The genome of a bunyavirus cannot be defined at the level of the viral particle but only at the scale of the viral population.

Bunyaviruses are enveloped negative or ambisense single-stranded RNA viruses with a genome divided into several segments. The canonical view depicts each viral particle packaging one copy of each genomic segment in one polarity named the viral strand. Several opposing observations revealed nonequal ratios of the segments, uneven number of segments per virion, and even packaging of viral complementary strands. Unfortunately, these observations result from studies often addressing other questions, on distinct viral species, and not using accurate quantitative methods. Hence, what RNA segments and strands are packaged as the genome of any bunyavirus remains largely ambiguous. We addressed this issue by first investigating the virion size distribution and RNA content in populations of the tomato spotted wilt virus (TSWV) using microscopy and tomography. These revealed heterogeneity in viral particle volume and amount of RNA content, with a surprising lack of correlation between the two. Then, the ratios of all genomic segments and strands were established using RNA sequencing and qRT-PCR. Within virions, both plus and minus strands (but no mRNA) are packaged for each of the three L, M, and S segments, in reproducible nonequimolar proportions determined by those in total cell extracts. These results show that virions differ in their genomic content but together build up a highly reproducible genetic composition of the viral population. This resembles the genome formula described for multipartite viruses, with which some species of the order Bunyavirales may share some aspects of the way of life, particularly emerging properties at a supravirion scale.

Promotion of order Bunyavirales to class Bunyaviricetes to accommodate a rapidly increasing number of related polyploviricotine viruses.

Prior to 2017, the family Bunyaviridae included five genera of arthropod and rodent viruses with tri-segmented negative-sense RNA genomes related to the Bunyamwera virus. In 2017, the International Committee on Taxonomy of Viruses (ICTV) promoted the family to order Bunyavirales and subsequently greatly expanded its composition by adding multiple families for non-segmented to polysegmented viruses of animals, fungi, plants, and protists. The continued and accelerated discovery of bunyavirals highlighted that an order would not suffice to depict the evolutionary relationships of these viruses. Thus, in April 2024, the order was promoted to class Bunyaviricetes. This class currently includes two major orders, Elliovirales (Cruliviridae, Fimoviridae, Hantaviridae, Peribunyaviridae, Phasmaviridae, Tospoviridae, and Tulasviridae) and Hareavirales (Arenaviridae, Discoviridae, Konkoviridae, Leishbuviridae, Mypoviridae, Nairoviridae, Phenuiviridae, and Wupedeviridae), for hundreds of viruses, many of which are pathogenic for humans and other animals, plants, and fungi.

Virus discovery in cultured portunid crabs: Genomic, phylogenetic, histopathological and microscopic characterization of a reovirus and a new bunyavirus.

Portunid crabs are distributed worldwide and highly valued in aquaculture. Viral infections are the main limiting factor for the survival of these animals and, consequently, for the success of commercial-scale cultivation. However, there is still a lack of knowledge about the viruses that infect cultured portunid crabs worldwide. Herein, the genome sequence and phylogeny of Callinectes sapidus reovirus 2 (CsRV2) are described, and the discovery of a new bunyavirus in Callinectes danae cultured in southern Brazil is reported. The CsRV2 genome sequence consists of 12 dsRNA segments (20,909 nt) encode 13 proteins. The predicted RNA-dependent RNA polymerase (RdRp) shows a high level of similarity with that of Eriocheir sinensis reovirus 905, suggesting that CsRV2 belongs to the genus Cardoreovirus. The CsRV2 particles are icosahedral, measuring approximately 65 nm in diameter, and exhibit typical non-turreted reovirus morphology. High throughput sequencing data revealed the presence of an additional putative virus genome similar to bunyavirus, called Callinectes danae Portunibunyavirus 1 (CdPBV1). The CdPBV1 genome is tripartite, consisting of 6,654 nt, 3,120 nt and 1,656 nt single-stranded RNA segments that each encode a single protein. Each segment has a high identity with European shore crab virus 1, suggesting that CdPBV1 is a new representative of the family Cruliviridae. The putative spherical particles of CdPBV1 measure ∼120 nm in diameter and present a typical bunyavirus morphology. The results of the histopathological analysis suggest that these new viruses can affect the health and, consequently, the survival of C. danae in captivity. Therefore, the findings reported here should be used to improve prophylactic and pathogen control practices and contribute to the development and optimization of the production of soft-shell crabs on a commercial scale in Brazil.

ICTV Virus Taxonomy Profile: Phenuiviridae 2023.

The family Phenuiviridae comprises viruses with 2-8 segments of negative-sense or ambisense RNA, comprising 8.1-25.1 kb in total. Virions are typically enveloped with spherical or pleomorphic morphology but can also be non-enveloped filaments. Phenuivirids infect animals including livestock and humans, birds, plants or fungi, as well as arthropods that serve as single hosts or act as biological vectors for transmission to animals or plants. Phenuivirids include important pathogens of humans, livestock, seafood and agricultural crops. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Phenuiviridae, which is available at ictv.global/report/phenuiviridae.

ICTV Virus Taxonomy Profile: Tulasviridae 2023.

Tulasviridae is a family of ambisense RNA viruses with genomes of about 12.2 kb that have been found in fungi. The tulasvirid genome is nonsegmented and contains three open reading frames (ORFs) that encode a nucleoprotein (NP), a large (L) protein containing an RNA-directed RNA polymerase (RdRP) domain, and a protein of unknown function (X). This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Tulasviridae, which is available at ictv.global/report/tulasviridae.

Annual (2023) taxonomic update of RNA-directed RNA polymerase-encoding negative-sense RNA viruses (realm Riboviria: kingdom Orthornavirae: phylum Negarnaviricota).

In April 2023, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by one new family, 14 new genera, and 140 new species. Two genera and 538 species were renamed. One species was moved, and four were abolished. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV.

The Orthobunyavirus Germiston Enters Host Cells from Late Endosomes.

With more than 80 members worldwide, the Orthobunyavirus genus in the Peribunyaviridae family is a large genus of enveloped RNA viruses, many of which are emerging pathogens in humans and livestock. How orthobunyaviruses (OBVs) penetrate and infect mammalian host cells remains poorly characterized. Here, we investigated the entry mechanisms of the OBV Germiston (GERV). Viral particles were visualized by cryo-electron microscopy and appeared roughly spherical with an average diameter of 98 nm. Labeling of the virus with fluorescent dyes did not adversely affect its infectivity and allowed the monitoring of single particles in fixed and live cells. Using this approach, we found that endocytic internalization of bound viruses was asynchronous and occurred within 30 to 40 min. The virus entered Rab5a-positive (Rab5a+) early endosomes and, subsequently, late endosomal vacuoles containing Rab7a but not LAMP-1. Infectious entry did not require proteolytic cleavage, and endosomal acidification was sufficient and necessary for viral fusion. Acid-activated penetration began 15 to 25 min after initiation of virus internalization and relied on maturation of early endosomes to late endosomes. The optimal pH for viral membrane fusion was slightly below 6.0, and penetration was hampered when the potassium influx was abolished. Overall, our study provides real-time visualization of GERV entry into host cells and demonstrates the importance of late endosomal maturation in facilitating OBV penetration. IMPORTANCE Orthobunyaviruses (OBVs), which include La Crosse, Oropouche, and Schmallenberg viruses, represent a growing threat to humans and domestic animals worldwide. Ideally, preventing OBV spread requires approaches that target early stages of infection, i.e., virus entry. However, little is known about the molecular and cellular mechanisms by which OBVs enter and infect host cells. Here, we developed accurate, sensitive tools and assays to investigate the penetration process of GERV. Our data emphasize the central role of late endosomal maturation in GERV entry, providing a comprehensive overview of the early stages of an OBV infection. Our study also brings a complete toolbox of innovative methods to study each step of the OBV entry program in fixed and living cells, from virus binding and endocytosis to fusion and penetration. The information gained herein lays the foundation for the development of antiviral strategies aiming to block OBV entry.

Transcriptome Mining Expands Knowledge of RNA Viruses across the Plant Kingdom.

Our current understanding of plant viruses stems largely from those affecting economically important plants. Yet plant species in cultivation represent a small and biased subset of the plant kingdom. Here, we describe virus diversity and abundance in 1,079 transcriptomes from species across the breadth of the plant kingdom (Archaeplastida) by analyzing open-source data from the 1000 Plant Transcriptomes Initiative (1KP). We identified 104 potentially novel viruses, of which 40% were single-stranded positive-sense RNA viruses across eight orders, including members of the Hepelivirales, Tymovirales, Cryppavirales, Martellivirales, and Picornavirales. One-third of the newly described viruses were double-stranded RNA viruses from the orders Durnavirales and Ghabrivirales. The remaining were negative-sense RNA viruses from the Rhabdoviridae, Aspiviridae, Yueviridae, and Phenuiviridae and the newly proposed Viridisbunyaviridae. Our analysis considerably expands the known host range of 13 virus families to include lower plants (e.g., Benyviridae and Secoviridae) and 4 virus families to include alga hosts (e.g., Tymoviridae and Chrysoviridae). More broadly, however, a cophylogeny analysis revealed that the evolutionary history of these families is largely driven by cross-species transmission events. The discovery of the first 30-kDa movement protein in a nonvascular plant suggests that the acquisition of plant virus movement proteins occurred prior to the emergence of the plant vascular system. Together, these data highlight that numerous RNA virus families are associated with older evolutionary plant lineages than previously thought and that the apparent scarcity of RNA viruses found in lower plants likely reflects a lack of investigation rather than their absence. IMPORTANCE Our knowledge of plant viruses is mainly limited to those infecting economically important host species. In particular, we know little about those viruses infecting basal plant lineages such as the ferns, lycophytes, bryophytes, and charophytes. To expand this understanding, we conducted a broad-scale viral survey of species across the breadth of the plant kingdom. We found that basal plants harbor a wide diversity of RNA viruses, including some that are sufficiently divergent to likely compose a new virus family. The basal plant virome revealed offers key insights into the evolutionary history of core plant virus gene modules and genome segments. More broadly, this work emphasizes that the scarcity of viruses found in these species to date most likely reflects the limited research in this area.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Rift Valley Fever Outbreak during COVID-19 Surge, Uganda, 2021.

Rift Valley fever, endemic or emerging throughout most of Africa, causes considerable risk to human and animal health. We report 7 confirmed Rift Valley fever cases, 1 fatal, in Kiruhura District, Uganda, during 2021. Our findings highlight the importance of continued viral hemorrhagic fever surveillance, despite challenges associated with the COVID-19 pandemic.

Crimean-Congo Hemorrhagic Fever Outbreak in Refugee Settlement during COVID-19 Pandemic, Uganda, April 2021.

Crimean-Congo hemorrhagic fever (CCHF) was detected in 2 refugees living in a refugee settlement in Kikuube district, Uganda. Investigations revealed a CCHF IgG seroprevalence of 71.3% (37/52) in goats within the refugee settlement. This finding highlights the need for a multisectoral approach to controlling CCHF in humans and animals in Uganda.

Characterization of tulip streak virus, a novel virus associated with the family Phenuiviridae.

In Japan, tulip-growing areas have been plagued by viral diseases for decades, but the viruses causing the damage remain undescribed. In this study, Nicotiana benthamiana and Chenopodium quinoa plants mechanically inoculated with crude sap from a symptomatic tulip flower exhibited necrosis symptoms. Additionally, flexuous and filamentous virus particles were detected by electron microscopy analysis. Moreover, we determined the complete sequences of two genomic segments of the tulip streak virus (TuSV), which is a new virus associated with streaking symptoms, on the basis of a next-generation sequencing analysis. Homology analyses of the amino acid sequence of RNA-dependent RNA polymerase and the terminal sequence of the genomic RNA indicated that TuSV is associated with viruses in the family Phenuiviridae, but differs substantially from other reported viruses.

Ever-increasing viral diversity associated with the red imported fire ant Solenopsis invicta (Formicidae: Hymenoptera).

BACKGROUND: Advances in sequencing and analysis tools have facilitated discovery of many new viruses from invertebrates, including ants. Solenopsis invicta is an invasive ant that has quickly spread worldwide causing significant ecological and economic impacts. Its virome has begun to be characterized pertaining to potential use of viruses as natural enemies. Although the S. invicta virome is the best characterized among ants, most studies have been performed in its native range, with less information from invaded areas. METHODS: Using a metatranscriptome approach, we further identified and molecularly characterized virus sequences associated with S. invicta, in two introduced areas, U.S and Taiwan. The data set used here was obtained from different stages (larvae, pupa, and adults) of S. invicta life cycle. Publicly available RNA sequences from GenBank's Sequence Read Archive were downloaded and de novo assembled using CLC Genomics Workbench 20.0.1. Contigs were compared against the non-redundant protein sequences and those showing similarity to viral sequences were further analyzed. RESULTS: We characterized five putative new viruses associated with S. invicta transcriptomes. Sequence comparisons revealed extensive divergence across ORFs and genomic regions with most of them sharing less than 40% amino acid identity with those closest homologous sequences previously characterized. The first negative-sense single-stranded RNA virus genomic sequences included in the orders Bunyavirales and Mononegavirales are reported. In addition, two positive single-strand virus genome sequences and one single strand DNA virus genome sequence were also identified. While the presence of a putative tenuivirus associated with S. invicta was previously suggested to be a contamination, here we characterized and present strong evidence that Solenopsis invicta virus 14 (SINV-14) is a tenui-like virus that has a long-term association with the ant. Furthermore, based on virus sequence abundance compared to housekeeping genes, phylogenetic relationships, and completeness of viral coding sequences, our results suggest that four of five virus sequences reported, those being SINV-14, SINV-15, SINV-16 and SINV-17, may be associated to viruses actively replicating in the ant S. invicta. CONCLUSIONS: The present study expands our knowledge about viral diversity associated with S. invicta in introduced areas with potential to be used as biological control agents, which will require further biological characterization.

Viral discovery and diversity in trypanosomatid protozoa with a focus on relatives of the human parasite Leishmania.

Knowledge of viral diversity is expanding greatly, but many lineages remain underexplored. We surveyed RNA viruses in 52 cultured monoxenous relatives of the human parasite Leishmania (Crithidia and Leptomonas), as well as plant-infecting PhytomonasLeptomonas pyrrhocoris was a hotbed for viral discovery, carrying a virus (Leptomonas pyrrhocoris ostravirus 1) with a highly divergent RNA-dependent RNA polymerase missed by conventional BLAST searches, an emergent clade of tombus-like viruses, and an example of viral endogenization. A deep-branching clade of trypanosomatid narnaviruses was found, notable as Leptomonas seymouri bearing Narna-like virus 1 (LepseyNLV1) have been reported in cultures recovered from patients with visceral leishmaniasis. A deep-branching trypanosomatid viral lineage showing strong affinities to bunyaviruses was termed "Leishbunyavirus" (LBV) and judged sufficiently distinct to warrant assignment within a proposed family termed "Leishbunyaviridae" Numerous relatives of trypanosomatid viruses were found in insect metatranscriptomic surveys, which likely arise from trypanosomatid microbiota. Despite extensive sampling we found no relatives of the totivirus Leishmaniavirus (LRV1/2), implying that it was acquired at about the same time the Leishmania became able to parasitize vertebrates. As viruses were found in over a quarter of isolates tested, many more are likely to be found in the >600 unsurveyed trypanosomatid species. Viral loss was occasionally observed in culture, providing potentially isogenic virus-free lines enabling studies probing the biological role of trypanosomatid viruses. These data shed important insights on the emergence of viruses within an important trypanosomatid clade relevant to human disease.

First report of watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2 infecting watermelon (Citrullus lanatus) in the United States.

Watermelon (Citrullus lanatus) and other cucurbits are cultivated globally, and Texas ranks among its top 5 producers in the U.S. In July 2020, plants with virus-like disease symptoms consisting of mild leaf crinkling and yellow mosaic patterns were observed in a 174-ha watermelon field in Burleson Co., TX; disease incidence was visually estimated at 5%. Total nucleic acids were extracted from leaf tissues of 5 randomly sampled plants (Dellaporta 1983) and their equimolar amounts were made into a composite sample that was used for cDNA library construction with TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina). The cDNA library was sequenced on the Illumina NextSeq 500 platform, generating ~37M single-end reads (each 75 nt), which were analyzed as per Al Rwahnih et al. (2018). Of these, 58,200 and 27,500 reads mapped to the genomes of watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2 (Xin et al. 2017), respectively, along with 4 other virus-specific reads (data not shown). The near complete RNA1-RNA3 segments of WCLaV-1 (354-652X) and WCLaV-2 (144-258X) were generated from the mapped reads and they shared ≥96% nt identities with published RNA segments of both viruses. The results were verified by RT-PCR using newly designed primers WCLaV-1vRP: 5'-GGTGAGTTAGTGTGTCTGAAGG/WCLaV-1cRP: 5'-GAGGTTGCCTGAGGTGATAAG to target 881 bp of the RNA1-encoded RNA-dependent RNA polymerase (RdRP), WCLaV-1vMP: 5'-GAAGGTTTGCTCCCTTGAAATG/WCLaV-1cMP: 5'-GACTGTGGCTGAAGAGTCTATG target 538 bp of the RNA2-encoded movement protein (MP), and WCLaV-1vNP: 5'-CGAATAGACTCTGGAGGGTAGA/WCLaV-1cMP: 5'-GAAAGCAAGAAAGCTGGCTAAA target 786 bp of the RNA3-encoded nucleoprotein (NP). Similarly, the WWCLaV-2-specific primers WCLaV-2vRP: 5'-GTCTCACATTCCTGCACTAACT/WCLaV-2cRP: 5'-ATCGGTCCTGGGTTATTTGTATC target 968 bp of the RdRP, WCLaV-2vMP: 5'-GACTTCAGAACCTCAACATCCA/WCLaV-2cMP: 5'-CAAGGGAGAGTGCTGACAAA target 562 bp of the MP, and WCLaV-2vNP: 5'-ATTCCCAGTGAGAGCAACAA/WCLaV-2cMP: 5'-GAGGTGGAGGTAGGAAAGAAAG target 449 bp of the NP. Fresh cDNA synthesized from the 5 samples with PrimeScript First Strand cDNA synthesis kit (Takara Bio) were tested by PCR with all 6 primer pairs using the PrimeSTAR GXL DNA Polymerase kit (Takara Bio). Three of the 5 samples were positive for both viruses and one sample was positive for each virus. The obtained products from 4 samples were cloned individually into pJET1.2/Blunt vector (Thermo Scientific, USA), followed by bidirectional Sanger-sequencing of the plasmids with the GenElute Five-Minute Plasmid Miniprep kit (Sigma-Aldrich). In pairwise comparisons, the partial RNA1-RNA3 sequences of WCLaV-1 (GenBank accession nos. MW559074-82) shared 100% nt/aa identities with each other and with corresponding sequences of WCLaV-1 isolate KF-1 from China (KY781184-86). The partial RNA1-RNA3 sequences of WCLaV-2 (MW559083-91) shared 97-100% nt/96-100% aa identities with each other and with corresponding sequences of WCLaV-2 isolate KF-15 from China (KY781187-89). This is the first report of WCLaV-1 and WCLaV-2 in Texas and the first record of both viruses in the U.S. and elsewhere outside of China. Both negative-sense, single-stranded RNA viruses represent a novel taxon in the family Phenuiviridae (order Bunyavirales) (Xin et al. 2017). While aspects of the biology of both viruses are yet to be elucidated, our results expand their geographical range. The detection primers developed here will be useful for screening cucurbits germplasm to avert their spread.

Emerging Sand Fly-Borne Phlebovirus in China.

We isolated 17 viral strains capable of causing cytopathic effects in mammalian cells and death in neonatal mice from sand flies in China. Phylogenetic analysis showed that these strains belonged to the genus Phlebovirus. These findings highlight the need to control this potentially emerging virus to help safeguard public health.

ICTV Virus Taxonomy Profile: Nairoviridae.

Members of the family Nairoviridae produce enveloped virions with three single-stranded RNA segments comprising 17.1 to 22.8 kb in total. These viruses are maintained in arthropods and transmitted by ticks to mammals or birds. Crimean-Congo hemorrhagic fever virus is tick-borne and is endemic in most of Asia, Africa, Southern and Eastern Europe whereas Nairobi sheep disease virus, which is also tick-borne, causes lethal haemorrhagic gastroenteritis in small ruminants in Africa and India. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Nairoviridae, which is available at ictv.global/report/nairoviridae.

Discovery of Novel Thrips Vector Proteins That Bind to the Viral Attachment Protein of the Plant Bunyavirus Tomato Spotted Wilt Virus.

The plant-pathogenic virus tomato spotted wilt virus (TSWV) encodes a structural glycoprotein (GN) that, like with other bunyavirus/vector interactions, serves a role in viral attachment and possibly in entry into arthropod vector host cells. It is well documented that Frankliniella occidentalis is one of nine competent thrips vectors of TSWV transmission to plant hosts. However, the insect molecules that interact with viral proteins, such as GN, during infection and dissemination in thrips vector tissues are unknown. The goals of this project were to identify TSWV-interacting proteins (TIPs) that interact directly with TSWV GN and to localize the expression of these proteins in relation to virus in thrips tissues of principal importance along the route of dissemination. We report here the identification of six TIPs from first-instar larvae (L1), the most acquisition-efficient developmental stage of the thrips vector. Sequence analyses of these TIPs revealed homology to proteins associated with the infection cycle of other vector-borne viruses. Immunolocalization of the TIPs in L1 revealed robust expression in the midgut and salivary glands of F. occidentalis, the tissues most important during virus infection, replication, and plant inoculation. The TIPs and GN interactions were validated using protein-protein interaction assays. Two of the thrips proteins, endocuticle structural glycoprotein and cyclophilin, were found to be consistent interactors with GN These newly discovered thrips protein-GN interactions are important for a better understanding of the transmission mechanism of persistent propagative plant viruses by their vectors, as well as for developing new strategies of insect pest management and virus resistance in plants.IMPORTANCE Thrips-transmitted viruses cause devastating losses to numerous food crops worldwide. For negative-sense RNA viruses that infect plants, the arthropod serves as a host as well by supporting virus replication in specific tissues and organs of the vector. The goal of this work was to identify thrips proteins that bind directly to the viral attachment protein and thus may play a role in the infection cycle in the insect. Using the model plant bunyavirus tomato spotted wilt virus (TSWV), and the most efficient thrips vector, we identified and validated six TSWV-interacting proteins from Frankliniella occidentalis first-instar larvae. Two proteins, an endocuticle structural glycoprotein and cyclophilin, were able to interact directly with the TSWV attachment protein, GN, in insect cells. The TSWV GN-interacting proteins provide new targets for disrupting the viral disease cycle in the arthropod vector and could be putative determinants of vector competence.

Structural and functional similarities in bunyaviruses: Perspectives for pan-bunya antivirals.

The order of Bunyavirales includes numerous (re)emerging viruses that collectively have a major impact on human and animal health worldwide. There are no vaccines for human use or antiviral drugs available to prevent or treat infections with any of these viruses. The development of efficacious and safe drugs and vaccines is a pressing matter. Ideally, such antivirals possess pan-bunyavirus antiviral activity, allowing the containment of every bunya-related threat. The fact that many bunyaviruses need to be handled in laboratories with biosafety level 3 or 4, the great variety of species and the frequent emergence of novel species complicate such efforts. We here examined the potential druggable targets of bunyaviruses, together with the level of conservation of their biological functions, structure, and genetic similarity by means of heatmap analysis. In the light of this, we revised the available models and tools currently available, pointing out directions for antiviral drug discovery.

Tamdy Virus in Ixodid Ticks Infesting Bactrian Camels, Xinjiang, China, 2018.

We isolated Tamdy virus (TAMV; strain XJ01/TAMV/China/2018) from Hyalomma asiaticum ticks infesting Bactrian camels in Xinjiang, China, in 2018. The genome of the strain showed high nucleotide similarity with previously described TAMV strains from Asia. Our study highlights the potential threat of TAMV to public health in China.