Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 163
Filtrar
Mais filtros

Tipo de documento
Intervalo de ano de publicação
1.
Neurobiol Dis ; 199: 106556, 2024 Jun 06.
Artigo em Inglês | MEDLINE | ID: mdl-38851544

RESUMO

Mutation of the ATL1 gene is one of the most common causes of hereditary spastic paraplegia (HSP), a group of genetic neurodegenerative conditions characterised by distal axonal degeneration of the corticospinal tract axons. Atlastin-1, the protein encoded by ATL1, is one of three mammalian atlastins, which are homologous dynamin-like GTPases that control endoplasmic reticulum (ER) morphology by fusing tubules to form the three-way junctions that characterise ER networks. However, it is not clear whether atlastin-1 is required for correct ER morphology in human neurons and if so what the functional consequences of lack of atlastin-1 are. Using CRISPR-inhibition we generated human cortical neurons lacking atlastin-1. We demonstrate that ER morphology was altered in these neurons, with a reduced number of three-way junctions. Neurons lacking atlastin-1 had longer endosomal tubules, suggestive of defective tubule fission. This was accompanied by reduced lysosomal proteolytic capacity. As well as demonstrating that atlastin-1 is required for correct ER morphology in human neurons, our results indicate that lack of a classical ER-shaping protein such as atlastin-1 may cause altered endosomal tubulation and lysosomal proteolytic dysfunction. Furthermore, they strengthen the idea that defective lysosome function contributes to the pathogenesis of a broad group of HSPs, including those where the primary localisation of the protein involved is not at the endolysosomal system.

2.
J Transl Med ; 22(1): 629, 2024 Jul 05.
Artigo em Inglês | MEDLINE | ID: mdl-38970118

RESUMO

BACKGROUND: Magnesium is a micronutrient and an intracellular cation responsible for different biochemical reactions involved in energy production and storage, control of neuronal and vasomotor activity, cardiac excitability, and muscle contraction. Magnesium deficiency may result in impaired physical performance. Moreover, magnesium plays an important role on delayed onset muscle soreness after training. Thus, physically active individuals and sport specialists have to pay attention to magnesium supplementation (MgS). However, the type, timing and dosage of magnesium intake are not well elucidated yet. Hence, we aimed to systematically review the literature regarding the effects of MgS on muscle soreness in physically active individuals. We focused exclusively on MgS, excluding those studies in which magnesium was administered together with other substances. METHODS: Three electronic databases and literature sources (PUBMED, SCOPUS and Web of Sciences-Core Collection) were searched, in accordance with PRISMA guidelines. After the database search, 1254 articles were identified, and after excluding duplicates, 960 articles remained. Among these, 955 were excluded following the title and abstract screening. The remaining 5 articles were screened in full text and 4 study met the eligibility criteria. RESULTS: These studies showed that MgS reduced muscle soreness, improved performance, recovery and induced a protective effect on muscle damage. CONCLUSION: To reach these positive effects, individuals engaged in intense exercise should have a Mg requirement 10-20% higher than sedentary people, to be taken in capsules and 2 h before training. Moreover, it is suggested to maintain magnesium levels in the recommended range during the off-season. SYSTEMATIC REVIEW REGISTRATION: PROSPERO registration number: CRD42024501822.


Assuntos
Suplementos Nutricionais , Exercício Físico , Magnésio , Mialgia , Humanos , Masculino , Magnésio/administração & dosagem , Magnésio/farmacologia , Mialgia/tratamento farmacológico
3.
Eur J Clin Microbiol Infect Dis ; 43(5): 895-904, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38472522

RESUMO

PURPOSE: Campylobacter is a frequent cause of enteric infections with common antimicrobial resistance issues. The most recent reports of campylobacteriosis in Italy include data from 2013 to 2016. We aimed to provide national epidemiological and microbiological data on human Campylobacter infections in Italy during the period 2017-2021. METHODS: Data was collected from 19 Hospitals in 13 Italian Regions. Bacterial identification was performed by mass spectrometry. Antibiograms were determined with Etest or Kirby-Bauer (EUCAST criteria). RESULTS: In total, 5419 isolations of Campylobacter spp. were performed. The most common species were C. jejuni (n = 4535, 83.7%), followed by C. coli (n = 732, 13.5%) and C. fetus (n = 34, 0.6%). The mean age of patients was 34.61 years and 57.1% were males. Outpatients accounted for 54% of the cases detected. Campylobacter were isolated from faeces in 97.3% of cases and in 2.7% from blood. C. fetus was mostly isolated from blood (88.2% of cases). We tested for antimicrobial susceptibility 4627 isolates (85.4%). Resistance to ciprofloxacin and tetracyclines was 75.5% and 54.8%, respectively; resistance to erythromycin was 4.8%; clarithromycin 2% and azithromycin 2%. 50% of C. jejuni and C. coli were resistant to ≥ 2 antibiotics. Over the study period, resistance to ciprofloxacin and tetracyclines significantly decreased (p < 0.005), while resistance to macrolides remained stable. CONCLUSION: Campylobacter resistance to fluoroquinolones and tetracyclines in Italy is decreasing but is still high, while macrolides retain good activity.


Assuntos
Antibacterianos , Infecções por Campylobacter , Campylobacter , Testes de Sensibilidade Microbiana , Humanos , Infecções por Campylobacter/epidemiologia , Infecções por Campylobacter/microbiologia , Itália/epidemiologia , Feminino , Masculino , Adulto , Antibacterianos/farmacologia , Pessoa de Meia-Idade , Adulto Jovem , Adolescente , Idoso , Campylobacter/efeitos dos fármacos , Campylobacter/isolamento & purificação , Criança , Pré-Escolar , Lactente , Fezes/microbiologia , Farmacorresistência Bacteriana , Idoso de 80 Anos ou mais , Recém-Nascido , Campylobacter jejuni/efeitos dos fármacos , Campylobacter jejuni/isolamento & purificação
4.
Bioorg Chem ; 147: 107304, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38643563

RESUMO

Increasing the selectivity of chemotherapies by converting them into prodrugs that can be activated at the tumour site decreases their side effects and allows discrimination between cancerous and non-cancerous cells. Herein, the use of metabolic glycoengineering (MGE) to selectively label MCF-7 breast cancer cells with tetrazine (Tz) activators for subsequent activation of prodrugs containing the trans-cyclooctene (TCO) moiety by a bioorthogonal reaction is demonstrated. Three novel Tz-modified monosaccharides, Ac4ManNTz 7, Ac4GalNTz 8, and Ac4SiaTz 16, were used for expression of the Tz activator within sialic-acid rich breast cancer cells' surface glycans through MGE. Tz expression on breast cancer cells (MCF-7) was evaluated versus the non-cancerous L929 fibroblasts showing a concentration-dependant effect and excellent selectivity with ≥35-fold Tz expression on the MCF-7 cells versus the non-cancerous L929 fibroblasts. Next, a novel TCO-N-mustard prodrug and a TCO-doxorubicin prodrug were analyzed in vitro on the Tz-bioengineered cells to probe our hypothesis that these could be activated via a bioorthogonal reaction. Selective prodrug activation and restoration of cytotoxicity were demonstrated for the MCF-7 breast cancer cells versus the non-cancerous L929 cells. Restoration of the parent drug's cytotoxicity was shown to be dependent on the level of Tz expression where the Ac4ManNTz 7 and Ac4GalNTz 8 derivatives (20 µM) lead to the highest Tz expression and full restoration of the parent drug's cytotoxicity. This work suggests the feasibility of combining MGE and tetrazine ligation for selective prodrug activation in breast cancer.


Assuntos
Antineoplásicos , Neoplasias da Mama , Pró-Fármacos , Pró-Fármacos/química , Pró-Fármacos/farmacologia , Pró-Fármacos/síntese química , Humanos , Neoplasias da Mama/tratamento farmacológico , Neoplasias da Mama/patologia , Neoplasias da Mama/metabolismo , Antineoplásicos/química , Antineoplásicos/farmacologia , Antineoplásicos/síntese química , Feminino , Estrutura Molecular , Ensaios de Seleção de Medicamentos Antitumorais , Relação Estrutura-Atividade , Células MCF-7 , Relação Dose-Resposta a Droga , Proliferação de Células/efeitos dos fármacos , Engenharia Metabólica , Sobrevivência Celular/efeitos dos fármacos
5.
New Microbiol ; 47(1): 28-32, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38700880

RESUMO

Acute respiratory tract infections (ARI) are common diseases in children and adults and could cause severe infections in high-risk patients, like the immunocompromised and elderly, and are the leading cause of morbidity, hospitalization and mortality. This study aimed to explore the prevalence of respiratory viruses and the clinical impact of single- and multi-infection among hospitalized patients in various age groups. 3578 nasopharyngeal swabs (NPS) were analyzed for pathogen detection of acute respiratory tract infections. 930 out of 3578 NPS were diagnosed positive for at least one respiratory virus. The distribution of viral infections, prevalence and pathogen, differed significantly among age groups. Most RTI are observed in the age group over 65 years (50.6%) with a high SARS-CoV2 prevalence, following by group <5 years (25.6%), where the most frequently detected viruses were RSV, Rhinovirus, FluA-H3, MPV, and AdV. The co-infection rate also varies according to age and, in some cases, especially in older adults, could have severe clinical impact. This study emphasizes that it is important to know and analyze, in all age groups of hospitalized patients, the epidemiology of respiratory viruses, the prevalence of coinfections, and the clinical impact of various pathogens. Furthermore, in a clinical setting, the rapid diagnosis of respiratory infections by means of molecular tests is crucial not only to avoid hospital outbreaks, but also to allow early and optimal treatment to reduce morbidity and mortality.


Assuntos
Coinfecção , Infecções Respiratórias , Humanos , Infecções Respiratórias/epidemiologia , Infecções Respiratórias/virologia , Idoso , Adulto , Pessoa de Meia-Idade , Pré-Escolar , Adolescente , Criança , Masculino , Adulto Jovem , Feminino , Lactente , Coinfecção/epidemiologia , Coinfecção/virologia , Idoso de 80 Anos ou mais , COVID-19/epidemiologia , Prevalência , Hospitalização , SARS-CoV-2 , Viroses/epidemiologia , Viroses/virologia , Recém-Nascido , Pandemias , Vírus/isolamento & purificação , Vírus/classificação , Vírus/genética
6.
J Med Virol ; 95(11): e29193, 2023 11.
Artigo em Inglês | MEDLINE | ID: mdl-37927140

RESUMO

Since the beginning of the pandemic, SARS-CoV-2 has shown a great genomic variability, resulting in the continuous emergence of new variants that has made their global monitoring and study a priority. This work aimed to study the genomic heterogeneity, the temporal origin, the rate of viral evolution and the population dynamics of the main circulating variants (20E.EU1, Alpha and Delta) in Italy, in August 2020-January 2022 period. For phylogenetic analyses, three datasets were set up, each for a different main lineage/variant circulating in Italy in that time including other Italian and International sequences of the same lineage/variant, available in GISAID sampled in the same times. The international dataset showed 26 (23% Italians, 23% singleton, 54% mixed), 40 (60% mixed, 37.5% Italians, 1 singleton) and 42 (85.7% mixed, 9.5% singleton, 4.8% Italians) clusters with at least one Italian sequence, in 20E.EU1  clade, Alpha and Delta variants, respectively. The estimation of tMRCAs in the Italian clusters (including >70% of genomes from Italy) showed that in all the lineage/variant, the earliest clusters were the largest in size and the most persistent in time and frequently mixed. Isolates from the major Italian Islands tended to segregate in clusters more frequently than those from other part of Italy. The study of infection dynamics showed a positive correlation between the trend in the effective number of infections estimated by BSP model and the Re curves estimated by birth-death skyline plot. The present work highlighted different evolutionary dynamics of studied lineages with high concordance between epidemiological parameters estimation and phylodynamic trends suggesting that the mechanism of replacement of the SARS-CoV-2 variants must be related to a complex of factors involving the transmissibility, as well as the implementation of control measures, and the level of cross-immunization within the population.


Assuntos
COVID-19 , SARS-CoV-2 , Humanos , SARS-CoV-2/genética , Filogenia , COVID-19/epidemiologia , Genômica , Itália/epidemiologia
7.
Chemistry ; 29(20): e202203942, 2023 Apr 06.
Artigo em Inglês | MEDLINE | ID: mdl-36656616

RESUMO

Bioorthogonal chemistry involves selective biocompatible reactions between functional groups that are not normally present in biology. It has been used to probe biomolecules in living systems, and has advanced biomedical strategies such as diagnostics and therapeutics. In this review, the challenges and opportunities encountered when translating in vitro bioorthogonal approaches to in vivo settings are presented, with a focus on methods to deliver the bioorthogonal reaction components. These methods include metabolic bioengineering, active targeting, passive targeting, and simultaneously used strategies. The suitability of bioorthogonal ligation reactions and bond cleavage reactions for in vivo applications is critically appraised, and practical considerations such as the optimum scheduling regimen in pretargeting approaches are discussed. Finally, we present our own perspectives for this area and identify what, in our view, are the key challenges that must be overcome to maximise the impact of these approaches.

8.
BMC Med Res Methodol ; 23(1): 166, 2023 07 11.
Artigo em Inglês | MEDLINE | ID: mdl-37434136

RESUMO

BACKGROUND: Frailty, neurodegeneration and geriatric syndromes cause a significant impact at the clinical, social, and economic level, mainly in the context of the aging world. Recently, Information and Communication Technologies (ICTs), virtual reality tools, and machine learning models have been increasingly applied to the care of older patients to improve diagnosis, prognosis, and interventions. However, so far, the methodological limitations of studies in this field have prevented to generalize data to real-word. This review systematically overviews the research designs used by studies applying technologies for the assessment and treatment of aging-related syndromes in older people. METHODS: Following the PRISMA guidelines, records from PubMed, EMBASE, and Web of Science were systematically screened to select original articles in which interventional or observational designs were used to study technologies' applications in samples of frail, comorbid, or multimorbid patients. RESULTS: Thirty-four articles met the inclusion criteria. Most of the studies used diagnostic accuracy designs to test assessment procedures or retrospective cohort designs to build predictive models. A minority were randomized or non-randomized interventional studies. Quality evaluation revealed a high risk of bias for observational studies, while a low risk of bias for interventional studies. CONCLUSIONS: The majority of the reviewed articles use an observational design mainly to study diagnostic procedures and suffer from a high risk of bias. The scarce presence of methodologically robust interventional studies may suggest that the field is in its infancy. Methodological considerations will be presented on how to standardize procedures and research quality in this field.


Assuntos
Fragilidade , Multimorbidade , Humanos , Idoso , Fragilidade/diagnóstico , Fragilidade/epidemiologia , Fragilidade/terapia , Projetos de Pesquisa , Estudos Retrospectivos , Síndrome , Comorbidade
9.
Bioorg Chem ; 131: 106325, 2023 02.
Artigo em Inglês | MEDLINE | ID: mdl-36577221

RESUMO

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes.


Assuntos
Antineoplásicos , Complexos de Coordenação , Compostos de Platina , Antineoplásicos/farmacologia , Antineoplásicos/química , Cisplatino/química , Complexos de Coordenação/farmacologia , Nucleosídeos/farmacologia , Nucleotídeos , Compostos de Platina/química , Compostos de Platina/farmacologia
10.
Int J Sports Med ; 44(10): 704-710, 2023 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-37429319

RESUMO

Thyroid hormones play a crucial role in skeletal muscle development, suggesting that thyroid function may influence muscle mass and muscle strength, which are both fundamental health-related indicators of several age-related consequences. However, whether there is a relationship between thyroid hormones, muscle mass, and muscle strength in individuals without thyroid dysfunctions is still unknown. Therefore, this systematic review aims to investigate whether thyroid hormones are related to muscle mass and strength parameters in euthyroid individuals. Three databases were searched (PubMed, Scopus, Web of Science) up to February 14, 2022, for peer-reviewed papers published in English. The search results were conducted independently by two different reviewers. The review included 13 studies with a total of 241,044 participants. All studies were observational: twelve studies measured thyroid stimulating hormone, ten and thirteen studies measured free triiodothyronine and free thyroxine, four studies analyzed the thyroid hormone ratio. The assessment methods for muscle mass were computed tomography, dual-energy X-ray absorptiometry and bioimpedance analysis, whereas hand dynamometer for muscle strength. Low levels within the normal range of free triiodothyronine, high levels within the normal range of free thyroxine, and lower thyroid hormone ratio may contribute to a reduced muscle function, which seems more evident in older males.


Assuntos
Tiroxina , Tri-Iodotironina , Masculino , Humanos , Idoso , Hormônios Tireóideos , Tireotropina , Músculos
11.
Int J Mol Sci ; 24(9)2023 May 05.
Artigo em Inglês | MEDLINE | ID: mdl-37176020

RESUMO

Muscular dystrophies (MDs) are a heterogeneous group of myopathies characterized by progressive muscle weakness leading to death from heart or respiratory failure. MDs are caused by mutations in genes involved in both the development and organization of muscle fibers. Several animal models harboring mutations in MD-associated genes have been developed so far. Together with rodents, the zebrafish is one of the most popular animal models used to reproduce MDs because of the high level of sequence homology with the human genome and its genetic manipulability. This review describes the most important zebrafish mutant models of MD and the most advanced tools used to generate and characterize all these valuable transgenic lines. Zebrafish models of MDs have been generated by introducing mutations to muscle-specific genes with different genetic techniques, such as (i) N-ethyl-N-nitrosourea (ENU) treatment, (ii) the injection of specific morpholino, (iii) tol2-based transgenesis, (iv) TALEN, (v) and CRISPR/Cas9 technology. All these models are extensively used either to study muscle development and function or understand the pathogenetic mechanisms of MDs. Several tools have also been developed to characterize these zebrafish models by checking (i) motor behavior, (ii) muscle fiber structure, (iii) oxidative stress, and (iv) mitochondrial function and dynamics. Further, living biosensor models, based on the expression of fluorescent reporter proteins under the control of muscle-specific promoters or responsive elements, have been revealed to be powerful tools to follow molecular dynamics at the level of a single muscle fiber. Thus, zebrafish models of MDs can also be a powerful tool to search for new drugs or gene therapies able to block or slow down disease progression.


Assuntos
Doenças Musculares , Distrofias Musculares , Animais , Humanos , Peixe-Zebra/genética , Distrofias Musculares/genética , Animais Geneticamente Modificados/genética , Fibras Musculares Esqueléticas/patologia
12.
Int J Mol Sci ; 24(5)2023 Feb 23.
Artigo em Inglês | MEDLINE | ID: mdl-36901879

RESUMO

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications.


Assuntos
Técnicas Biossensoriais , Nanoestruturas , Óxido de Zinco , Óxido de Zinco/química , Nanoestruturas/química , Biotina/química , Técnicas Biossensoriais/métodos
13.
Small ; 18(41): e2204732, 2022 10.
Artigo em Inglês | MEDLINE | ID: mdl-36089668

RESUMO

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg-1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL-1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy.


Assuntos
Antineoplásicos , Nanopartículas , Ácidos Nucleicos Peptídicos , Antineoplásicos/química , Antineoplásicos/farmacologia , Antígeno B7-H1 , Linhagem Celular Tumoral , Terra de Diatomáceas , Dissulfetos , Ligantes , Nanopartículas/química , Oxirredução , Peptídeos , Polietilenoglicóis/química , Receptor de Morte Celular Programada 1 , Dióxido de Silício
14.
Mol Pharm ; 19(1): 345-353, 2022 01 03.
Artigo em Inglês | MEDLINE | ID: mdl-34842438

RESUMO

Here, we evaluated the feasibility of non-prodrug PEG-drug conjugates to decrease the accumulation of drugs within the placental tissues. The results showed that PEG was biocompatible with the human placenta with no alteration of the basal rate of proliferation or apoptosis in term placental explants. No significant changes in the released levels of lactate dehydrogenase and the human chorionic gonadotropin were observed after PEG treatment. The cellular uptake studies revealed that conjugating Cy5.5 and haloperidol to PEG significantly reduced (by up to ∼40-fold) their uptake by the placenta. These findings highlight the viability of novel non-prodrug polymer-drug conjugates to avoid the accumulation of drugs within the placenta.


Assuntos
Placenta/metabolismo , Polietilenoglicóis/química , Complicações na Gravidez/tratamento farmacológico , Composição de Medicamentos/métodos , Feminino , Haloperidol/farmacocinética , Humanos , Placenta/efeitos dos fármacos , Polietilenoglicóis/efeitos adversos , Polímeros , Gravidez
15.
BMC Health Serv Res ; 22(1): 545, 2022 Apr 23.
Artigo em Inglês | MEDLINE | ID: mdl-35461276

RESUMO

BACKGROUND: The use of variable rate intravenous insulin infusion (VRIII) is a complex process that has consistently been implicated in reports of error and consequent harm. Investment in patient safety has focused mainly on learning from errors, though this has yet to be proved to reduce error rates. The Resilient Health Care approach advocates learning from everyday practices. Video reflexive ethnography (VRE) is an innovative methodology used to capture everyday practices, reflect on and thereby improve these. This study set out to explore the use of VRIIIs by utilising the VRE methodology. METHODS: This study was conducted in a Vascular Surgery Unit. VRE methodology was used to collect qualitative data that involved videoing healthcare practitioners caring for patients treated with VRIII and discussing the resulting clips with participants in reflexive meetings. Transcripts of these were subjected to thematic analysis. Quantitative data (e.g. blood glucose measurements) were collected from electronic patient records in order to contextualise the outcomes of the video-observed tasks. RESULTS: The use of VRE in conjunction with quantitative data revealed that context-dependent adaptations (seeking verbal orders to treat hypoglycaemia) and standardised practices (using VRIII guidelines) were strategies used in everyday work. Reflexive meetings highlighted the challenges faced while using VRIII, which were mainly related to lack of clinical knowledge, e.g. prescribing/continuing long-acting insulin analogues alongside the VRIII, and problems with organisational infrastructure, i.e. the wireless blood glucose meter results sometimes not updating on the electronic system. Reflexive meetings also enabled participants to share the meanings of the reality surrounding them and encouraged them to suggest solutions tailored to their work, for example face-to-face, VRIII-focused training. CONCLUSIONS: VRE deepened understanding of VRIII by shedding light on its essential tasks and the challenges and adaptations entailed by its use. Future research might focus on collecting data across various units and hospitals to develop a full picture of the use of VRIIIs.


Assuntos
Hipoglicemia , Insulina , Antropologia Cultural , Glicemia , Humanos , Infusões Intravenosas
16.
Anaerobe ; 75: 102583, 2022 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-35568274

RESUMO

INTRODUCTION: A lack of updated data on the burden and profile of anaerobic bloodstream infections (ABIs) exists. We assessed the incidence of ABIs and trends in antimicrobial resistance in anaerobes isolated from blood in Italy. MATERIAL AND METHODS: We conducted a retrospective study on 17 Italian hospitals (2016-2020). Anaerobes isolated from blood culture and their in vitro susceptibility profiles (EUCAST-interpreted) were registered and analyzed. RESULTS: A total of 1960 ABIs were identified. The mean age of ABIs patients was 68.6 ± 18.5 years, 57.6% were males. The overall incidence rate of ABIs was 1.01 per 10.000 patient-days. Forty-seven% of ABIs occurred in medical wards, 17% in ICUs, 14% in surgical wards, 7% in hemato-oncology, 14% in outpatients. The three most common anti-anaerobic tested drugs were metronidazole (92%), clindamycin (89%) and amoxicillin/clavulanate (83%). The three most common isolated anaerobes were Bacteroides fragilis (n = 529), Cutibacterium acnes (n = 262) and Clostridium perfringens (n = 134). The lowest resistance rate (1.5%) was to carbapenems, whereas the highest rate (51%) was to penicillin. Clindamycin resistance was >20% for Bacteroides spp., Prevotella spp. and Clostridium spp. Metronidazole resistance was 9.2% after excluding C. acnes and Actinomyces spp. Bacteroides spp. showed an increased prevalence of clindamycin resistance through the study period: 19% in 2016, 33% in 2020 (p ≤ 0.001). CONCLUSIONS: Our data provide a comprehensive overview of the epidemiology of ABIs in Italy, filling a gap that has existed since 1995. Caution is needed when clindamycin is used as empirical anti-anaerobic drug.


Assuntos
Infecções Bacterianas , Sepse , Idoso , Idoso de 80 Anos ou mais , Anaerobiose , Antibacterianos/farmacologia , Antibacterianos/uso terapêutico , Bactérias Anaeróbias , Infecções Bacterianas/microbiologia , Clindamicina , Farmacorresistência Bacteriana , Feminino , Humanos , Masculino , Metronidazol , Testes de Sensibilidade Microbiana , Pessoa de Meia-Idade , Estudos Retrospectivos
17.
Molecules ; 27(15)2022 Jul 25.
Artigo em Inglês | MEDLINE | ID: mdl-35897938

RESUMO

Antiangiogenic agents attenuate tumours' growth and metastases and are therefore beneficial as an adjuvant or standalone cancer regimen. Drugs with dual antiproliferative and antiangiogenic activities can achieve anticancer efficacy and overcome acquired resistance. In this study, synthetic flavones (5a,b) with reported anticancer activity, and derivatives (4b and 6a), exhibited significant inhibition of endothelial cell tube formation (40-55%, 12 h) at 1 µM, which is comparable to sunitinib (50% inhibition at 1 µM, 48 h). Flavones (4b, 5a,b and 6a) also showed 25-37% reduction in HUVECs migration at 10 µM. In a Western blotting assay, 5a and 5b subdued VEGFR2 phosphorylation by 37% and 57%, respectively, suggesting that VEGFR2 may be their main antiangiogenic target. 5b displayed the best docking fit with VEGFR2 in an in silico study, followed by 5a, emphasizing the importance of the 7-hydroxyl group accompanied by a 4-C=S for activity. Conversely, derivatives with a 4-carbonyl moiety fitted poorly into the target's binding pocket, suggesting that their antiangiogenic activity depends on a different target. This study provides valuable insight into the Structure Activity Relationships (SAR) and modes of action of halogenated flavones with VEGFR2 and highlights their therapeutic potential as antiangiogenic/anticancer lead compounds.


Assuntos
Antineoplásicos , Flavonas , Inibidores da Angiogênese/química , Inibidores da Angiogênese/farmacologia , Antineoplásicos/farmacologia , Proliferação de Células , Células Endoteliais/metabolismo , Flavonas/química , Flavonas/farmacologia , Flavonoides/farmacologia , Fosforilação , Receptor 2 de Fatores de Crescimento do Endotélio Vascular
18.
Molecules ; 27(9)2022 May 07.
Artigo em Inglês | MEDLINE | ID: mdl-35566347

RESUMO

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.


Assuntos
Quadruplex G , Ácidos Nucleicos , DNA/química , Genes myc , Glucosídeos/farmacologia , Simulação de Acoplamento Molecular , Compostos Fitoquímicos , Proteínas Proto-Oncogênicas c-myc/metabolismo , Análise Espectral , Estilbenos
19.
Medicina (Kaunas) ; 58(9)2022 Sep 10.
Artigo em Inglês | MEDLINE | ID: mdl-36143932

RESUMO

In recent decades, the rate of caesarean deliveries has increased worldwide. The reasons for this trend are still largely misunderstood and controversial among researchers. The decision often depends on the obstetrician, his beliefs and experience, the characteristics of the patients, the hospital environment and its internal protocols, the increasing use of induction of labor, the medico-legal implications, and, finally, the mother's ability to request delivery by caesarean section without medical indication. This review aims to describe the reasons behind the increasing demand for caesarean sections by patients (CDMR) and strategies aimed at reducing caesarean section rates and educating women about the risks and benefits of CS.


Assuntos
Cesárea , Médicos , Cesárea/efeitos adversos , Cesárea/métodos , Feminino , Humanos , Gravidez
20.
Cancer ; 127(4): 569-576, 2021 02 15.
Artigo em Inglês | MEDLINE | ID: mdl-33107985

RESUMO

BACKGROUND: The objective of this study was to report on a retrospective series of patients with epithelioid hemangioendothelioma (EHE) who received treatment with sirolimus within the Italian Rare Cancer Network. METHODS: From January 2005, 38 adult patients with advanced EHE received continuous-dosing sirolimus, 5 mg daily, until they developed either toxicity or disease progression. Disease progression in the 6 months before the start of treatment was required. Each pathologic diagnosis was reviewed. The daily dose of sirolimus was adjusted based on plasma levels. Response was retrospectively assessed by local investigators using Response Evaluation Criteria in Solid Tumors, version 1.1 (RECIST). Survival was estimated using the Kaplan-Meier method. RESULTS: All 38 patients (WW Domain Containing Transcription Regulator 1 [WWTR1]-positive, n = 37; transcription factor E3 [TFE3]-positive, n = 1) had disease progression before starting sirolimus (at baseline, 13 of 38 patients had the presence of serosal effusions and systemic symptoms). Thirty-seven patients were evaluable for response (there was 1 early interruption). The best RECIST responses were a partial response in 4 patients (10.8%), stable disease in 28 patients (75.7%), and disease progression in 5 patients (13.5%). At a 41.5-month median follow-up (interquartile range [IQR], 23.9-56.8 months), the median PFS was 13 months (95% CI, 3.7 months to not estimated [NE]), and the median OS was 18.8 months (95% CI, 10.6 months to NE). In patients who had serosal effusions at baseline, the median PFS was 4.8 months (IQR, 3.5-11.7 months), and the median OS was 10.6 months (IQR, 5.1-13.0 months), compared with 47.8 months (IQR, 11.4 months to NE) and 47.8 months (IQR, 15.7 months to NE), respectively, in patients without serosal effusions. Overall, sirolimus was fairly well tolerated, with 10 patients reporting irregular menstruation/ovary disfunction. CONCLUSIONS: The current results confirm that sirolimus is active in EHE, leading to prolonged stabilization in most patients who present without serosal effusions. Serosal effusions are confirmed as an unfavorable prognostic sign associated with short survival, and sirolimus displays limited activity in this subgroup.


Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/administração & dosagem , Hemangioendotelioma Epitelioide/tratamento farmacológico , Peptídeos e Proteínas de Sinalização Intracelular/genética , Sirolimo/administração & dosagem , Adulto , Idoso , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Criança , Progressão da Doença , Feminino , Hemangioendotelioma Epitelioide/epidemiologia , Hemangioendotelioma Epitelioide/genética , Hemangioendotelioma Epitelioide/patologia , Humanos , Itália/epidemiologia , Estimativa de Kaplan-Meier , Masculino , Pessoa de Meia-Idade , Prognóstico , Critérios de Avaliação de Resposta em Tumores Sólidos , Sirolimo/efeitos adversos , Proteínas com Motivo de Ligação a PDZ com Coativador Transcricional
SELEÇÃO DE REFERÊNCIAS
Detalhe da pesquisa