Ingestion of fishing gear and Anisakis sp. infection in a beached Indo-Pacific finless porpoise (Neophocaena phocaenoides) in the Jeju Island, Republic of Korea: findings from post-mortem computed tomography and necropsy.

BACKGROUND: Human fishing activities have significantly affect environmental concern for marine ecosystems, conservation of marine mammals, and human health. Coastal cetaceans are highly vulnerable to ingestion of fishing gear, bycatching, or entanglement, all of which can be fatal for these animals. In particular, certain coastal dolphins and porpoises are heavily impacted by fishing gear such as angling gear or stownet, as their food often overlap with the target fish species of human fisheries. CASE PRESENTATION: This study presents a case of an Indo-Pacific finless porpoise (Neophocaena phocaenoides) beached on the coast of Jeju Island, Republic of Korea, with ingestion of fishing gear and severe Anisakis infection. Although this species inhabits waters ranging from the Persian Gulf to Taiwan, several stranded carcasses have been reported on Jeju Island in recent years. Post-mortem computed tomography revealed a bundle of four fishing hooks in the forestomach, along with nylon lines and steel lines with connectors, which were assumed to be angling gear for Jeju hairtail (Trichiurus lepturus). Further necroscopic investigation revealed that the forestomach contained a large number of Anisakis spp. (Nematoda: Anisakidae). Histological examination revealed a thickened forestomach wall with pinpoint and volcanic ulcerations, a thickened layer of stratified squamous epithelium, and infiltrated stroma in the squamous epithelium. CONCLUSIONS: This study emphasizes the urgent need to address the impact of fishing activities on marine mammals, marine litter pollution, and the bycatch problem in Korean seawater. In addition, the occurrence of N. phocaenoides in seawater around Jeju Island should be raised in future geographical ecology or veterinary pathology studies and when its distribution is updated.

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco.

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

Increasing intensities of Anisakis simplex (Rudolphi, 1809 det. Krabbe, 1878) larvae with weight and sea age in returning adult Atlantic salmon, Salmo salar L., of coastal waters of Norway.

Ninety wild Atlantic salmon, Salmo salar L., (1.5-10.3 kg) were caught in the Namsen Fjord near the mouth of River Namsen, mid-Norway, and examined for the presence and distribution of Anisakis simplex (Rudolphi, 1809 det. Krabbe, 1878) larvae by digestion of the viscera and muscles in a pepsin/HCl solution. All salmon were migrating spawners after 1-4 years of feeding in the Atlantic Ocean. All 90 Atlantic salmon had A. simplex larvae in the viscera, and all, except two, had A. simplex larvae in the musculature. The number of A. simplex larvae in each fish varied between 3 and 181, and the total mean number of nematode larvae was 44.5. The intensity of A. simplex larvae was positively correlated with increasing weight and sea age of the host. However, the proportion of larvae in the muscle fillets decreased with increasing host weight and sea age. Atlantic salmon females had more A. simplex larvae than males. In all the fish examined, 70.2% of the A. simplex larvae were found in the viscera and 29.8% in the musculature. The majority (93%) of the larvae in the musculature occurred in the hypaxial sections anterior to the anus. As A. simplex larvae commonly occur in the musculature of wild Atlantic salmon, consumption of unfrozen, raw or semi-raw musculature represents a risk for humans developing anisakiasis.

The occurrence of Anisakis spp. in Australian waters: past, present, and future trends.

As one of the world's megadiverse countries, Australian biodiversity is vital for global biodiversity. Nematodes belonging to the genus Anisakis (family Anisakidae) are an important part of this biodiversity due to their ability to be repeatedly transmitted among their intermediate hosts before reaching the top of the food pyramid. Therefore, they have a significant impact on the community structures of various ecosystems. In addition, globally, they are known to be of medical and veterinary significance. The aim of this article is to provide an update on the current knowledge about these important parasites in Australia. Since 1916, a total of 234 records of Anisakis spp. from various hosts and localities have been found in Australia. It is estimated that the occurrence of Anisakis spp. and their health impacts in at least 84, 98.5, and 95% of Australian marine mammals, fish, and water birds, respectively, have not been documented yet. The results of this study suggest Australia is perhaps home to the most diverse Anisakis fauna. Available information is dominated by reports of these parasites in fish hosts, many of them among edible fish. Given the popularity of seafood in Australia and the occurrence of infectious stages of Anisakis spp. in edible fish, all stakeholders should be made aware of the occurrence, prevalence, and survival of Anisakis spp. in seafood. Also, as more pet owners feed their pets with a variety of fish and seafood products, it is important for veterinarians to be aware of seafood transmitted Anisakis spp. in pet animals. This study also highlights several important knowledge gaps: (i) The detailed life cycle of Anisakis spp. in Australia is not known. Detecting their first intermediate hosts is important for better management of crustacean zooplankton populations in our waters. (ii) Research on Anisakis spp. in Australia has been restricted to limited taxonomical studies and should extend to other aspects of these important parasites. (iii) The capacity to identify parasite taxa to species is especially important for resolving biological diversity around Australia; however, opportunities to formally train in parasite taxonomy are rare and diminishing. There is a need to train researchers with taxonomy skills. (iv) Given the vast range of biodiversity in Australia and the broad host-specificity of Anisakis spp., particularly in the larval stages, the full range of their intermediate hosts remains unknown. (v) The health impacts of the infection of the intermediate/definitive hosts with Anisakis spp. are not fully understood. Thus, one of the important areas for future studies is investigating the pathogenicity of Anisakis spp. in affected animals. This is a crucial yet unknown factor for the conservation of some endangered species in Australia.

Genetic identification of Anisakis spp. (Nematoda: Anisakidae) from cetaceans of the Southwestern Atlantic Ocean: ecological and zoogeographical implications.

Adult Anisakis Dujardin, 1845 were found in two specimens of killer whale Orcinus orca and one specimen of franciscana Pontoporia blainvillei stranded from off the coast of Buenos Aires Province, Argentina. Genetic identification of the nematodes (N = 144) was performed by sequence analysis of the mitochondrial (mtDNA cox2) and the nuclear (nas 10 nDNA) gene loci. Anisakis pegreffii and Anisakis berlandi were detected in the two individuals of O. orca, while Anisakis typica and A. pegreffii were identified in P. blainvillei. Morphological and morphometric analysis also carried out on adult specimens of A. pegreffii and A. berlandi has allowed to underlining the usefulness of genetic/molecular markers in their recognition. This represents the first record of A. pegreffii in O. orca and P. blainvillei and of A. berlandi in O. orca. This is also the first sympatric and syntopic occurrence, as adults, of A. pegreffii and A. berlandi from the Austral Region of the Atlantic Ocean waters. These results provide insights into the knowledge of the host ranges and geographical distribution of these parasites in the basin waters of the region. Pontoporia blainvillei showed low abundance values of infection with Anisakis spp., which is the general pattern for coastal dolphins in the area, whereas O. orca harboured higher abundance of Anisakis spp. than those previously recorded among cetacean species in the Argentine Sea. Differences in the Anisakis spp. distribution and their parasitic loads, observed among the three host specimens, are discussed in relation to the oceanographic parameters, as well as to the host ecology. The usefulness of genetic/molecular markers in the recognition of adults of the sibling species A. pegreffii and A. berlandi with considerable overlapping in morphometric and morphological characters was underlined. The distribution of Anisakis species from Southwestern Atlantic waters is discussed in relation to their value as indicators for studies on the zoogeography of their hosts at a regional-scale level.

Species composition and infection levels of Anisakis (Nematoda: Anisakidae) in the skipjack tuna Katsuwonus pelamis (Linnaeus) in the Northwest Pacific.

Parasites can be used as biological tags to assess stock structures in various marine fish species. In the present study, the species composition and infection levels of parasitic nematodes of the genus Anisakis in the skipjack tuna Katsuwonus pelamis were examined in the Northwest Pacific and adjacent seas. A total of 867 third-stage larvae of Anisakis were collected from 112 skipjack tunas captured around Japan and in other subtropical localities. All larvae were identified as A. berlandi, A. pegreffii, A. simplex (s.s.), A. typica, and A. physeteris (s.l.) by the direct sequencing of the mitochondrial cox2 gene and real-time PCR assays targeting the nuclear ITS region. Anisakis species composition differed among northeastern Japan, the Sea of Japan, and other areas (central Japan, the Nansei Islands, and subtropical region), which is largely concordant with previous stock discrimination of skipjack tuna. Molecular phylogenetic analysis resulted in two intraspecific genetic groups in A. simplex (s.s.), one of which occurred almost exclusively in northeastern Japan. This could be a useful indicator for stock discrimination. Skipjack tunas from northeastern Japan were also characterized by a remarkable variety in the intensity of A. simplex (s.s.), suggesting the commingling of individuals with different migration patterns. This idea might be further justified by the geographic distribution of two genetically distinct groups of A. physeteris (s.l.).

Estimation of the number of Anisakis larvae in commercial fish using a descriptive model based on real-time PCR.

BACKGROUND: Seafood parasitation by Anisakis (Anisakidae) larvae has been reported in most of the oceans and seas worldwide. The presence of these nematodes in commonly consumed fish represents a potential hazard for consumers as they can provoke gastrointestinal symptoms and allergic reactions. In the present work, the capacity of a SYBR Green qPCR protocol to quantify Anisakis larvae in commercial fish was evaluated using experimentally spiked samples with different numbers (0-50) of A. simplex third-stage larvae (L3). To verify the agreement of the obtained results, 25 naturally infected fish specimens of Atlantic blue whiting underwent a parallel visual inspection. RESULTS: The logarithmic behavior of the Cq data obtained from the experimentally spiked samples allowed the development of a descriptive mathematical model that correlates the Cq value with the number of Anisakis larvae (R2 = 0.9908, CV = 2.37%). In the commercial blue whiting specimens there was a high correlation between the results of the molecular technique and the visual inspection (R2 = 0.9912); the Bland-Altman analysis showed that 94% of the differences were within the limits of agreement (-4.98 and 6.68), indicating the reliability of the descriptive mathematical model based on the SYBR Green qPCR technique. CONCLUSION: The descriptive function presented based on the SYBR Green qPCR assay is promising as a sensitive and accurate tool for measuring the Anisakis larval load in commercial fish, with a potential application not only in the food industry but also in prevention programs for public health. © 2020 Society of Chemical Industry.

Risk-based scoring and genetic identification for anisakids in frozen fish products from Atlantic FAO areas.

BACKGROUND: The presence of Anisakis larvae in fish represents a major public health concern. Effective risk management procedures should be applied to prevent heavily infected products from reaching the market. The aim of the study is to provide preliminary data on parasite exposure and risk classification in frozen fish products by applying a risk categorization scheme (site, abundance, density and epidemiology - SADE) and Fish Parasite Rating (FPR) method. Fish and cephalopods samples (N = 771) from 5 different FAO Atlantic areas were examined and categorized after an accurate visual inspection and a chloro-peptic digestion. RESULTS: In 25 out of 33 fish species parasite larvae were found. 10897 anisakids larvae were collected and identified to genus level. Molva dypterygia, Conger conger, Zeus faber and Aphanopus carbo were shown to be the most highly infected species. SADE and FPR scores were 1 and poor, respectively, for the referred species, because of the disseminated Anisakis infection and commercial rejection. CONCLUSION: SADE/FPR method showed high specificity and accuracy. The information provided in this work could be used in early warning systems for the detection of parasites in fishery products and might help fishing industries in establishing management strategies for infected stocks in terms of cost saving decisions.

Anisakid nematode larvae in the liver of Atlantic cod Gadus morhua L. from West Greenland.

Anisakid nematode larvae occur frequently in the liver of Atlantic cod, but merely few infection data from cod in waters around Greenland exist. The present study reports the occurrence of third-stage anisakid larvae in the livers of 200 Atlantic cod caught on fishing grounds along the West coast of Greenland (fjord systems of Maniitsoq) in May, June, August and September 2017. Classical and molecular helminthological techniques were used to identify the nematodes. A total of 200 cod livers were examined, and 194 were infected with third-stage nematode larvae (overall prevalence of infection 97%) with a mean intensity of 10.3 (range between 1 and 44 parasites per fish). Prevalences recorded were 96% for Anisakis simplex (s.l.), 55% for Pseudoterranova decipiens (s.l.) and 8% for Contracaecum osculatum (s.l.). Sequencing the mtDNA cox2 from 8 out of 23 these latter larvae conferred these to C. osculatum sp. B. A clear seasonal variation was observed, with a rise in A. simplex (s.l.) and P. decipiens (s.l.) occurrence in June and August and a decline in September. The study may serve as a baseline for future investigations using the three anisakids as biological indicators in Greenland waters.

Occurrence of larval anisakids in horse mackerel (Trachurus trachurus) caught in Portuguese waters.

The third-stage larvae (L3) of the Anisakidae family are parasitic nematodes with zoonotic impact and are frequently encountered in the organs and musculature of various fish intended for human consumption. Since Anisakis simplex (s.s.) and A. pegreffii are the major aetiological agents of human disease, this study aims to combine the morphological and molecular data on the recovered anisakid larvae to contribute to a simplified morphological distinction of those species and conducted a survey of anisakid larvae infection in horse mackerel (Trachurus trachurus). Here, 116 horse mackerel caught in Portuguese waters were analysed for the presence of L3 of anisakids, and 3148 larvae were collected, of which only 30% were retrieved during visual inspection. As such, visual inspection does not appear to be very effective in anisakid detection. A prevalence of 84.5% of infected fish was found, and the mean intensity and mean abundance were 32.1 and 27.1 parasites per fish, respectively. The morphological and molecular analyses of 196 L3 randomly chosen from the total sample of parasites demonstrated the presence of L3 of mostly Anisakis spp., with only one L3 of Hysterothylacium aduncum. Relative frequencies of 62.9% for A. pegreffii and 37.1% for A. simplex (s.s.) were obtained. The morphometry differences between these two sibling species were evaluated, and the results demonstrated significant differences between the length of the ventriculus and the length of the oesophagus. Precisely, A. simplex (s.s.) has a longer oesophagus and ventriculus than A. pegreffii. As such, these differences may be used to distinguish the two species through morphological analysis.

A new species of Contracaecum (Nematoda: Anisakidae) found parasitizing Nannopterum brasilianus (Suliformes: Phalacrocoracidae) and Hoplias argentinensis (Characiformes: Erythrinidae) in South America: morphological and molecular characterization of larval and adult stages.

Nematode species of the genus Contracaecum Railliet & Henry, 1912 have been reported around the world in many species of fish-eating birds and seals. Here, Contracaecum jorgei n. sp. is morphologically described using light and scanning electron microscopy for adults and fourth-stage larvae (L4) found in the bird Nannopterum brasilianus and third-stage larvae (L3) found in the freshwater fish Hoplias argentinensis, both from the province of Córdoba, Argentina. Additionally, sequences of cytochrome c oxidase subunit II were obtained from these specimens and molecular phylogenetic analysis was used to determine its relationships within the genus. The present species is distinguished from other species by the number and disposition of cephalic papillae; shape and size of the interlabia; length of the spicules; and number and arrangement of papillae in the posterior end of the male. Furthermore, in the molecular analyses, sequences obtained from adult L4 and L3 specimens of C. jorgei n. sp. were similar and grouped, forming an independent lineage, thus confirming it as a distinct species. Thus, morphological characteristics associated with molecular data support the proposal of a new species.

First evidence of the presence of Anisakis simplex in Crangon crangon and Contracaecum osculatum in Gammarus sp. by in situ examination of the stomach contents of cod (Gadus morhua) from the southern Baltic Sea.

Cod (Gadus morhua), an important fish species in the Baltic Sea, is the paratenic host for many parasite species, including the zoonotic nematodes, Anisakis sp. and Contracaecum osculatum. We aimed to identify which invertebrate species (found in situ in the fish stomach) are responsible for infection of cod with zoonotic nematodes. We found that Crangon crangon and Gammarus sp., both invertebrate prey species of cod, were infected with Anisakis simplex and C. osculatum, respectively. These host-parasite systems are reported here for the first time, implicating C. crangon and Gammarus sp. as sources of infection of Baltic cod with zoonotic nematodes.

The hidden companion of non-native fishes in north-east Atlantic waters.

A tropicalization phenomenon of ichthyofauna has been described in the last decades in Galicia (north-eastern Atlantic), with increasing reports of tropical and subtropical fishes appearing northward this distribution range. A search for parasites was carried out in the digestive tract of two specimens first captured in Galician waters: the prickly puffer Ephippion guttifer (Tetraodontidae) and the African stripped grunt Parapristipoma octolineatum (Haemulidae). Examination of E. guttifer showed high intensity of nematodes, from three different genera: Cucullanus (Cucullanidae), Hysterothylacium (Raphidascaridae) and Anisakis (Anisakidae), with demonstrated pathogenicity to humans. Molecular identification allowed the identification of Anisakis pegreffii, already described in the area, and first reports for European waters of Cucullanus dodsworthi, Hysterothylacium reliquens and a new Hysterothylacium sp. P. octolineatum showed a far lower level of parasitization, with two Hysterothylacium larvae, genetically identified as Hysterothylacium deardorffoverstreetorum, also its first report in the eastern Atlantic. Thus, possible ecological impact of the occurrence of two non-native individual fishes in a new area could be remarkably higher if we see this issue through the lens of the parasitological perspective, as far as only two individual fish can harbour more of one hundred nematode parasites belonging to different species, most of them also new species for that area.

Genetic and morphological characterization of Mawsonascaris vulvolacinata n. sp. (Nematoda: Anisakidae) and associated histopathology in a wild caught cowtail stingray, Pastinachus ater.

There are limited reports of infectious agents affecting Australian cowtail stingrays. In the present study, a new species of ascaridoid nematode belonging to the genus Mawsonascaris is described. The most distinct characteristic features were observed in females (the presence of a polar spine in the eggs and a flap-like projection in the vulval area). An identification key for Mawsonascaris spp. is provided. Additionally, internal transcribed spacers (ITS) sequences were obtained for the new species. Alignment of the ITS sequence of the specimens in the present study with those deposited in GenBank showed that there exists no other highly similar sequence. Phylogenetic analyses resulted in a distinct grouping of our specimens supporting morphological distinction from previously described Mawsonascaris spp. Histology was used to investigate the pathology caused by the infection. Necrosis, inflammation and fibrosis were evident at the border of the nodules formed by parasite. A large number of parasites were present in muscularis mucosae and submucosa but not in the muscularis of the stomach. The parasites were associated with an increased inflammatory response, which was also found in the muscularis mucosae and submucosa. Similar pathology has been described in elasmobranchs infected by cestodes, although with more severe lesions.

On the occurrence and molecular identification of Contracaecum larvae (Nematoda: Anisakidae) in Mugil cephalus from Turkish waters.

Anisakis and Contracaecum species are fish borne zoonotic nematodes. In our previous studies, other larval anisakid and raphidascarid nematodes, Anisakis and Hysterothylacium species, were genetically identified in marine fish from Turkish waters. However, there is no information on molecular identification of larval Contracaecum species in marine fish from Turkey. Therefore, the aim of this study was only to investigate the presence and molecular identification of Contracaecum species in commonly commercialized marine fish from Turkish waters. A total of 475 marine fish, which belong to 21 different species, were sampled from the Aegean (FAO 37.3.1), Mediterranean (FAO 37.3.2), and Black Sea (FAO 37.4.2). The prevalence of Contracaecum L3 larvae in the Aegean Sea was identified as 10% in Mugil cephalus. All Contracaecum L3 larvae were molecularly characterized with RFLP targeting the ITS region and rrnS gene. Moreover, all larvae were analyzed by sequencing of ITS region, rrnS and cox2 gene. All Contracaecum larvae were identified as C. overstreeti based on the cox2 sequence analysis. This is the first report of C. overstreeti larvae in M. cephalus as paratenic and intermediate hosts. Furthermore, the analysis reveals novel information on ITS region. Additionally, the rrnS gene of C. overstreeti was also achieved and deposited in Genbank for the first time. The PCR-RFLP patterns of the ITS region and rrnS gene from C. overstreeti were presented in the present study. Consequently, the presence of C. overstreeti larvae in M. cephalus from the Aegean Sea may also potentially capable of inducing allergic sensitization in humans.

Anisakid Larvae from Anchovies in the South Coast of Korea.

Anisakiasis (anisakidosis) refers to a foodborne zoonosis caused by ingesting raw or undercooked marine fish or cephalopods infected with anisakid larvae. The present study was performed to investigate the prevalence of anisakid larvae in anchovies (Engraulis japonica) purchased from 2 local markets in Gyeongsangnam-do, the Republic of Korea (=Korea), during 2018-2019. Anchovies were transported to our laboratory and examined by pepsin-HCl artificial digestion technique followed by microscopic observations and molecular analyses. The overall prevalence of anisakid larvae was 19.5% (39/200), from which a total of 51 larvae (av. 1.3 larvae/infected anchovy) were recovered. Sequencing of the larvae targeting the ITS region, including ITS1, 5.8S rRNA, and ITS2 genes confirmed the species of larvae as Anisakis pegreffii (54.9%; 28/51), Hysterothylacium sinense (23.5%; 12/51), and Hysterothylacium aduncum (21.5%; 11/51). The results suggested that anchovies could be a potential source of human anisakiasis in Korea.

Molecular Identification of Anisakis Larvae Extracted by Gastrointestinal Endoscopy from Health Check-up Patients in Korea.

Anisakiasis is a zoonotic disease induced by anisakid nematodes, and endoscopic inspection is used for a diagnosis or remedy for it. Anisakis simplex, Anisakis physeteris, and Pseudoterranova decipiens had been reported to be the major species causing human infections, particularly, in Japan. However, in Korea, recent studies strongly suggested that Anisakis pegreffii is the major species of human infections. To support this suggestion, we collected anisakid larvae (n=20) from 20 human patients who were undergone gastrointestinal endoscopy at a health check-up center in Korea, and molecular identification was performed on the larvae using PCR-RFLP analysis and gene sequencing of rDNA ITS regions and mtDNA cox2. In addition, anisakid larvae (n=53) collected from the sea eel (Astroconger myriaster) were also examined for comparison with those extracted from humans. The results showed that all human samples (100%) were identified as A. pegreffii, whereas 90.7% of the samples from the sea eel were A. pegreffii with the remaining 9.3% being Hysterothylacium aduncum. Our study confirmed that A. pegreffii is the predominant species causing human anisakiasis in Korea, and this seems to be due to the predominance of this larval type in the fish (sea eels) popularly consumed by the Korean people. The possibility of human infection with H. aduncum in Korea is also suggested.

Functional insights into the infective larval stage of Anisakis simplex s.s., Anisakis pegreffii and their hybrids based on gene expression patterns.

BACKGROUND: Anisakis simplex sensu stricto and Anisakis pegreffii are sibling species of nematodes parasitic on marine mammals. Zoonotic human infection with third stage infective larvae causes anisakiasis, a debilitating and potentially fatal disease. These 2 species show evidence of hybridisation in geographical areas where they are sympatric. How the species and their hybrids differ is still poorly understood. RESULTS: Third stage larvae of Anisakis simplex s.s., Anisakis pegreffii and hybrids were sampled from Merluccius merluccius (Teleosti) hosts captured in waters of the FAO 27 geographical area. Specimens of each species and hybrids were distinguished with a diagnostic genetic marker (ITS). RNA was extracted from pools of 10 individuals of each taxon. Transcriptomes were generated using Illumina RNA-Seq, and assembled de novo. A joint assembly (here called merged transcriptome) of all 3 samples was also generated. The inferred transcript sets were functionally annotated and compared globally and also on subsets of secreted proteins and putative allergen families. While intermediary metabolism appeared to be typical for nematodes in the 3 evaluated taxa, their transcriptomes present strong levels of differential expression and enrichment, mainly of transcripts related to metabolic pathways and gene ontologies associated to energy metabolism and other pathways, with significant presence of excreted/secreted proteins, most of them allergens. The allergome of the 2 species and their hybrids has also been thoroughly studied; at least 74 different allergen families were identified in the transcriptomes. CONCLUSIONS: A. simplex s.s., A. pegreffi and their hybrids differ in gene expression patterns in the L3 stage. Strong parent-of-origin effects were observed: A. pegreffi alleles dominate in the expression patterns of hybrids albeit the latter, and A. pegreffii also display significant differences indicating that hybrids are intermediate biological entities among their parental species, and thus of outstanding interest in the study of speciation in nematodes. Analyses of differential expression based on genes coding for secreted proteins suggests that co-infections presents different repertoires of released protein to the host environment. Both species and their hybrids, share more allergen genes than previously thought and are likely to induce overlapping disease responses.

A case of hepatic anisakiasis caused by Pseudoterranova decipiens mimicking metastatic liver cancer.

BACKGROUND: Anisakid nematodes (Anisakis spp. or Pseudoterranova spp.) usually infect gastric or intestinal walls, while they rarely infect in extra-gastrointestinal sites of human body. Generally, Anisakis spp. larvae are highly infected in fish intermediate hosts, whereas Pseudoterranova spp. larvae are very rarely infected. To the best of our knowledge, there have been no reports which have documented cases of hepatic anisakiasis caused by Pseudoterranova spp. This report describes the first documented case of hepatic anisakiasis due to infection with Pseudoterranova decipiens and clinical features of the hepatic anisakiasis through literature review. CASE PRESENTATION: The case was a 28-year-old man with prior history of malignancy who was found to have a hepatic mass mimicking metastatic liver tumor. A new low density area of 20 mm in diameter in liver segment 7 was found on follow-up CT. With suspicious diagnosis of metastatic liver cancer, laparoscopic partial hepatectomy was performed. A pathological examination revealed no evidence of malignancy, but showed necrotic granuloma with eosinophil infiltration and the presence of a larva with Y-shaped lateral cords, which are specific to anisakid larvae. The type of larva was identified as Pseudoterranova decipiens sensu lato using PCR of DNA purified from a fixed granuloma embedded in paraffin. CONCLUSION: The present report is the first to discuss the case of a patient with hepatic anisakiasis caused by Pseudoterranova decipiens. Hepatic anisakiasis is a potential differential diagnosis for hepatic tumors and genetic identification with the PCR method was reliable for obtaining final diagnosis even when the larvae body in the resected specimen collapses with time.

Helminth parasites of the dwarf sperm whale Kogia sima (Cetacea: Kogiidae) from the Mediterranean Sea, with implications on host ecology.

Limited data exist on the occurrence of the dwarf sperm whale Kogia sima in the Mediterranean Sea and its parasite fauna. Here, the occurrence of the anisakid species Anisakis physeteris and A. pegreffii in the stomach chambers of an adult female dwarf sperm whale, stranded in southern Italy, is reported. In addition, the occurrence of Phyllobothrium delphini larvae infecting the blubber of the caudal peduncle region was recorded. A. physeteris and A. pegreffii represent the 2 parasite species of the genus, mostly distributed in the Mediterranean Sea in fish and squids. The finding of A. pegreffii and A. physeteris in the dwarf sperm whale represents a new record in this host species for the Mediterranean Sea. The study of gastrointestinal content also revealed a massive presence of cephalopod beaks identified as belonging to pelagic squids including the umbrella squid Histioteuthis bonnellii, the reverse jewel squid H. reversa, the long-armed squid Chiroteuthis veranii, and the comb-finned squid Ctenopteryx sicula. The feeding habits of the dwarf sperm whale, as well as the occurrence of these squid residuals in the cetacean host, suggest that these squid species play a major role in maintaining the life cycle of anisakid parasite species and P. delphini.