mesophotic coral ecosystems (MCEs) represent an underexplored source of intriguing natural products. Efforts to discover bioactive metabolites from sponge-associated fungi in MCEs identified a new steroid, acremocholone (1) and its three known analogs (2-4), from Acremonium sp. NBUF150. The Acremonium sp. NBUF150 was isolated from a Ciocalypta sponge located 70â m deep within the South China Sea. The planar structures and absolute configuration of 1-4 were determined from NMR-derived spectroscopic data, HR-ESI-MS, and X-ray crystallography. Compound 1 exhibited antimicrobial inhibition against Vibrio scophthalmi, V.â shilonii and V.â brasiliensis at minimum inhibitory concentrations of 8 µg/mL; compound 2 inhibited V.â shilonii and V.â brasiliensis at 8 and 32â µg/mL, respectively, and compound 4 inhibited growth of V.â brasiliensis at 16â µg/mL. Sponge associated fungi from MCEs represent a promising resource of anti-Vibrio drug leads for aquaculture use.