Epithelial-Cell-Derived Extracellular Vesicles in Pathophysiology of Epithelial Injury and Repair in Chronic Rhinosinusitis: Connecting Immunology in Research Lab to Biomarkers in Clinics.

Epithelial barrier disruption and failure of epithelial repair by aberrant epithelial-mesenchymal transition (EMT)-induced basal cells observed in nasal mucosa of chronic rhinosinusitis (CRS) are speculated to play important roles in disease pathophysiology. Microparticles (MPs) are a type of extracellular vesicle (EV) released by budding or shedding from the plasma membrane of activated or apoptotic cells. MPs are detected in nasal lavage fluids (NLFs) and are now receiving attention as potential biomarkers to evaluate the degree of activation of immune cells and injury of structural cells in nasal mucosa of subjects with sinus disease. There are three types of epithelial-cell-derived MPs, which are defined by the expression of different epithelial specific markers on their surface: EpCAM, E-cadherin, and integrin ß6 (ITGB6). When these markers are on MPs that are also carrying canonical EMT/mesenchymal markers (Snail (SNAI1); Slug (SNAI2); alpha-smooth muscle actin (αSMA, ACTA2)) or pro- and anti-coagulant molecules (tissue factor (TF); tissue plasminogen activator (tPA); plasminogen activator inhibitor-1 (PAI-1)), they provide insight as to the roles of epithelial activation for EMT or regulation of coagulation in the underlying disease. In this review, we discuss the potential of epithelial MPs as research tools to evaluate status of nasal mucosae of CRS patients in the lab, as well as biomarkers for management and treatment of CRS in the clinic.

Protocadherin B9 promotes resistance to bicalutamide and is associated with the survival of prostate cancer patients.

Background Prostate cancer (PCa) is a common malignancy worldwide and is the second leading cause of cancer death in men. The standard therapy for advanced PCa is androgen deprivation therapy (ADT). Although ADT, including bicalutamide treatment, is initially effective, resistance to bicalutamide frequently occurs and leads to the development of castration-resistant PCa. Thus, clarifying the mechanisms of bicalutamide resistance is urgently needed. We designed this study to assess the expression and function of PCDHB9, which encodes the protocadherin B9 protein. Methods The expression of PCDHB9 was determined using immunohistochemistry and a qRT-PCR. The effects of the overexpression or knockdown of PCDHB9 on cell growth, migration, adhesion were evaluated. To evaluate the PCDHB9-mediated effects in PCa, we performed a gene expression analysis using DU145 transfected with PCDHB9. We examined the effects of PCDHB9 inhibition on bicalutamide resistance. Results The qRT-PCR revealed that the expression of PCDHB9 was much higher in PCa than that in non-neoplastic prostate tissues. In 152 clinically localized PCa cases immunohistochemistry showed that 59% of PCa cases were positive for protocadherin B9. A Kaplan-Meier analysis showed that the high expression of protocadherin B9 was associated with PSA recurrence after radical prostatectomy. A functional analysis showed that PCDHB9 modulated cell migration and adhesion. We also found that PCDHB9 induced the expression of ITGB6 based on a gene expression analysis. The effect of PCDHB9 inhibition on bicalutamide sensitivity was examined using MTT assays. The IC50 value of PCDHB9 siRNA-transfected PCa cells was significantly lower than that of negative control siRNA-transfected cells. Furthermore, immunohistochemical staining of protocadherin B9 in 74 PCa patients who were treated with androgen depletion therapy, including bicalutamide treatment, demonstrated that the high expression of protocadherin B9 was significantly associated with poor overall survival. Conclusions PCDHB9 plays an important role in the progression of PCa and bicalutamide resistance. Collectively, our results suggest that PCDHB9 targeted therapy may be more effective than bicalutamide alone.

Nudt3 is an mRNA decapping enzyme that modulates cell migration.

Removal of the 5'-end 7-methylguanosine cap structure is a critical step in the highly regulated process of mRNA decay. The Nudix hydrolase, Dcp2, was identified as a first decapping enzyme and subsequently shown to preferentially modulate stability of only a subset of mRNAs. This observation led to the hypothesis that mammalian cells possess multiple decapping enzymes that may function in distinct pathways. Here we report Nudt3 is a Nudix protein that possesses mRNA decapping activity in cells and is a modulator of MCF-7 breast cancer cell migration. Reduction of Nudt3 protein levels in MCF-7 cells promotes increased cell migration and corresponding enhanced filopodia extensions. Importantly, this phenotype was reversed by complementation with wild type, but not catalytically inactive Nudt3 protein indicating Nudt3 decapping activity normally functions to control cell migration. Genome-wide analysis of Nudt3 compromised cells identified elevated levels of transcripts involved in cell motility including integrin ß6, lipocalin-2, and fibronectin. The observed increase in mRNA abundance was dependent on Nudt3 decapping activity where integrin ß6 and lipocalin-2 were modulated directly through mRNA stability, while fibronectin was indirectly controlled. Moreover, increased cell migration observed in Nudt3 knockdown cells was mediated through the extracellular integrin ß6 and fibronectin protein nexus. We conclude that Nudt3 is an mRNA decapping enzyme that orchestrates expression of a subset of mRNAs to modulate cell migration and further substantiates the existence of multiple decapping enzymes functioning in distinct cellular pathways in mammals.

HR+HER2- breast cancers with growth factor receptor-mediated EMT have a poor prognosis and lapatinib downregulates EMT in MCF-7 cells.

Despite an overall good prognosis, a significant proportion of patients with hormone receptor positive human epidermal growth factor receptor 2 negative breast cancers develop distant metastases. The metastatic potential of epithelial cells is known to be regulated by tumor-stromal interaction and mediated by epithelial-to-mesenchymal transition. Hormone receptor positive human epidermal growth factor receptor 2 negative tumors were used to estimate markers of epithelial-to-mesenchymal transition, and the luminal breast cancer cell line MCF-7 was used to examine the interactions between integrins and growth factor receptors in causation of epithelial-to-mesenchymal transition. A total of 140 primary tumors were sub-divided into groups enriched for the markers of epithelial-to-mesenchymal transition (snail family transcriptional repressor 2 and integrin ß6) versus those with low levels. Within the epithelial-to-mesenchymal transition+ tumors, there was a positive correlation between the transcripts of integrin ß6 and growth factor receptors-human epidermal growth factor receptor 2 and epidermal growth factor receptor. In tumors enriched for epithelial-to-mesenchymal transition markers, patients with tumors with the highest quartile of growth factor receptor transcripts had a shorter disease-free survival compared to patients with low growth factor receptor expression by Kaplan-Meier analysis (log rank, p = 0.03). Epithelial-to-mesenchymal transition was induced in MCF-7 cells by treatment with transforming growth factor beta 1 and confirmed by upregulation of SNAI1 and SNAI2 transcripts, increase of vimentin and integrin ß6 protein, and repression of E-cadherin. Treatment of these cells with the dual-specificity tyrosine-kinase inhibitor lapatinib led to downregulation of epithelial-to-mesenchymal transition as indicated by lower levels of SNAI1 and SNAI2 transcripts, integrin αvß6, and matrix metalloproteinase 9 protein. The results suggest that synergistic interactions between growth factor receptors and integrin ß6 could mediate epithelial-to-mesenchymal transition and migration in a subset of luminal breast cancers and lapatinib might be effective in disrupting this interaction.

Integrin ß6 acts as an unfavorable prognostic indicator and promotes cellular malignant behaviors via ERK-ETS1 pathway in pancreatic ductal adenocarcinoma (PDAC).

Pancreatic ductal adenocarcinoma (PDAC) remains one of the most deadly cancers and is expected to become the second leading cause of cancer death by 2030. Despite extensive efforts to improve surgical treatment, limited progress has been made. Increasing evidence indicates that integrin ß6 plays a crucial role in carcinoma invasion and metastasis. However, the expression and role of ß6 in PDAC remain largely unknown. In the present study, we investigated the expression of ß6 in PDAC and its potential value as a prognostic factor and therapeutic target. ß6 upregulation was identified as an independent unfavorable prognostic indicator. Integrin ß6 markedly promoted the proliferation and invasion of pancreatic carcinoma cells and induced ETS1 phosphorylation in an ERK-dependent manner, leading to the upregulation of matrix metalloprotease-9, which is essential for ß6-mediated invasiveness of pancreatic carcinoma cells. Accordingly, small interfering RNA-mediated silencing of integrin ß6 markedly suppressed xenograft tumor growth in vivo. Taken together, our results suggest that integrin ß6 plays important roles in the progression of pancreatic carcinoma and contributes to reduced survival times, and may serve as a novel therapeutic target for the treatment of PDAC.

Integrin ß6 mediates epithelial-mesenchymal transition in diabetic kidney disease.

The progression of diabetic kidney disease (DKD) is associated with increased fibronectin (FN) levels in proximal tubular epithelial cells. Bioinformatics analysis showed that integrin ß6 and cell adhesion function were significantly changed in the cortices of db/db mice. Remodelling of cell adhesion is one of the core changes during epithelial-mesenchymal transition (EMT) in DKD. Integrin is a family of transmembrane proteins that regulates cell adhesion and migration, and extracellular FN is the major ligand of integrin ß6. We found that the expression of integrin ß6 was elevated in the proximal tubules of db/db mice and FN-induced renal proximal tubule cells. The levels of EMT were also significantly increased in vivo and in vitro. In addition, FN treatment activated the Fak/Src pathway, increased the expression of p-YAP, and then upregulated the Notch1 pathway in diabetic proximal tubules. Knockdown of integrin ß6 or Notch1 reduced the EMT aggravation induced by FN. Furthermore, urinary integrin ß6 was significantly increased in DKD patients. Our findings reveal a critical role of integrin ß6 in regulating EMT in proximal tubular epithelial cells and identify a novel direction for the detection and treatment of DKD.

Identification of integrin ß6 gene promoter and analysis of its transcription regulation in colon cancer cells.

BACKGROUND: The integrin ß6 gene, which is expressed in epithelial cancer, plays a pivotal role in various aspects of cancer progression. The present research for integrin ß6 regulation mainly focuses on the post-transcription and translation related regulation mechanism and its role in tumorigenesis. The mechanisms of how the integrin ß6 gene is regulated transcriptionally, and the promoter and transcription factors responsible for basic transcription of integrin ß6 gene remain unknown. AIM: To clone and characterize the integrin ß6 promoter. METHODS: Software analysis was used to predict the region of integrin ß6 promoter. Luciferase reporter plasmids, which contained the integrin ß6 promoter, were constructed. Element deletion analysis was performed to identify the location of core promoter and binding sites for transcription factors. RESULTS: The regulatory elements for the transcription of the integrin ß6 gene were located between -286 and -85 and contained binding sites for transcription factors such as STAT3 and Ets-1. CONCLUSION: For the first time, we found the region of ß6 core promoter and demonstrated the binding sites for transcription factors such as Ets-1 and STAT3, which are important for integrin ß6 promoter transcription activity. These findings are important for investigating the mechanism of integrin ß6 activation in cancer progression.

Transforming growth factor-ß1 and lysophosphatidic acid activate integrin ß6 gene promoter in Hep-3B cells.

Although it is difficult to detect αvß6 integrin (αvß6) in normal epithelia cells, its expression is upregulated during wound healing and carcinogenesis. Overexpression of αvß6 has been demonstrated in epithelial cell carcinomas, such as adenocarcinoma of the colon and ovary. However, the expression of αvß6 has not been reported in hepatocellular carcinoma (HCC). We previously indicated that LPA may induce αvß6-mediated TGF-ß1 signaling mechanisms during the pathogenesis of lung injury and fibrosis. In addition, transforming growth factor-ß1 (TGF-ß1) and lysophosphatidic acid (LPA) have been demonstrated to participate in the progression of HCC. In the present study, we hypothesized that TGF-ß1 and LPA would serve a key role in the subunit integrin ß6 (Itgß6) transcriptional regulatory mechanism in HCC. It was identified that human HCC tissues and Hep-3B cells expressed Itgß6. Treatment of Hep-3B with TGF-ß1 or LPA increased the expression of Itgß6. Furthermore, truncation experiments indicated a positive regulatory region at -326 to -157 bp of the Itgß6 promoter. TGF-ß1 and LPA increased transcriptional activation at this regulatory region. To the best of our knowledge, the present study was the first to demonstrate Itgß6 expression in HCC, and the data indicate that TGF-ß1 and LPA regulate Itgß6 expression through the Itgß6 gene promoter, which is an important factor in the development of HCC.

The clinical significance and underlying correlation of pStat-3 and integrin αvß6 expression in gallbladder cancer.

BACKGROUND: Both phosphorylated signal transducer and activator of transcription 3(pStat-3) and integrin αvß6 can play vital role in the development and progression of cancer. However, little is known about their expression correlation and clinical significance in gallbladder cancer(GBC). OBJECTIVE: The aim of our present study was to investigate the expression of pStat-3 and integrin αvß6, two proteins' correlation and their clinical significance in GBC tissues. RESULTS: The expression of pStat-3 and integrin αvß6 were both significantly associated with T stage, lymph node metastasis status, TNM stage (P=0.008, P=0.000, P=0.000 and P=0.036, P=0.001,P=0.000,respectively). IHC and Western blot showed their expressions in GBC tissues were higher than that in paraneoplastic tissues. Moderate positive correlation existed between the two proteins (r =0.349, P <0.001). The survival analysis by Kaplan-Meier and Cox regression model showed that GBC patients with pStat-3 or integrin αvß6 positive expression had a significantly poorer 2-year survival rate (P = 0.002 and 0.000, the log-rank test, respectively), and either marker could act as unfavorable independent prognostic factors(RR=1.907, P=0.021 and RR=2.046, P=0.038). MATERIALS AND METHODS: The expression levels of pStat-3 and integrin αvß6 were analyzed in GBC cancerous and paraneoplastic tissues of 97 cases via immunohistochemistry(IHC) and further validated by western blot method. Besides, SPSS software was used to observe their clinical significance as well as the two proteins' correlation. CONCLUSION: pStat-3 and integrin αvß6 were indicators of tumor's progression and poor prognosis of patients with GBC. And the further study involving them may provide a helpful therapeutic target in prevention and treatment of GBC patients.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin ß6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin ß6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin ß6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin ß6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin ß6.

Clinical significance of integrin ß6 as a tumor recurrence factor in follicular thyroid carcinoma.

BACKGROUND: Overexpression of integrin ß6 plays an important role in a variety of malignant tumor invasion and metastasis. METHODS: The expression levels of integrin ß6, matrix metalloproteinase (MMP)-2 and MMP-9 were analyzed by immunohistochemistry with human follicular thyroid carcinomas. Then we investigated their correlation with clinical outcomes parameters, relationship, and the survival time. RESULTS: The integrin ß6 staining was expressed in cellular membrane and cytoplasm of follicular thyroid carcinoma cells. The MMP-2 and MMP-9 expressions were mainly found in cellular cytoplasm. In correlation with the clinical outcome parameters of 60 patients, there were significant statistical differences of integrin ß6, MMP-2, and MMP-9 expression levels in different size of tumor. Integrin ß6 and MMP-9 expressions have significant statistical differences in T classifications. MMP-2 and MMP-9 expressions have significant statistical differences in different M classification. Other clinical outcome parameters had no significant statistical differences. CONCLUSION: Integrin ß6 expression correlated significantly with MMP-9 expression, and may be a valuable recurrence indicator for follicular thyroid carcinomas.

The cytoplasmic extension of the integrin ß6 subunit regulates epithelial-to-mesenchymal transition.

Prognosis for oral cancer patients has not improved in over 60 years due to invasion and recurrence. To understand the invasive behavior of this tumor, we evaluated the role of the αvß6 integrin. Invasive oral SCC cells express the αvß6 integrin, which contains an 11-amino-acid extension on its ß-subunit unique to the integrin family. We determined that this ß6 cytoplasmic extension regulates the composition of the intermediate filament network and the organization of signaling structures called focal contacts. The auto-phosphorylation of FAK, which is localized to focal contacts, was also regulated by the ß6-cytoplasmic tail, as were the transcription factors Notch and STAT3. Lastly, we also determined that activation of MAPK required the full-length ß6 integrin. Together these results indicate that the signaling critical to epithelial-to-mesenchymal transition (EMT) is regulated by the ß6 integrin cytoplasmic domain.