Oxygenases as Powerful Weapons in the Microbial Degradation of Pesticides.

Oxygenases, which catalyze the reductive activation of O2 and incorporation of oxygen atoms into substrates, are widely distributed in aerobes. They function by switching the redox states of essential cofactors that include flavin, heme iron, Rieske non-heme iron, and Fe(II)/α-ketoglutarate. This review summarizes the catalytic features of flavin-dependent monooxygenases, heme iron-dependent cytochrome P450 monooxygenases, Rieske non-heme iron-dependent oxygenases, Fe(II)/α-ketoglutarate-dependent dioxygenases, and ring-cleavage dioxygenases, which are commonly involved in pesticide degradation. Heteroatom release (hydroxylation-coupled hetero group release), aromatic/heterocyclic ring hydroxylation to form ring-cleavage substrates, and ring cleavage are the main chemical fates of pesticides catalyzed by these oxygenases. The diversity of oxygenases, specificities for electron transport components, and potential applications of oxygenases are also discussed. This article summarizes our current understanding of the catalytic mechanisms of oxygenases and a framework for distinguishing the roles of oxygenases in pesticide degradation.

Isolation of a facultative methanotroph Methylocystis iwaonis SD4 from rice rhizosphere and establishment of rapid genetic tools for it.

Methanotrophs of the genus Methylocystis are frequently found in rice paddies. Although more than ten facultative methanotrophs have been reported since 2005, none of these strains was isolated from paddy soil. Here, a facultative methane-oxidizing bacterium, Methylocystis iwaonis SD4, was isolated and characterized from rhizosphere samples of rice plants in Nanjing, China. This strain grew well on methane or methanol but was able to grow slowly using acetate or ethanol. Moreover, strain SD4 showed sustained growth at low concentrations of methane (100 and 500 ppmv). M. iwaonis SD4 could utilize diverse nitrogen sources, including nitrate, urea, ammonium as well as dinitrogen. Strain SD4 possessed genes encoding both the particulate methane monooxygenase and the soluble methane monooxygenase. Simple and rapid genetic manipulation methods were established for this strain, enabling vector transformation and unmarked genetic manipulation. Fast growth rate and efficient genetic tools make M. iwaonis SD4 an ideal model to study facultative methanotrophs, and the ability to grow on low concentration of methane implies its potential in methane removal.

ChlOR, a GMC family oxidoreductase that evolved independently from the actinomycete, confers resistance to amphenicol antibiotics.

Overuse of the amphenicol antibiotics chloramphenicol (CHL) and thiamphenicol (TAP) poses a great threat to ecosystem safety and human health. The strain, Nocardioides sp. LMS-CY, Nocardioides sp. QY071 and Nocardioides sp. L-11A, classified as a gram-positive actinomycete, harbours a complete CHL metabolic pathway. However, the metabolic genes (clusters) involved in the entire pathway in gram-positive actinomycetes are still limited. Here, chlORLMS , chlORQY071 and chlORL-11A completely from the actinomycete Nocardioides spp. were found to act on the C1 -OH of the CHL/TAP side chain, directly converting CHL/TAP to 4-nitrobenzaldehyde (PNBD)/4-methylsulfonyl benzaldehyde (PMBD) and transforming PNBD/PMBD into 4-nitrobenzyl alcohol (PNBM)/4-methylsulfonyl phenyl methanol (PMBM). Furthermore, oxidoreductases can transform PNBM into 4-nitrobenzoate (PNBA). The oxidoreductases ChlORLMS , ChlORQY071 and ChlORL-11A were all classified as cellobiose dehydrogenases from the glucose methanol choline (GMC) family. Based on the Swiss-Prot database, ChlORQY071 exhibited a lower identity (27.12%-35.10% similarity) with the reported oxidoreductases. Enzymatic and molecular docking analyses showed that ChlORQY071 and ChlORL-11A from the two similar genomes were remarkably more effective in metabolizing CHL than ChlORLMS . Overall, the detailed resistance mechanism of CHL/TAP by actinomycete strains isolated from soil and livestock manure will provide insights into the occurrence of CHL/TAP resistance genes in the environment, resistance risk and bioremediation of CHL/TAP-contaminated environments.

Cre/lox-Mediated CRISPRi Library Reveals Core Genome of a Type I Methanotroph Methylotuvimicrobium buryatense 5GB1C.

Methanotrophs play key roles in global methane cycling and are promising platforms for methane bioconversion. However, major gaps existing in fundamental knowledge undermines understanding of these methane-consuming microorganisms. To associate genes with a phenotype at the genome-wide level, we developed a Cre/lox-mediated method for constructing a large-scale CRISPRi library in a model methanotroph Methylotuvimicrobium buryatense 5GB1C. The efficiency of this Cre mediated integration method was up to a level of 105 CFU/µg DNA. Targeting 4,100 predicted protein-coding genes, our CRISPRi pooled screening uncovered 788 core genes for the growth of strain 5GB1C using methane. The core genes are highly consistent with the gene knockout results, indicating the reliability of the CRISPRi screen. Insights from the core genes include that annotated isozymes generally exist in metabolic pathways and many core genes are hypothetical genes. This work not only provides functional genomic data for both fundamental research and metabolic engineering of methanotrophs, but also offers a method for CRISPRi library construction. IMPORTANCE Due to their key role in methane cycling and their industrial potential, methanotrophs have drawn increasing attention. Genome-wide experimental approaches for gene-phenotype mapping accelerate our understanding and engineering of a bacterium. However, these approaches are still unavailable in methanotrophs. This work has two significant implications. First, the core genes identified here provide functional genetic basics for complete reconstruction of the metabolic network and afford more clues for knowledge gaps. Second, the Cre-mediated knock-in method developed in this work enables large-scale DNA library construction in methanotrophs; the CRISPRi library can be used to screen the genes associated with special culture conditions.

Unveiling the regulatory mechanisms of salicylate degradation gene cluster cehGHIR4 in Rhizobium sp. strain X9.

In a previous study, the novel gene cluster cehGHI was found to be involved in salicylate degradation through the CoA-mediated pathway in Rhizobium sp. strain X9 (Mol Microbiol 116:783-793, 2021). In this study, an IclR family transcriptional regulator CehR4 was identified. In contrast to other regulators involved in salicylate degradation, cehR4 forms one operon with the gentisyl-CoA thioesterase gene cehI, while cehG and cehH (encoding salicylyl-CoA ligase and salicylyl-CoA hydroxylase, respectively) form another operon. cehGH and cehIR4 are divergently transcribed, and their promoters overlap. The results of the electrophoretic mobility shift assay and DNase I footprinting showed that CehR4 binds to the 42-bp motif between genes cehH and cehI, thus regulating transcription of cehGH and cehIR4. The repeat sequences IR1 (5'-TTTATATAAA-3') and IR2 (5'-AATATAGAAA-3') in the motif are key sites for CehR4 binding. The arrangement of cehGH and cehIR4 and the conserved binding motif of CehR4 were also found in other bacterial genera. The results disclose the regulatory mechanism of salicylate degradation through the CoA pathway and expand knowledge about the systems controlled by IclR family transcriptional regulators.IMPORTANCEThe long-term residue of aromatic compounds in the environment has brought great threat to the environment and human health. Microbial degradation plays an important role in the elimination of aromatic compounds in the environment. Salicylate is a common intermediate metabolite in the degradation of various aromatic compounds. Recently, Rhizobium sp. strain X9, capable of degrading the pesticide carbaryl, was isolated from carbaryl-contaminated soil. Salicylate is the intermediate metabolite that appeared during the degradation of carbaryl, and a novel salicylate degradation pathway and the involved gene cluster cehGHIR4 have been identified. This study identified and characterized the IclR transcription regulator CehR4 that represses transcription of cehGHIR4 gene cluster. Additionally, the genetic arrangements of cehGH and cehIR4 and the binding sites of CehR4 were also found in other bacterial genera. This study provides insights into the biodegradation of salicylate and provides an application in the bioremediation of aromatic compound-contaminated environments.

A nitroreductase DnrA catalyzes the biotransformation of several diphenyl ether herbicides in Bacillus sp. Za.

Diphenyl ether herbicides, typical globally used herbicides, threaten the agricultural environment and the sensitive crops. The microbial degradation pathways of diphenyl ether herbicides are well studied, but the nitroreduction of diphenyl ether herbicides by purified enzymes is still unclear. Here, the gene dnrA, encoding a nitroreductase DnrA responsible for the reduction of nitro to amino groups, was identified from the strain Bacillus sp. Za. DnrA had a broad substrate spectrum, and the Km values of DnrA for different diphenyl ether herbicides were 20.67 µM (fomesafen), 23.64 µM (bifenox), 26.19 µM (fluoroglycofen), 28.24 µM (acifluorfen), and 36.32 µM (lactofen). DnrA also mitigated the growth inhibition effect on cucumber and sorghum through nitroreduction. Molecular docking revealed the mechanisms of the compounds fomesafen, bifenox, fluoroglycofen, lactofen, and acifluorfen with DnrA. Fomesafen showed higher affinities and lower binding energy values for DnrA, and residue Arg244 affected the affinity between diphenyl ether herbicides and DnrA. This research provides new genetic resources and insights into the microbial remediation of diphenyl ether herbicide-contaminated environments. KEY POINTS: • Nitroreductase DnrA transforms the nitro group of diphenyl ether herbicides. • Nitroreductase DnrA reduces the toxicity of diphenyl ether herbicides. • The distance between Arg244 and the herbicides is related to catalytic efficiency.

Characterization of the 2,6-Dimethylphenol Monooxygenase MpdAB and Evaluation of Its Potential in Vitamin E Precursor Synthesis.

2,6-Dimethylphenol (2,6-DMP) is a widely used chemical intermediate whose residue has been frequently detected in the environment, posing a threat to some aquatic organisms. Microbial degradation is an effective method to eliminate 2,6-DMP in nature. However, the genetic and biochemical mechanisms of 2,6-DMP metabolism remain unknown. Mycobacterium neoaurum B5-4 is a 2,6-DMP-degrading bacterium isolated in our previous study. Here, a 2,6-DMP degradation-deficient mutant of strain B5-4 was screened. Comparative genomic, transcriptomic, gene disruption, and genetic complementation data indicated that mpdA and mpdB are responsible for the initial step of 2,6-DMP degradation in M. neoaurum B5-4. MpdAB was predicted to be a two-component flavin-dependent monooxygenase system, which shows 32% and 36% identities with HsaAB from Mycobacterium tuberculosis CDC1551. The transcription of mpdA and mpdB was substantially increased upon exposure to 2,6-DMP. Nuclear magnetic resonance analysis showed that purified 6×His-MpdA and 6×His-MpdB hydroxylated 2,6-DMP and 2,3,6-trimethylphenol (2,3,6-TMP) at the para-position using NADH and flavin adenine dinucleotide (FAD) as cofactors. The apparent Km values of MpdAB for 2,6-DMP and 2,3,6-TMP were 0.12 ± 0.01 and 0.17 ± 0.01 mM, respectively, and the corresponding kcat/Km values were 4.02 and 2.84 s-1 mM-1, respectively. Since para-hydroxylated 2,3,6-TMP is a major precursor for vitamin E synthesis, the potential of MpdAB in vitamin E synthesis was preliminarily evaluated using whole-cell catalysis. Low expression levels of MpdA and 2,3,6-TMP cytotoxicity limited the efficiency of whole-cell catalysis. Together, this study reveals the genetic and biochemical basis for the initial step of 2,6-DMP biodegradation and provides candidate enzymes for vitamin E synthesis. IMPORTANCE Although the microbial degradation of the six isomers of dimethylphenol has been extensively studied, the genetic and biochemical mechanisms of 2,6-DMP degradation remain unclear. This study identified the genes responsible for the initial step in the 2,6-DMP catabolic pathway in M. neoaurum B5-4. Moreover, MpdAB also catalyzed the transformation of 2,3,6-TMP to 2,3,5-trimethylhydroquinone (2,3,5-TMHQ), a crucial step in vitamin E synthesis. Overall, this study provides candidate enzymes for both the bioremediation of 2,6-DMP contamination and the development of a green method to synthesize vitamin E.

PicR as a MarR Family Transcriptional Repressor Multiply Controls the Transcription of Picolinic Acid Degradation Gene Cluster pic in Alcaligenes faecalis JQ135.

Picolinic acid (PA) is a natural toxic pyridine derivative as well as an important intermediate used in the chemical industry. In a previous study, we identified a gene cluster, pic, that responsible for the catabolism of PA in Alcaligenes faecalis JQ135. However, the transcriptional regulation of the pic cluster remains known. This study showed that the entire pic cluster was composed of 17 genes and transcribed as four operons: picR, picCDEF, picB4B3B2B1, and picT1A1A2A3T2T3MN. Deletion of picR, encoding a putative MarR-type regulator, greatly shortened the lag phase of PA degradation. An electrophoretic mobility shift assay and DNase I footprinting showed that PicR has one binding site in the picR-picC intergenic region and two binding sites in the picB-picT1 intergenic region. The DNA sequences of the three binding sites have the palindromic characteristics of TCAG-N4-CTNN: the space consists of four nonspecific bases, and the four palindromic bases on the left and the first two palindromic bases on the right are strictly conserved, while the last two bases on the right vary among the three binding sites. An in vivo ß-galactosidase activity reporter assay indicated that 6-hydroxypicolinic acid but not PA acted as a ligand of PicR, preventing PicR from binding to promoter regions and thus derepressing the transcription of the pic cluster. This study revealed the negative transcriptional regulation mechanism of PA degradation by PicR in A. faecalis JQ135 and provides new insights into the structure and function of the MarR-type regulator. IMPORTANCE The pic gene cluster was found to be responsible for PA degradation and widely distributed in Alpha-, Beta-, and Gammaproteobacteria. Thus, it is very necessary to understand the regulation mechanism of the pic cluster in these strains. This study revealed that PicR binds to three sites of the promoter regions of the pic cluster to multiply regulate the transcription of the pic cluster, which enables A. faecalis JQ135 to efficiently utilize PA. Furthermore, the study also found a unique palindrome sequence for binding of the MarR-type regulator. This study enhanced our understanding of microbial catabolism of environmental toxic pyridine derivatives.

The Novel Monooxygenase Gene dipD in the dip Gene Cluster of Alcaligenes faecalis JQ135 Is Essential for the Initial Catabolism of Dipicolinic Acid.

Dipicolinic acid (DPA), an essential pyridine derivative biosynthesized in Bacillus spores, constitutes a major proportion of global biomass carbon pool. Alcaligenes faecalis strain JQ135 could catabolize DPA through the "3HDPA (3-hydroxydipicolinic acid) pathway." However, the genes involved in this 3HDPA pathway are still unknown. In this study, a dip gene cluster responsible for DPA degradation was cloned from strain JQ135. The expression of dip genes was induced by DPA and negatively regulated by DipR. A novel monooxygenase gene, dipD, was crucial for the initial hydroxylation of DPA into 3HDPA and proposed to encode the key catalytic component of the multicomponent DPA monooxygenase. The heme binding protein gene dipF, ferredoxin reductase gene dipG, and ferredoxin genes dipJ/dipK/dipL were also involved in the DPA hydroxylation and proposed to encode other components of the multicomponent DPA monooxygenase. The 18O2 stable isotope labeling experiments confirmed that the oxygen atom in the hydroxyl group of 3HDPA came from dioxygen molecule rather than water. The protein sequence of DipD exhibits no significant sequence similarities with known oxygenases, suggesting that DipD was a new member of oxygenase family. Moreover, bioinformatic survey suggested that the dip gene cluster was widely distributed in many Alpha-, Beta-, and Gammaproteobacteria, including soil bacteria, aquatic bacteria, and pathogens. This study provides new molecular insights into the catabolism of DPA in bacteria. IMPORTANCE Dipicolinic acid (DPA) is a natural pyridine derivative that serves as an essential component of the Bacillus spore. DPA accounts for 5 to 15% of the dry weight of spores. Due to the huge number of spores in the environment, DPA is also considered to be an important component of the global biomass carbon pool. DPA could be decomposed by microorganisms and enter the global carbon cycling; however, the underlying molecular mechanisms are rarely studied. In this study, a DPA catabolic gene cluster (dip) was cloned and found to be widespread in Alpha-, Beta-, and Gammaproteobacteria. The genes responsible for the initial hydroxylation of DPA to 3-hydroxyl-dipicolinic acid were investigated in Alcaligenes faecalis strain JQ135. The present study opens a door to elucidate the mechanism of DPA degradation and its possible role in DPA-based carbon biotransformation on earth.

The low-nanomolar 4-nitrobenzoate-responsive repressor PnbX negatively regulates the actinomycete-derived 4-nitrobenzoate-degrading pnb locus.

Nitroaromatic compounds pose severe threats to public health and environmental safety. Nitro group removal via ammonia release is an important strategy for bacterial detoxification of nitroaromatic compounds, such as the conversion of 4-nitrobenzoate (4-NBA) to protocatechuate by the bacterial pnb operon. In contrast to the LysR-family transcriptional regulator PnbR in proteobacteria, the actinomycete-derived pnb locus (4-NBA degradation structural genes) formed an operon with the TetR-family transcriptional regulator gene pnbX, implying that it has a distinct regulatory mechanism. Here, pnbBA from the actinomycete Nocardioides sp. strain LMS-CY was biochemically confirmed to express 4-NBA degradation enzymes, and pnbX was essential for inducible degradation of 4-NBA. Purified PnbX-6His could bind the promoter probe of the pnb locus in vitro, and 4-NBA prevented this binding. 4-NBA could bind PnbX at a 1:1 molar ratio with KD  = 26.7 ± 4.2 nM. Low-nanomolar levels of 4-NBA induced the transcription of the pnb operon in strain LMS-CY. PnbX bound a palindromic sequence motif (5'-TTACGTTACA-N8 -TGTAACGTAA-3') that encompasses the pnb promoter. This study identified a TetR-family repressor for the actinomycete-derived pnb operon that recognizes 10-8  M 4-NBA as its ligand, implying that nitro group removal of nitroaromatic compounds may be especially important for actinomycetes.

The Operon Encoding Hydrolytic Dehalogenation of 4-Chlorobenzoate Is Transcriptionally Regulated by the TetR-Type Repressor FcbR and Its Ligand 4-Chlorobenzoyl Coenzyme A.

The bacterial hydrolytic dehalogenation of 4-chlorobenzoate (4CBA) is a coenzyme A (CoA)-activation-type catabolic pathway that is usually a common part of the microbial mineralization of chlorinated aromatic compounds. Previous studies have shown that the transport and dehalogenation genes for 4CBA are typically clustered as an fcbBAT1T2T3C operon and inducibly expressed in response to 4CBA. However, the associated molecular mechanism remains unknown. In this study, a gene (fcbR) adjacent to the fcb operon was predicted to encode a TetR-type transcriptional regulator in Comamonas sediminis strain CD-2. The fcbR knockout strain exhibited constitutive expression of the fcb cluster. In the host Escherichia coli, the expression of the Pfcb -fused green fluorescent protein (gfp) reporter was repressed by the introduction of the fcbR gene, and genetic studies combining various catabolic genes suggest that the ligand for FcbR may be an intermediate metabolite. Purified FcbR could bind to the Pfcb DNA probe in vitro, and the metabolite 4-chlorobenzyl-CoA (4CBA-CoA) prevented FcbR binding to the P fcb DNA probe. Isothermal titration calorimetry (ITC) measurements showed that 4CBA-CoA could bind to FcbR at a 1:1 molar ratio. DNase I footprinting showed that FcbR protected a 42-bp DNA motif (5'-GGAAATCAATAGGTCCATAGAAAATCTATTGACTAATCGAAT-3') that consists of two sequence repeats containing four pseudopalindromic sequences (5'-TCNATNGA-3'). This binding motif overlaps with the -35 box of Pfcb and was proposed to prevent the binding of RNA polymerase. This study characterizes a transcriptional repressor of the fcb operon, together with its ligand, thus identifying halogenated benzoyl-CoA as belonging to the class of ligands of transcriptional regulators.IMPORTANCE The bacterial hydrolytic dehalogenation of 4CBA is a special CoA-activation-type catabolic pathway that plays an important role in the biodegradation of polychlorinated biphenyls and some herbicides. With genetic and biochemical approaches, the present study identified the transcriptional repressor and its cognate effector of a 4CBA hydrolytic dehalogenation operon. This work extends halogenated benzoyl-CoA as a new member of CoA-derived effector compounds that mediate allosteric regulation of transcriptional regulators.

McbG, a LysR Family Transcriptional Regulator, Activates the mcbBCDEF Gene Cluster Involved in the Upstream Pathway of Carbaryl Degradation in Pseudomonas sp. Strain XWY-1.

Although enzyme-encoding genes involved in the degradation of carbaryl have been reported in Pseudomonas sp. strain XWY-1, no regulator has been identified yet. In the mcbABCDEF cluster responsible for the upstream pathway of carbaryl degradation (from carbaryl to salicylate), the mcbA gene is constitutively expressed, while mcbBCDEF is induced by 1-naphthol, the hydrolysis product of carbaryl by McbA. In this study, we identified McbG, a transcriptional activator of the mcbBCDEF cluster. McbG is a 315-amino-acid protein with a molecular mass of 35.7 kDa. It belongs to the LysR family of transcriptional regulators and shows 28.48% identity to the pentachlorophenol (PCP) degradation transcriptional activation protein PcpR from Sphingobium chlorophenolicum ATCC 39723. Gene disruption and complementation studies reveal that mcbG is essential for transcription of the mcbBCDEF cluster in response to 1-naphthol in strain XWY-1. The results of the electrophoretic mobility shift assay (EMSA) and DNase I footprinting show that McbG binds to the 25-bp motif in the mcbBCDEF promoter area. The palindromic sequence TATCGATA within the motif is essential for McbG binding. The binding site is located between the -10 box and the transcription start site. In addition, McbG can repress its own transcription. The EMSA results show that a 25-bp motif in the mcbG promoter area plays an important role in McbG binding to the promoter of mcbG This study reveals the regulatory mechanism for the upstream pathway of carbaryl degradation in strain XWY-1. The identification of McbG increases the variety of regulatory models within the LysR family of transcriptional regulators.IMPORTANCEPseudomonas sp. strain XWY-1 is a carbaryl-degrading strain that utilizes carbaryl as the sole carbon and energy source for growth. The functional genes involved in the degradation of carbaryl have already been reported. However, the regulatory mechanism has not been investigated yet. Previous studies demonstrated that the mcbA gene, responsible for hydrolysis of carbaryl to 1-naphthol, is constitutively expressed in strain XWY-1. In this study, we identified a LysR-type transcriptional regulator, McbG, which activates the mcbBCDEF gene cluster responsible for the degradation of 1-naphthol to salicylate and represses its own transcription. The DNA binding site of McbG in the mcbBCDEF promoter area contains a palindromic sequence, which affects the binding of McbG to DNA. These findings enhance our understanding of the mechanism of microbial degradation of carbaryl.

A plasmid-based genomic screening system for transcriptional regulators of non-adjacent xenobiotic catabolism genes.

Bacteria play an important role in the catabolism of environmental xenobiotics. The study of transcriptional regulation has greatly enhanced our understanding of the molecular mechanisms associated with these processes. However, genes encoding transcription factors (TFs) for xenobiotic catabolism are usually not located in the immediate vicinity of the catabolic genes that they regulate; therefore, functional identification of these TFs is difficult. Significantly modified from a metagenome screening method substrate-induced gene expression (SIGEX), here we propose a synthetic pSRGFP-18 plasmid-based tool as a TF reporter system. In short, two multiple cloning sites (MCS) were designed; one in front of an egfp reporter gene was constructed for promoter insertion, and the other MCS was used for shotgun cloning of genomic DNA. Based on the regulatory relationship between TFs and the promoter of their associated catabolic genes, this approach allowed us to screen for TF genes using a genome shotgun approach. This system performed well when testing the known operons. Following statistical analysis of known catabolic operons in Escherichia coli and Bacillus subtilis, the suggested region of the target promoter for this system was from - 250 to + 150. Furthermore, to broaden the applicability of this plasmid, a series of pSRGFP-18 and pBBR1-based pSRGFP-X plasmids were constructed, which had broad host ranges and contained different antibiotic markers. This study outlines a powerful tool to enable functional identification of TFs for bacterial xenobiotic catabolism.

Methylomonas rhizoryzae sp. nov., a type I methanotroph isolated from the rhizosphere soil of rice.

A gammaproteobacterial methanotroph, strain GJ1T, was isolated from a rhizosphere soil sample of rice in Nanjing, China. The cells were Gram-negative, motile rods with a single polar flagellum, and they contained type I intracytoplasmic membranes. The cells formed pink colonies. The strain possessed both the particulate methane monooxygenase enzyme (pMMO) and the soluble methane monooxygenase enzyme (sMMO). pxmABC, encoding a divergent methane monooxygenase (pXMO), and nifH, which encodes dinitrogenase reductase, were also present. Methane and methanol were utilized as sole carbon sources, while other carbon sources, including acetate, pyruvate, succinate, citrate, malate, glucose, urea, methylamine, ethanol and formate, could not be utilized by strain GJ1T. Cell grew optimally at 25-33 °C (range 16-37 °C), pH 6.0-8.0 (range 5.5-8.5) and 0-1.2% NaCl (no growth above 1.5% NaCl). Phylogenetic analyses based on the 16S rRNA gene, pmoA and nifH showed that the isolate belongs to the genus Methylomonas of the family Methylococcaceae within the class Gammaproteobacteria. The major quinone was determined to be MQ-8, and the major fatty acids were observed to be C16:1 and C14:0. The genome size of strain GJ1T is about 4.55 Mb, and the DNA G + C content of the strain was determined to be 53.67 mol% within the range of the genus Methylomonas (47-58 mol%) reported at present. The average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values between strain GJ1T and Methylomonas koyamae Fw12E-YT among the genus Methylomonas were the highest, and they were only 74.66% and 21.40%, respectively. In consequence, results of phenotypic characterization and phylogenetic analyses support strain GJ1T as a novel species within the genus Methylomonas, namely, Methylomonas rhizoryzae sp. nov.. The type strain is GJ1T (= ACCC 61706).

Comparative genome analysis reveals the evolution of chloroacetanilide herbicide mineralization in Sphingomonas wittichii DC-6.

The environmental fate of the extensively used chloroacetanilide herbicides (CH) has been a cause of increasing concern in the past decade because of their carcinogenic properties. Although microbes play important roles in CH degradation, Sphingomonas wittichii DC-6 was the first reported CH-mineralizing bacterium. In this study, the complete genome of strain DC-6 was sequenced and comparative genomic analysis was performed using strain DC-6 and other three partial CH-degrading bacteria, Sphingobium quisquiliarum DC-2, Sphingobium baderi DE-13, and Sphingobium sp. MEA3-1. 16S rDNA phylogenetic analysis indicated that strain DC-2, MEA3-1, and DE-13 are closely related and DC-6 has relatively distant genetic relationship with the other three strains. The identified CH degradation genes responsible for the upstream and downstream pathway, including cndA, cmeH, meaXY, and meaAB, were all located in conserved DNA fragments (or genetic islands) in the vicinity of mobile element proteins. Protein BLAST in the NCBI database showed that cndA and cmeH were present in the genomes of other sequenced strains isolated from various habitats; however, the gene compositions in these host strains were completely different from those of other sphingomonads, and codon usage of genes for upstream pathway were also different from that of downstream pathway. These results showed that the upstream and downstream pathways of CH degradation in strain DC-6 have evolved by horizontal gene transfer and gene combination. In addition, the genes of the ring-cleavage pathway were not conserved and may have evolved directly from bacterial degradation of hydroxyquinol. The present study provides insights into the evolutionary strategy and microbial catabolic pathway of CH mineralization.

Complete Genome Sequence of Sphingobium baderi DE-13, an Alkyl-Substituted Aniline-Mineralizing Bacterium.

Alkyl-substituted aniline is an important aniline derivative that may be associated with serious environmental risks. Previously, Sphingobium baderi DE-13, a bacterium that can mineralize alkyl substituted anilines such as 2,6-dimethylaniline, 2,6-diethylaniline, 2-methyl-6-ethylaniline, 2-methylaniline, and 2-ethylaniline, was isolated from active sludge. Here, we report the complete genome sequence of strain DE-13. It contains one circular chromosome and eight circular plasmids with total 4,583,422 bp and GC content of 62.41%. The reported and predicted genes involved in the catabolism of alkyl-substituted anilines are indicated. This study will provide insights into the bacterial catabolism of alkyl substituted anilines.

The Two-Component Monooxygenase MeaXY Initiates the Downstream Pathway of Chloroacetanilide Herbicide Catabolism in Sphingomonads.

Due to the extensive use of chloroacetanilide herbicides over the past 60 years, bacteria have evolved catabolic pathways to mineralize these compounds. In the upstream catabolic pathway, chloroacetanilide herbicides are transformed into the two common metabolites 2-methyl-6-ethylaniline (MEA) and 2,6-diethylaniline (DEA) through N-dealkylation and amide hydrolysis. The pathway downstream of MEA is initiated by the hydroxylation of aromatic rings, followed by its conversion to a substrate for ring cleavage after several steps. Most of the key genes in the pathway have been identified. However, the genes involved in the initial hydroxylation step of MEA are still unknown. As a special aniline derivative, MEA cannot be transformed by the aniline dioxygenases that have been characterized. Sphingobium baderi DE-13 can completely degrade MEA and use it as a sole carbon source for growth. In this work, an MEA degradation-deficient mutant of S. baderi DE-13 was isolated. MEA catabolism genes were predicted through comparative genomic analysis. The results of genetic complementation and heterologous expression demonstrated that the products of meaX and meaY are responsible for the initial step of MEA degradation in S. baderi DE-13. MeaXY is a two-component flavoprotein monooxygenase system that catalyzes the hydroxylation of MEA and DEA using NADH and flavin mononucleotide (FMN) as cofactors. Nuclear magnetic resonance (NMR) analysis confirmed that MeaXY hydroxylates MEA and DEA at the para-position. Transcription of meaX was enhanced remarkably upon induction of MEA or DEA in S. baderi DE-13. Additionally, meaX and meaY were highly conserved among other MEA-degrading sphingomonads. This study fills a gap in our knowledge of the biochemical pathway that carries out mineralization of chloroacetanilide herbicides in sphingomonads.IMPORTANCE Much attention has been paid to the environmental fate of chloroacetanilide herbicides used for the past 60 years. Microbial degradation is considered an important mechanism in the degradation of these compounds. Bacterial degradation of chloroacetanilide herbicides has been investigated in many recent studies. Pure cultures or consortia able to mineralize these herbicides have been obtained. The catabolic pathway has been proposed, and most key genes involved have been identified. However, the genes responsible for the initiation step (from MEA to hydroxylated MEA or from DEA to hydroxylated DEA) of the downstream pathway have not been reported. The present study demonstrates that a two-component flavin-dependent monooxygenase system, MeaXY, catalyzes the para-hydroxylation of MEA or DEA in sphingomonads. Therefore, this work finds a missing link in the biochemical pathway that carries out the mineralization of chloroacetanilide herbicides in sphingomonads. Additionally, the results expand our understanding of the degradation of a special kind of aniline derivative.

PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

Mangrovibacter yixingensis sp. nov., isolated from farmland soil.

A Gram-staining-negative, facultatively anaerobic, rod-shaped, nitrogen-fixing bacterial strain, designated TULL-AT, was isolated from a farmland soil sample in Yixing, China. The optimal conditions for growth were 30 °C, pH 7.0-8.0 and 0% (w/v) NaCl. Q8 was the dominant respiratory quinone and the major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and aminophospholipid. Phylogenetic analysis of 16S rRNA gene sequences showed that strain TULL-AT was most closely related to Mangrovibacter plantisponsor MSSRF40T (99.6%), followed by Salmonella enterica subsp. diarizonae DSM 14847T (96.8%) and Cronobacter condimenti 1330T (96.8 %). Sequence analysis of the genes rpoB, gyrB and hsp60 revealed that those of strain TULL-AT also exhibit high sequence similarity with those of the species M. plantisponsor MSSRF40T (95.5, 94.1 and 93.4%). The genomic DNA G+C content was 52 mol%. The major fatty acids of strain TULL-AT were C16 : 0, C16 : 1ω7c and/or C16 : 1ω6c, C18 : 1ω7c /C18 : 1ω6c, C14 : 0, C14 : 0 3-OH/iso-C16 : 1 I and iso-C17 : 1 I and/or anteiso-C17 : 1 B. Strain TULL-AT showed low DNA-DNA relatedness with M. plantisponsor MSSRF40T (35.10 ± 1.41%). Based on the multiple genotypic and phenotypic data, strain TULL-AT is considered to represent a novel species of the genus Mangrovibacter, for which the name Mangrovibacter yixingensis sp. nov. is proposed. The type strain is TULL-AT ( = ACCC 19709T = KCTC 42181T).

Flavobacterium suzhouense sp. nov., isolated from farmland river sludge.

A Gram-stain-negative bacterium, designated XIN-1(T), was isolated from a farmland river sludge sample in Suzhou, China. Cells of strain XIN-1(T) were strictly aerobic, non-motile and rod-shaped. Strain XIN-1(T) grew optimally at pH 7.0 and 28 °C. Phylogenetic analysis of the 16S rRNA gene sequences showed that strain XIN-1(T) was most closely related to Flavobacterium hauense BX12(T) (98.2 % sequence similarity), followed by Flavobacterium beibuense F44-8(T) (96.3 %). The major respiratory quinone was menaquinone-6 and the major polar lipid was phosphatidylethanolamine. The major fatty acids (>5 %) were summed feature 3 (comprising C16 : 1ω7c and/or C16 : 1ω6c), summed feature 4 (comprising iso-C17 : 1 I and/or anteiso-C17 : 1 B), iso-C15 : 0, C16 : 0 and iso-C17 : 0 3-OH. The genomic DNA G+C content of strain XIN-1(T) was 39.8 mol%. Strain XIN-1(T) showed low DNA-DNA relatedness with F. hauense BX12(T) (38.7±0.5 %). On the basis of genotypic and phenotypic data, strain XIN-1(T) is considered to represent a novel species of the genus Flavobacterium, for which the name Flavobacterium suzhouense sp. nov. is proposed. The type strain is XIN-1(T) ( = CCTCC AB 2014200(T) = KCTC 42107(T)).