Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 57
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
J Infect Dis ; 2024 Oct 16.
Artigo em Inglês | MEDLINE | ID: mdl-39412357

RESUMO

BACKGROUND: Drug-resistant tuberculosis is a growing public health threat, and early characterization of the resistance phenotype is essential for guiding treatment and mitigating the high mortality associated with the disease. However, the slow growth rate of Mycobacterium tuberculosis, the causative agent of tuberculosis, necessitates several weeks for conventional culture-dependent drug susceptibility testing (DST). In addition, there are no widely available molecular diagnostic assays for evaluating resistance to newer tuberculosis drugs or drugs with complex resistance mechanisms. METHODS: We have developed a luciferase-based reporter mycobacteriophage assay that can determine drug resistance within 48 hours. We engineered the TM4 mycobacteriophage to express green enhanced nanoluciferase (GeNL) cassette and optimized DST for bedaquiline, pretomanid, linezolid, clofazimine, and rifampicin using clinical M. tuberculosis isolates. RESULTS: To assess the feasibility of this assay, we conducted a proof-of-principle study using 53 clinical M. tuberculosis isolates. TM4::GeNL phage DST effectively distinguished between sensitive and resistant isolates for bedaquiline and rifampicin at a concentration of 0.125 µg/mL. Optimal differentiation between sensitive and resistant isolates for pretomanid, clofazimine, and linezolid was achieved at concentrations of 0.5 µg/mL, 0.25 µg/mL, and 1 µg/mL, respectively. Additionally, TM4::GeNL DST identified low-level rifampicin resistance in clinical isolates even though they were classified as sensitive by Mycobacteria Growth Indicator Tube DST. CONCLUSIONS: TM4::GeNL reporter phage DST offers a rapid method to identify M. tuberculosis drug resistance, including resistance to newer tuberculosis drugs.

2.
Nat Chem Biol ; 18(5): 482-491, 2022 05.
Artigo em Inglês | MEDLINE | ID: mdl-35194207

RESUMO

Molecular profiling of small molecules offers invaluable insights into the function of compounds and allows for hypothesis generation about small-molecule direct targets and secondary effects. However, current profiling methods are limited in either the number of measurable parameters or throughput. Here we developed a multiplexed, unbiased framework that, by linking genetic to drug-induced changes in nearly a thousand metabolites, allows for high-throughput functional annotation of compound libraries in Escherichia coli. First, we generated a reference map of metabolic changes from CRISPR interference (CRISPRi) with 352 genes in all major essential biological processes. Next, on the basis of the comparison of genetic changes with 1,342 drug-induced metabolic changes, we made de novo predictions of compound functionality and revealed antibacterials with unconventional modes of action (MoAs). We show that our framework, combining dynamic gene silencing with metabolomics, can be adapted as a general strategy for comprehensive high-throughput analysis of compound functionality from bacteria to human cell lines.


Assuntos
Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas , Escherichia coli , Sistemas CRISPR-Cas/genética , Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas/genética , Escherichia coli/genética , Escherichia coli/metabolismo , Humanos , Metabolômica/métodos
3.
Proc Natl Acad Sci U S A ; 115(39): 9779-9784, 2018 09 25.
Artigo em Inglês | MEDLINE | ID: mdl-30143580

RESUMO

Reactive oxygen species (ROS)-mediated oxidative stress and DNA damage have recently been recognized as contributing to the efficacy of most bactericidal antibiotics, irrespective of their primary macromolecular targets. Inhibitors of targets involved in both combating oxidative stress as well as being required for in vivo survival may exhibit powerful synergistic action. This study demonstrates that the de novo arginine biosynthetic pathway in Mycobacterium tuberculosis (Mtb) is up-regulated in the early response to the oxidative stress-elevating agent isoniazid or vitamin C. Arginine deprivation rapidly sterilizes the Mtb de novo arginine biosynthesis pathway mutants ΔargB and ΔargF without the emergence of suppressor mutants in vitro as well as in vivo. Transcriptomic and flow cytometry studies of arginine-deprived Mtb have indicated accumulation of ROS and extensive DNA damage. Metabolomics studies following arginine deprivation have revealed that these cells experienced depletion of antioxidant thiols and accumulation of the upstream metabolite substrate of ArgB or ArgF enzymes. ΔargB and ΔargF were unable to scavenge host arginine and were quickly cleared from both immunocompetent and immunocompromised mice. In summary, our investigation revealed in vivo essentiality of the de novo arginine biosynthesis pathway for Mtb and a promising drug target space for combating tuberculosis.


Assuntos
Arginina/deficiência , Mycobacterium tuberculosis/metabolismo , Estresse Oxidativo , Antioxidantes/metabolismo , Antituberculosos/farmacologia , Arginina/metabolismo , Dano ao DNA , Farmacorresistência Bacteriana , Citometria de Fluxo , Perfilação da Expressão Gênica , Técnicas In Vitro , Redes e Vias Metabólicas , Espécies Reativas de Oxigênio/metabolismo , Compostos de Sulfidrila/metabolismo
4.
J Bacteriol ; 202(22)2020 10 22.
Artigo em Inglês | MEDLINE | ID: mdl-32900827

RESUMO

Phenotypic testing for drug susceptibility of Mycobacterium tuberculosis is critical to basic research and managing the evolving problem of antimicrobial resistance in tuberculosis management, but it remains a specialized technique to which access is severely limited. Here, we report on the development and validation of an improved phage-mediated detection system for M. tuberculosis We incorporated a nanoluciferase (Nluc) reporter gene cassette into the TM4 mycobacteriophage genome to create phage TM4-nluc. We assessed the performance of this reporter phage in the context of cellular limit of detection and drug susceptibility testing using multiple biosafety level 2 drug-sensitive and -resistant auxotrophs as well as virulent M. tuberculosis strains. For both limit of detection and drug susceptibility testing, we developed a standardized method consisting of a 96-hour cell preculture followed by a 72-hour experimental window for M. tuberculosis detection with or without antibiotic exposure. The cellular limit of detection of M. tuberculosis in a 96-well plate batch culture was ≤102 CFU. Consistent with other phenotypic methods for drug susceptibility testing, we found TM4-nluc to be compatible with antibiotics representing multiple classes and mechanisms of action, including inhibition of core central dogma functions, cell wall homeostasis, metabolic inhibitors, compounds currently in clinical trials (SQ109 and Q203), and susceptibility testing for bedaquiline, pretomanid, and linezolid (components of the BPaL regimen for the treatment of multi- and extensively drug-resistant tuberculosis). Using the same method, we accurately identified rifampin-resistant and multidrug-resistant M. tuberculosis strains.IMPORTANCEMycobacterium tuberculosis, the causative agent of tuberculosis disease, remains a public health crisis on a global scale, and development of new interventions and identification of drug resistance are pillars in the World Health Organization End TB Strategy. Leveraging the tractability of the TM4 mycobacteriophage and the sensitivity of the nanoluciferase reporter enzyme, the present work describes an evolution of phage-mediated detection and drug susceptibility testing of M. tuberculosis, adding a valuable tool in drug discovery and basic biology research. With additional validation, this system may play a role as a quantitative phenotypic reference method and complement to genotypic methods for diagnosis and antibiotic susceptibility testing.


Assuntos
Antituberculosos/farmacologia , Farmacorresistência Bacteriana , Testes de Sensibilidade Microbiana/métodos , Micobacteriófagos/genética , Mycobacterium tuberculosis/efeitos dos fármacos , Rifampina/farmacologia , Humanos , Luciferases/genética , Luciferases/metabolismo , Medições Luminescentes , Mycobacterium tuberculosis/genética , Mycobacterium tuberculosis/virologia , Tuberculose Resistente a Múltiplos Medicamentos/microbiologia , Tuberculose Pulmonar/microbiologia
5.
J Biol Chem ; 294(6): 1936-1943, 2019 02 08.
Artigo em Inglês | MEDLINE | ID: mdl-30530783

RESUMO

Energy metabolism has recently gained interest as a target space for antibiotic drug development in mycobacteria. Of particular importance is bedaquiline (Sirturo), which kills mycobacteria by inhibiting the F1F0 ATP synthase. Other components of the electron transport chain such as the NADH dehydrogenases (NDH-2 and NdhA) and the terminal respiratory oxidase bc1:aa3 are also susceptible to chemical inhibition. Because antituberculosis drugs are prescribed as part of combination therapies, the interaction between novel drugs targeting energy metabolism and classical first and second line antibiotics must be considered to maximize treatment efficiency. Here, we show that subinhibitory concentration of drugs targeting the F1F0 ATP synthase and the cytochrome bc1:aa3, as well as energy uncouplers, interfere with the bactericidal potency of isoniazid and moxifloxacin. Isoniazid- and moxifloxacin-induced mycobacterial death correlated with a transient increase in intracellular ATP that was dissipated by co-incubation with energy metabolism inhibitors. Although oxidative phosphorylation is a promising target space for drug development, a better understanding of the link between energy metabolism and antibiotic-induced mycobacterial death is essential to develop potent drug combinations for the treatment of tuberculosis.


Assuntos
Antibacterianos/farmacologia , Metabolismo Energético/efeitos dos fármacos , Mycobacterium/efeitos dos fármacos , Trifosfato de Adenosina/metabolismo , Antituberculosos/farmacologia , Proteínas de Bactérias/antagonistas & inibidores , Desenho de Fármacos , Complexo de Proteínas da Cadeia de Transporte de Elétrons/antagonistas & inibidores , Isoniazida/farmacologia , Moxifloxacina/farmacologia , Mycobacterium/citologia , Fosforilação Oxidativa/efeitos dos fármacos , ATPases Translocadoras de Prótons/antagonistas & inibidores
6.
Proc Natl Acad Sci U S A ; 114(28): 7426-7431, 2017 07 11.
Artigo em Inglês | MEDLINE | ID: mdl-28652330

RESUMO

The recent discovery of small molecules targeting the cytochrome bc1 :aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1 :aa3 consists of a menaquinone:cytochrome c reductase (bc1 ) and a cytochrome aa3 -type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1 :aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1 :aa3 , as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis.


Assuntos
Mycobacterium tuberculosis/metabolismo , Oxirredutases/química , Mutações Sintéticas Letais , Trifosfato de Adenosina/química , Animais , Antineoplásicos/farmacologia , Antituberculosos/farmacologia , Redutases do Citocromo/metabolismo , Diarilquinolinas/farmacologia , Transporte de Elétrons , Complexo IV da Cadeia de Transporte de Elétrons/metabolismo , Deleção de Genes , Humanos , Inflamação , Camundongos , Camundongos Endogâmicos BALB C , Proteínas Mitocondriais , Infecções por Mycobacterium/microbiologia , Mycobacterium bovis , Mycobacterium tuberculosis/genética , Fosforilação Oxidativa , Oxirredutases/genética , Oxigênio/química , Proteínas de Plantas , Células THP-1
7.
Mol Syst Biol ; 14(11): e8623, 2018 11 05.
Artigo em Inglês | MEDLINE | ID: mdl-30397005

RESUMO

In natural environments, microbes are typically non-dividing and gauge when nutrients permit division. Current models are phenomenological and specific to nutrient-rich, exponentially growing cells, thus cannot predict the first division under limiting nutrient availability. To assess this regime, we supplied starving Escherichia coli with glucose pulses at increasing frequencies. Real-time metabolomics and microfluidic single-cell microscopy revealed unexpected, rapid protein, and nucleic acid synthesis already from minuscule glucose pulses in non-dividing cells. Additionally, the lag time to first division shortened as pulsing frequency increased. We pinpointed division timing and dependence on nutrient frequency to the changing abundance of the division protein FtsZ. A dynamic, mechanistic model quantitatively relates lag time to FtsZ synthesis from nutrient pulses and FtsZ protease-dependent degradation. Lag time changed in model-congruent manners, when we experimentally modulated the synthesis or degradation of FtsZ. Thus, limiting abundance of FtsZ can quantitatively predict timing of the first cell division.


Assuntos
Proteínas de Bactérias/metabolismo , Proteínas do Citoesqueleto/metabolismo , Escherichia coli/metabolismo , Glucose/metabolismo , Divisão Celular , Escherichia coli/citologia , Metabolômica/métodos , Técnicas Analíticas Microfluídicas , Proteólise , Análise de Célula Única
9.
Proc Natl Acad Sci U S A ; 112(32): 10008-13, 2015 Aug 11.
Artigo em Inglês | MEDLINE | ID: mdl-26221021

RESUMO

Multidrug resistance, strong side effects, and compliance problems in TB chemotherapy mandate new ways to kill Mycobacterium tuberculosis (Mtb). Here we show that deletion of the gene encoding homoserine transacetylase (metA) inactivates methionine and S-adenosylmethionine (SAM) biosynthesis in Mtb and renders this pathogen exquisitely sensitive to killing in immunocompetent or immunocompromised mice, leading to rapid clearance from host tissues. Mtb ΔmetA is unable to proliferate in primary human macrophages, and in vitro starvation leads to extraordinarily rapid killing with no appearance of suppressor mutants. Cell death of Mtb ΔmetA is faster than that of other auxotrophic mutants (i.e., tryptophan, pantothenate, leucine, biotin), suggesting a particularly potent mechanism of killing. Time-course metabolomics showed complete depletion of intracellular methionine and SAM. SAM depletion was consistent with a significant decrease in methylation at the DNA level (measured by single-molecule real-time sequencing) and with the induction of several essential methyltransferases involved in biotin and menaquinone biosynthesis, both of which are vital biological processes and validated targets of antimycobacterial drugs. Mtb ΔmetA could be partially rescued by biotin supplementation, confirming a multitarget cell death mechanism. The work presented here uncovers a previously unidentified vulnerability of Mtb-the incapacity to scavenge intermediates of SAM and methionine biosynthesis from the host. This vulnerability unveils an entirely new drug target space with the promise of rapid killing of the tubercle bacillus by a new mechanism of action.


Assuntos
Metionina/farmacologia , Mycobacterium tuberculosis/efeitos dos fármacos , Mycobacterium tuberculosis/fisiologia , S-Adenosilmetionina/farmacologia , Acetiltransferases/metabolismo , Animais , Linhagem Celular , Feminino , Humanos , Imunocompetência/efeitos dos fármacos , Metaboloma/efeitos dos fármacos , Camundongos Endogâmicos C57BL , Camundongos SCID , Mycobacterium tuberculosis/enzimologia , Mycobacterium tuberculosis/patogenicidade , Fatores de Tempo , Transcriptoma/efeitos dos fármacos , Transcriptoma/genética , Virulência
10.
J Biol Chem ; 291(13): 7060-9, 2016 Mar 25.
Artigo em Inglês | MEDLINE | ID: mdl-26858255

RESUMO

Mycobacterium tuberculosis (Mtb) displays a high degree of metabolic plasticity to adapt to challenging host environments. Genetic evidence suggests thatMtbrelies mainly on fatty acid catabolism in the host. However,Mtbalso maintains a functional glycolytic pathway and its role in the cellular metabolism ofMtbhas yet to be understood. Pyruvate kinase catalyzes the last and rate-limiting step in glycolysis and theMtbgenome harbors one putative pyruvate kinase (pykA, Rv1617). Here we show thatpykAencodes an active pyruvate kinase that is allosterically activated by glucose 6-phosphate (Glc-6-P) and adenosine monophosphate (AMP). Deletion ofpykApreventsMtbgrowth in the presence of fermentable carbon sources and has a cidal effect in the presence of glucose that correlates with elevated levels of the toxic catabolite methylglyoxal. Growth attenuation was also observed in media containing a combination of short chain fatty acids and glucose and surprisingly, in media containing odd and even chain fatty acids alone. Untargeted high sensitivity metabolomics revealed that inactivation of pyruvate kinase leads to accumulation of phosphoenolpyruvate (P-enolpyruvate), citrate, and aconitate, which was consistent with allosteric inhibition of isocitrate dehydrogenase by P-enolpyruvate. This metabolic block could be relieved by addition of the α-ketoglutarate precursor glutamate. Taken together, our study identifies an essential role of pyruvate kinase in preventing metabolic block during carbon co-catabolism inMtb.


Assuntos
Proteínas de Bactérias/metabolismo , Carbono/metabolismo , Glicólise/genética , Mycobacterium tuberculosis/metabolismo , Piruvato Quinase/metabolismo , Ácido Aconítico/metabolismo , Monofosfato de Adenosina/metabolismo , Monofosfato de Adenosina/farmacologia , Regulação Alostérica , Animais , Proteínas de Bactérias/genética , Ácido Cítrico/metabolismo , Meios de Cultura/química , Ativação Enzimática , Ácidos Graxos Voláteis/farmacologia , Feminino , Deleção de Genes , Expressão Gênica , Glucose/metabolismo , Glucose-6-Fosfato/metabolismo , Glucose-6-Fosfato/farmacologia , Ácido Glutâmico/metabolismo , Ácido Glutâmico/farmacologia , Glicólise/efeitos dos fármacos , Isocitrato Desidrogenase/antagonistas & inibidores , Isocitrato Desidrogenase/genética , Isocitrato Desidrogenase/metabolismo , Ácidos Cetoglutáricos/metabolismo , Camundongos , Camundongos SCID , Mycobacterium tuberculosis/efeitos dos fármacos , Mycobacterium tuberculosis/genética , Fosfoenolpiruvato/metabolismo , Aldeído Pirúvico/metabolismo , Piruvato Quinase/genética , Análise de Sobrevida , Tuberculose/microbiologia , Tuberculose/mortalidade
11.
Proc Natl Acad Sci U S A ; 111(11): 4257-61, 2014 Mar 18.
Artigo em Inglês | MEDLINE | ID: mdl-24591586

RESUMO

In the Earth's lower atmosphere, H2 is maintained at trace concentrations (0.53 ppmv/0.40 nM) and rapidly turned over (lifetime ≤ 2.1 y(-1)). It is thought that soil microbes, likely actinomycetes, serve as the main global sink for tropospheric H2. However, no study has ever unambiguously proven that a hydrogenase can oxidize this trace gas. In this work, we demonstrate, by using genetic dissection and sensitive GC measurements, that the soil actinomycete Mycobacterium smegmatis mc(2)155 constitutively oxidizes subtropospheric concentrations of H2. We show that two membrane-associated, oxygen-dependent [NiFe] hydrogenases mediate this process. Hydrogenase-1 (Hyd1) (MSMEG_2262-2263) is well-adapted to rapidly oxidize H2 at a range of concentrations [Vmax(app) = 12 nmol⋅g⋅dw(-1)⋅min(-1); Km(app) = 180 nM; threshold = 130 pM in the Δhyd23 (Hyd1 only) strain], whereas Hyd2 (MSMEG_2719-2720) catalyzes a slower-acting, higher-affinity process [Vmax(app) = 2.5 nmol⋅g⋅dw(-1)⋅min(-1); Km(app) = 50 nM; threshold = 50 pM in the Δhyd13 (Hyd2 only) strain]. These observations strongly support previous studies that have linked group 5 [NiFe] hydrogenases (e.g., Hyd2) to the oxidation of tropospheric H2 in soil ecosystems. We further reveal that group 2a [NiFe] hydrogenases (e.g., Hyd1) can contribute to this process. Hydrogenase expression and activity increases in carbon-limited cells, suggesting that scavenging of trace H2 helps to sustain dormancy. Distinct physiological roles for Hyd1 and Hyd2 during the adaptation to this condition are proposed. Soil organisms harboring high-affinity hydrogenases may be especially competitive, given that they harness a highly dependable fuel source in otherwise unstable environments.


Assuntos
Atmosfera/química , Hidrogênio/metabolismo , Hidrogenase/metabolismo , Mycobacterium smegmatis/enzimologia , Microbiologia do Solo , Cromatografia Gasosa , Hidrogênio/análise , Oxirredução , Oxigênio/metabolismo
12.
Proc Natl Acad Sci U S A ; 111(31): 11479-84, 2014 Aug 05.
Artigo em Inglês | MEDLINE | ID: mdl-25049411

RESUMO

Oxygen availability is a major factor and evolutionary force determining the metabolic strategy of bacteria colonizing an environmental niche. In the soil, conditions can switch rapidly between oxia and anoxia, forcing soil bacteria to remodel their energy metabolism accordingly. Mycobacterium is a dominant genus in the soil, and all its species are obligate aerobes. Here we show that an obligate aerobe, the soil actinomycete Mycobacterium smegmatis, adopts an anaerobe-type strategy by activating fermentative hydrogen production to adapt to hypoxia. This process is controlled by the two-component system DosR-DosS/DosT, an oxygen and redox sensor that is well conserved in mycobacteria. We show that DosR tightly regulates the two [NiFe]-hydrogenases: Hyd3 (MSMEG_3931-3928) and Hyd2 (MSMEG_2719-2718). Using genetic manipulation and high-sensitivity GC, we demonstrate that Hyd3 facilitates the evolution of H2 when oxygen is depleted. Combined activity of Hyd2 and Hyd3 was necessary to maintain an optimal NAD(+)/NADH ratio and enhanced adaptation to and survival of hypoxia. We demonstrate that fermentatively-produced hydrogen can be recycled when fumarate or oxygen become available, suggesting Mycobacterium smegmatis can switch between fermentation, anaerobic respiration, and aerobic respiration. Hydrogen metabolism enables this obligate aerobe to rapidly meet its energetic needs when switching between microoxic and anoxic conditions and provides a competitive advantage in low oxygen environments.


Assuntos
Bactérias Anaeróbias/fisiologia , Fermentação , Hidrogênio/metabolismo , Mycobacterium smegmatis/fisiologia , Microbiologia do Solo , Estresse Fisiológico , Aerobiose , Anaerobiose , Bactérias Anaeróbias/enzimologia , Bactérias Anaeróbias/genética , Proteínas de Bactérias/genética , Proteínas de Bactérias/metabolismo , Sequência de Bases , Elétrons , Regulação Bacteriana da Expressão Gênica , Homeostase , Hidrogenase , Espaço Intracelular/metabolismo , Viabilidade Microbiana , Modelos Biológicos , Dados de Sequência Molecular , Mycobacterium smegmatis/enzimologia , Mycobacterium smegmatis/genética , Oxirredução , Oxigênio/metabolismo , Regulon/genética , Transcrição Gênica
13.
PLoS Pathog ; 10(11): e1004510, 2014 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-25412183

RESUMO

In chronic infection, Mycobacterium tuberculosis bacilli are thought to enter a metabolic program that provides sufficient energy for maintenance of the protonmotive force, but is insufficient to meet the demands of cellular growth. We sought to understand this metabolic downshift genetically by targeting succinate dehydrogenase, the enzyme which couples the growth processes controlled by the TCA cycle with the energy production resulting from the electron transport chain. M. tuberculosis contains two operons which are predicted to encode succinate dehydrogenase enzymes (sdh-1 and sdh-2); we found that deletion of Sdh1 contributes to an inability to survive long term stationary phase. Stable isotope labeling and mass spectrometry revealed that Sdh1 functions as a succinate dehydrogenase during aerobic growth, and that Sdh2 is dispensable for this catalysis, but partially overlapping activities ensure that the loss of one enzyme can incompletely compensate for loss of the other. Deletion of Sdh1 disturbs the rate of respiration via the mycobacterial electron transport chain, resulting in an increased proportion of reduced electron carrier (menaquinol) which leads to increased oxygen consumption. The loss of respiratory control leads to an inability to recover from stationary phase. We propose a model in which succinate dehydrogenase is a governor of cellular respiration in the adaptation to low oxygen environments.


Assuntos
Proteínas de Bactérias/metabolismo , Modelos Biológicos , Mycobacterium tuberculosis/enzimologia , Consumo de Oxigênio/fisiologia , Succinato Desidrogenase/metabolismo , Animais , Proteínas de Bactérias/genética , Camundongos , Camundongos Knockout , Viabilidade Microbiana/genética , Mycobacterium tuberculosis/genética , Succinato Desidrogenase/genética
14.
Microbiology (Reading) ; 161(Pt 3): 648-61, 2015 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-25525207

RESUMO

Mycobacterium smegmatis is a fast-growing, saprophytic, mycobacterial species that contains two cAMP-receptor protein (CRP) homologues designated herein as Crp1 and Crp2. Phylogenetic analysis suggests that Crp1 (Msmeg_0539) is uniquely present in fast-growing environmental mycobacteria, whereas Crp2 (Msmeg_6189) occurs in both fast- and slow-growing species. A crp1 mutant of M. smegmatis was readily obtained, but crp2 could not be deleted, suggesting it was essential for growth. A total of 239 genes were differentially regulated in response to crp1 deletion (loss of function), including genes coding for mycobacterial energy generation, solute transport and catabolism of carbon sources. To assess the role of Crp2 in M. smegmatis, the crp2 gene was overexpressed (gain of function) and transcriptional profiling studies revealed that 58 genes were differentially regulated. Identification of the CRP promoter consensus in M. smegmatis showed that both Crp1 and Crp2 recognized the same consensus sequence (TGTGN8CACA). Comparison of the Crp1- and Crp2-regulated genes revealed distinct but overlapping regulons with 11 genes in common, including those of the succinate dehydrogenase operon (MSMEG_0417-0420, sdh1). Expression of the sdh1 operon was negatively regulated by Crp1 and positively regulated by Crp2. Electrophoretic mobility shift assays with purified Crp1 and Crp2 demonstrated that Crp1 binding to the sdh1 promoter was cAMP-independent whereas Crp2 binding was cAMP-dependent. These data suggest that Crp1 and Crp2 respond to distinct signalling pathways in M. smegmatis to coordinate gene expression in response to carbon and energy supply.


Assuntos
Proteínas de Bactérias/metabolismo , Proteína Receptora de AMP Cíclico/metabolismo , Mycobacterium smegmatis/crescimento & desenvolvimento , Mycobacterium smegmatis/metabolismo , Sequência de Aminoácidos , Proteínas de Bactérias/química , Proteínas de Bactérias/genética , Carbono/metabolismo , Proteína Receptora de AMP Cíclico/química , Proteína Receptora de AMP Cíclico/genética , Regulação Bacteriana da Expressão Gênica , Humanos , Dados de Sequência Molecular , Infecções por Mycobacterium não Tuberculosas/microbiologia , Mycobacterium smegmatis/genética , Óperon , Regiões Promotoras Genéticas , Alinhamento de Sequência
15.
J Antimicrob Chemother ; 70(7): 2028-37, 2015 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-25754998

RESUMO

OBJECTIVES: It is not fully understood why inhibiting ATP synthesis in Mycobacterium species leads to death in non-replicating cells. We investigated the bactericidal mode of action of the anti-tubercular F1Fo-ATP synthase inhibitor bedaquiline (Sirturo™) in order to further understand the lethality of ATP synthase inhibition. METHODS: Mycobacterium smegmatis strains were used for all the experiments. Growth and survival during a bedaquiline challenge were performed in multiple media types. A time-course microarray was performed during initial bedaquiline challenge in minimal medium. Oxygen consumption and proton-motive force measurements were performed on whole cells and inverted membrane vesicles, respectively. RESULTS: A killing of 3 log10 cfu/mL was achieved 4-fold more quickly in minimal medium (a glycerol carbon source) versus rich medium (LB with Tween 80) during bedaquiline challenge. Assessing the accelerated killing condition, we identified a transcriptional remodelling of metabolism that was consistent with respiratory dysfunction but inconsistent with ATP depletion. In glycerol-energized cell suspensions, bedaquiline caused an immediate 2.3-fold increase in oxygen consumption. Bedaquiline collapsed the transmembrane pH gradient, but not the membrane potential, in a dose-dependent manner. Both these effects were dependent on binding to the F1Fo-ATP synthase. CONCLUSIONS: Challenge with bedaquiline results in an electroneutral uncoupling of respiration-driven ATP synthesis. This may be a determinant of the bactericidal effects of bedaquiline, while ATP depletion may be a determinant of its delayed onset of killing. We propose that bedaquiline binds to and perturbs the a-c subunit interface of the Fo, leading to futile proton cycling, which is known to be lethal to mycobacteria.


Assuntos
Antituberculosos/farmacologia , Diarilquinolinas/farmacologia , Viabilidade Microbiana/efeitos dos fármacos , Mycobacterium smegmatis/efeitos dos fármacos , Mycobacterium smegmatis/fisiologia , Desacopladores/farmacologia , Meios de Cultura/química , Perfilação da Expressão Gênica , Humanos , Análise em Microsséries , Técnicas Microbiológicas
16.
Appl Environ Microbiol ; 81(4): 1190-9, 2015 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-25501483

RESUMO

We have known for 40 years that soils can consume the trace amounts of molecular hydrogen (H2) found in the Earth's atmosphere.This process is predicted to be the most significant term in the global hydrogen cycle. However, the organisms and enzymes responsible for this process were only recently identified. Pure culture experiments demonstrated that several species of Actinobacteria, including streptomycetes and mycobacteria, can couple the oxidation of atmospheric H2 to the reduction of ambient O2. A combination of genetic, biochemical, and phenotypic studies suggest that these organisms primarily use this fuel source to sustain electron input into the respiratory chain during energy starvation. This process is mediated by a specialized enzyme, the group 5 [NiFe]-hydrogenase, which is unusual for its high affinity, oxygen insensitivity, and thermostability. Atmospheric hydrogen scavenging is a particularly dependable mode of energy generation, given both the ubiquity of the substrate and the stress tolerance of its catalyst. This minireview summarizes the recent progress in understanding how and why certain organisms scavenge atmospheric H2. In addition, it provides insight into the wider significance of hydrogen scavenging in global H2 cycling and soil microbial ecology.


Assuntos
Actinobacteria/metabolismo , Proteínas de Bactérias/metabolismo , Hidrogênio/metabolismo , Hidrogenase/metabolismo , Actinobacteria/enzimologia , Actinobacteria/genética , Microbiologia do Ar , Atmosfera/química , Proteínas de Bactérias/genética , Ecossistema , Hidrogenase/genética
17.
J Bacteriol ; 196(17): 3091-7, 2014 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-24936051

RESUMO

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.


Assuntos
Proteína Receptora de AMP Cíclico/metabolismo , Citocromos/metabolismo , Regulação Bacteriana da Expressão Gênica/fisiologia , Mycobacterium smegmatis/enzimologia , Oxigênio/metabolismo , Proteína Receptora de AMP Cíclico/genética , Citocromos/genética , Regulação Enzimológica da Expressão Gênica/fisiologia , Mycobacterium smegmatis/genética , Mycobacterium smegmatis/metabolismo , Transcrição Gênica
18.
Acta Crystallogr D Biol Crystallogr ; 70(Pt 4): 968-80, 2014 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-24699642

RESUMO

The proline-utilization pathway in Mycobacterium tuberculosis (Mtb) has recently been identified as an important factor in Mtb persistence in vivo, suggesting that this pathway could be a valuable therapeutic target against tuberculosis (TB). In Mtb, two distinct enzymes perform the conversion of proline into glutamate: the first step is the oxidation of proline into Δ(1)-pyrroline-5-carboxylic acid (P5C) by the flavoenzyme proline dehydrogenase (PruB), and the second reaction involves converting the tautomeric form of P5C (glutamate-γ-semialdehyde) into glutamate using the NAD(+)-dependent Δ(1)-pyrroline-5-carboxylic dehydrogenase (PruA). Here, the three-dimensional structures of Mtb-PruA, determined by X-ray crystallography, in the apo state and in complex with NAD(+) are described at 2.5 and 2.1 Šresolution, respectively. The structure reveals a conserved NAD(+)-binding mode, common to other related enzymes. Species-specific conformational differences in the active site, however, linked to changes in the dimer interface, suggest possibilities for selective inhibition of Mtb-PruA despite its reasonably high sequence identity to other PruA enzymes. Using recombinant PruA and PruB, the proline-utilization pathway in Mtb has also been reconstituted in vitro. Functional validation using a novel NMR approach has demonstrated that the PruA and PruB enzymes are together sufficient to convert proline to glutamate, the first such demonstration for monofunctional proline-utilization enzymes.


Assuntos
1-Pirrolina-5-Carboxilato Desidrogenase/química , Mycobacterium tuberculosis/enzimologia , 1-Pirrolina-5-Carboxilato Desidrogenase/metabolismo , Cristalografia por Raios X , Modelos Moleculares , NAD/química , NAD/metabolismo , Ressonância Magnética Nuclear Biomolecular , Prolina/metabolismo , Estrutura Quaternária de Proteína , Estrutura Terciária de Proteína , Homologia Estrutural de Proteína
19.
Environ Microbiol ; 16(1): 318-30, 2014 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-24536093

RESUMO

Mycobacterium smegmatis is an obligate aerobe that harbours three predicted [NiFe] hydrogenases, Hyd1 (MSMEG_2262­2263), Hyd2 (MSMEG_2720-2719) and Hyd3 (MSMEG_3931-3928). We show here that these three enzymes differ in their phylogeny, regulation and catalytic activity. Phylogenetic analysis revealed that Hyd1 groups with hydrogenases that oxidize H2 produced by metabolic processes, and Hyd2 is homologous to a novel group of putative high-affinity hydrogenases. Hyd1 and Hyd2 respond to carbon and oxygen limitation, and, in the case of Hyd1, hydrogen supplementation. Hydrogen consumption measurements confirmed that both enzymes can oxidize hydrogen. In contrast, the phylogenetic analysis and activity measurements of Hyd3 are consistent with the enzyme evolving hydrogen. Hyd3 is controlled by DosR, a regulator that responds to hypoxic conditions. The strict dependence of hydrogen oxidation of Hyd1 and Hyd2 on oxygen suggests that the enzymes are oxygen tolerant and linked to the respiratory chain. This unique combination of hydrogenases allows M. smegmatis to oxidize hydrogen at high (Hyd1) and potentially tropospheric (Hyd2) concentrations, as well as recycle reduced equivalents by evolving hydrogen (Hyd3). The distribution of these hydrogenases throughout numerous soil and marine species of actinomycetes suggests that oxic hydrogen metabolism provides metabolic flexibility in environments with changing nutrient fluxes.


Assuntos
Proteínas de Bactérias/metabolismo , Hidrogenase/metabolismo , Mycobacterium smegmatis/enzimologia , Aerobiose , Proteínas de Bactérias/genética , Hidrogênio/metabolismo , Hidrogenase/genética , Família Multigênica , Mycobacterium smegmatis/genética , Mycobacterium smegmatis/metabolismo , Óperon , Oxirredução , Oxigênio/metabolismo , Filogenia
20.
Nat Microbiol ; 9(6): 1607-1618, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38740932

RESUMO

Phthiocerol dimycocerosate (PDIM) is an essential virulence lipid of Mycobacterium tuberculosis. In vitro culturing rapidly selects for spontaneous PDIM-negative mutants that have attenuated virulence and increased cell wall permeability, thus impacting the relevance of experimental findings. PDIM loss can also reduce the efficacy of the BCG Pasteur vaccine. Here we show that vancomycin susceptibility can rapidly screen for M. tuberculosis PDIM production. We find that metabolic deficiency of methylmalonyl-CoA impedes the growth of PDIM-producing bacilli, selecting for PDIM-negative variants. Supplementation with odd-chain fatty acids, cholesterol or vitamin B12 restores PDIM-positive bacterial growth. Specifically, we show that propionate supplementation enhances PDIM-producing bacterial growth and selects against PDIM-negative mutants, analogous to in vivo conditions. Our study provides a simple approach to screen for and maintain PDIM production, and reveals how discrepancies between the host and in vitro nutrient environments can attenuate bacterial pathogenicity.


Assuntos
Mycobacterium tuberculosis , Propionatos , Mycobacterium tuberculosis/efeitos dos fármacos , Mycobacterium tuberculosis/metabolismo , Mycobacterium tuberculosis/patogenicidade , Mycobacterium tuberculosis/genética , Mycobacterium tuberculosis/crescimento & desenvolvimento , Propionatos/farmacologia , Propionatos/metabolismo , Virulência , Lipídeos/química , Ésteres do Colesterol/metabolismo , Tuberculose/microbiologia , Tuberculose/prevenção & controle , Ácidos Graxos/metabolismo , Vitamina B 12/farmacologia , Vitamina B 12/metabolismo , Humanos , Mutação , Fatores de Virulência/metabolismo , Fatores de Virulência/genética , Colesterol/metabolismo , Acil Coenzima A
SELEÇÃO DE REFERÊNCIAS
Detalhe da pesquisa