Real-time PCR detection of Toxoplasma gondii in surface water samples in São Paulo, Brazil.

Water is considered an important vehicle for the spread of human toxoplasmosis in several countries. Toxoplasma gondii oocysts can persist in the environment for long periods, being highly resistant to the various chemical inactivation processes commonly used by water supply systems, distinctly from simple filtration and flocculation that are efficient in removing oocysts from drinking water. The existing methodologies for identification and quantification of this parasite in water samples are not standardized and have limitations. This study aimed to evaluate the presence of T. gondii oocysts in surface water samples used as a source for the production of drinking water in the State of São Paulo, through the implementation of a specific methodology using real-time PCR technique (qPCR). Volumes of 20 L of the sample were concentrated by filtration in Envirocheck® HV capsules. For DNA extraction, the PowerSoil DNA isolation® kit (currently DNeasy PowerSoil®) was used. The target sequence selected for qPCR was a 62-base-pair fragment of the B1 gene. In the initial recovery evaluation of the method in four replicates of reverse osmosis water, the mean recovery was 48.5% (SD ± 11.5), while the mean recovery for method performance in matrices was 3.2% (SD ± 3.2) (rainy season) and 62.0% (SD ± 6.2) (dry period), suggesting that the characteristics of the samples and the climatic conditions interfere in the recovery efficiency. Of the 39 samples analyzed (May to December 2015), 7.7% (3/39) were positive for T. gondii, and among the ten sources studied; the occurrence of the oocysts was detected in 30% (3/10).

Hepatitis A Outbreaks and Environmental Circulation of Genotype IA Strains in the São Paulo City, 2017-2018.

Hepatitis A virus (HAV) is the major cause of enterically transmitted infectious hepatitis. Between 2016 and 2017, the number of confirmed cases of hepatitis A virus (HAV) increased from 64 to 786 in São Paulo affecting mainly adults aged between 18 and 39 years (80%) and males (88%). To support epidemiological surveillance, the present study monitored the presence of HAV in urban sewage samples collected bimonthly for 1 year (November 2017-November 2018) in the central region of the city, where most of cases were detected. Sewage samples were concentrated by polyethylene glycol precipitation and HAV RNA was quantified by RT-qPCR. Nucleotide sequencing targeting the VP1/2A junction region was carried out to genotype the HAV strains. HAV was detected in 76.9% (40/52) of the samples, with a geometric mean viral load of 5.09 × 104 (± SD 4.51 × 105) genome copies (GC/L) (Mauá Street) and 5.27 × 104 (± SD 1.26 × 106) GC/L (Prestes Maia Avenue). Of the 40 positive samples, 8 were typed as HAV subgenotype IA [100% nucleotide (nt) identity with HAV strain VRD_521_2016]. Highest homology was obtained with sequences from European countries (Italy, Spain) and Israel, all of which had reported recent HAV outbreaks associated with men who have sex with men. Our results highlight that wastewater surveillance is a useful tool to support investigating HAV outbreaks in the community, including circulating genotypes.

Detection and molecular characterization of Cryptosporidium species and Giardia assemblages in two watersheds in the metropolitan region of São Paulo, Brazil.

Cryptosporidium and Giardia are associated with cases of water and foodborne outbreaks in the world. This study included 50 samples of surface raw water collected from two watersheds in the state of São Paulo, Brazil. The isolation of (oo)cysts was performed in accordance with the U.S. Environmental Protection Agency's methods 1623 and genotypic characterization and quantification were carried out by Nested PCR and qPCR assays based on 18S rRNA and gdh genes, respectively. U.S. EPA 1623 method showed the presence of (oo)cysts in 40% ([Formula: see text] = 0.10 oocysts/L) and 100% ([Formula: see text] = 7.6 cysts/L) of samples from São Lourenço River, respectively, and 24% ([Formula: see text] = 0.8 oocysts/L) and 60% ([Formula: see text] = 1.64 cysts/L) of Guarapiranga Reservoir, respectively. The qPCR assay detected C. hominis/parvum in 52% (0.06 to 1.85 oocysts/L) of São Lourenço River and 64% (0.09 to 1.4 oocysts/L) of Guarapiranga Reservoir samples. Presence/absence test for Giardia intestinalis was positive in 92% of São Lourenço River and 8% of Guarapiranga Reservoir samples. The assemblage A was detected in 16% (0.58 to 2.67 cysts/L) in São Lourenço River and no positive samples were obtained for assemblage B in both water bodies. The characterization of anthroponotic species C. parvum/hominis, G. intestinalis, and assemblage A was valuable in the investigation of possible sources of contamination in the watersheds studied confirming the need of expanding environmental monitoring measures for protection of these water sources in our country.

Assessing the infection risk of Giardia and Cryptosporidium in public drinking water delivered by surface water systems in Sao Paulo State, Brazil.

A survey of Giardia and Cryptosporidium was conducted in surface water used as drinking water sources by public water systems in four densely urbanized regions of Sao Paulo State, Brazil. A Quantitative Microbial Risk Assessment, based on protozoa concentrations, was performed to estimate the probability of protozoa infection associated with drinking water ingestion. A total of 206 source water samples were analyzed over a 24 month period using the USEPA Method 1623. The risk of infection was estimated using an exponential dose response model, children and adults exposure and a gamma distribution for (oo)cyst concentrations with three scenarios for treating censored data. Giardia was detected in 102 of the samples, and 19 of them were also positive for Cryptosporidium, with maximum concentrations of 97.0 cysts/L and 6.0 oocysts/L, respectively. Risk distributions were similar for the three scenarios. In the four regions, the estimated risk of Giardia infection per year, for adults and children, ranged from 0.29% to 2.47% and from 0.08% to 0.70%, respectively. Cryptosporidium risk infection varied from 0.15% to 0.29% for adults and from 0.04% to 0.08% for children. In both cases, the calculated risk surpassed the risk of infection of 10(-4) (1:10,000) defined as tolerable by USEPA for a yearly exposure. The probability of Giardia infection was very close to the rates of acute diarrheic disease for adults (1% to 3%) but lower for children (2% to 7%). The daily consumption of drinking water was an important contributing factor for these differences. The Microbiological Risk Assessment carried out in this study provides an indication of infection risks by Giardia and Cryptosporidium in the population served by these source waters. Strategies for source water protection and performance targets for the water treatment should be established to achieve the required level of public health risk.

Quantificação de oocistos de Toxoplasma gondii em amostras de águas superficiais no Estado de São Paulo / Quantification of Toxoplasma gondii oocysts in surface water samples in São Paulo

Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo

Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5\' TAGTATCGTGCGGCAATGTG 3\' (531-551) and 5\'GGCAGCGTCTCTTCCTCTTTT 3\' (571-592) were used. The probe employed was 5 \'(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3\'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo