Selective PPARγ modulator diosmin improves insulin sensitivity and promotes browning of white fat.

Peroxisome proliferator-activated receptor γ (PPARγ) is a master regulator of adipocyte differentiation, glucolipid metabolism, and inflammation. Thiazolidinediones are PPARγ full agonists with potent insulin-sensitizing effects, whereas their oral usage is restricted because of unwanted side effects, including obesity and cardiovascular risks. Here, via virtual screening, microscale thermophoresis analysis, and molecular confirmation, we demonstrate that diosmin, a natural compound of wide and long-term clinical use, is a selective PPARγ modulator that binds to PPARγ and blocks PPARγ phosphorylation with weak transcriptional activity. Local diosmin administration in subcutaneous fat (inguinal white adipose tissue [iWAT]) improved insulin sensitivity and attenuated obesity via enhancing browning of white fat and energy expenditure. Besides, diosmin ameliorated inflammation in WAT and liver and reduced hepatic steatosis. Of note, we determined that iWAT local administration of diosmin did not exhibit obvious side effects. Taken together, the present study demonstrated that iWAT local delivery of diosmin protected mice from diet-induced insulin resistance, obesity, and fatty liver by blocking PPARγ phosphorylation, without apparent side effects, making it a potential therapeutic agent for the treatment of metabolic diseases.

Endophytic fungi improved wheat resistance to Rhopalosiphum padi by decreasing its feeding efficiency and population fitness.

The improvement of crop resistance to insect using endophytic fungi is an environmentally friendly and sustainable strategy for agricultural pest control. Clarifying the efficacy and mechanism of endophytic fungi in improving crop resistance to pest offers the opportunity for biological control. In this study, changes in the transcriptome and defense compounds of wheat inoculated with endophytic fungal strains (i.e., YC and BB) were evaluated, and the efficacy of endophytic fungi in improving wheat resistance to Rhopalosiphum padi was studied. The results showed that the numbers of upregulated differentially-expressed genes (DEGs) in wheat plants inoculated with endophytic fungal strains YC and BB were higher than those of the downregulated DEGs, irrespective of R. padi infestation. Defense-related metabolic pathways, such as plant hormone signal transduction and secondary metabolite biosynthesis pathways were significantly enriched. Endophytic fungal strains YC and BB significantly increased jasmonic acid, DIMBOA (2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-one), total flavone, and tannin contents in wheat plants (P < 0.05) but decreased salicylic acid content. Variations in the contents of defense compounds were significantly correlated with decreased feeding, development, and reproduction of R. padi fed on wheat plants inoculated with strains YC and BB (|r| = 0.68-0.91, P < 0.05). The results suggested that endophytic fungi significantly decreased the feeding efficiency and population fitness [YC: (-11.13%) - (-22.07%); BB: (-10.98%) - (-22.20%)] of R. padi by altering the phytohormone pathway and secondary metabolite biosynthesis in wheat plants. This study helps in understanding of the efficacy of endophytic fungi in improving wheat resistance to insect and will be conducive to integrated pest management.

Comparative study of characteristic compounds of three species of truffle.

The Panxi area in Sichuan Province is the main area for the production of truffles in China, and several species of truffle are known to exist in this region. Nevertheless, it is unclear what the differences in chemical composition between the truffles are. Using an ultra-high-performance liquid chromatography quadrupole/orbitrap high-resolution mass spectrometry coupled with Compound Discoverer 3.0, we identified chemical components in three mainly known truffles from the Panxi region. Further analysis of chemical composition differences was conducted using principal component analysis, and orthogonal partial least squares discriminant analysis. Note that, 78.9% of the variance was uncovered by the principal component analysis model. As a result of the orthogonal partial least squares discriminant analysis model, the three species of truffles (Tuber pesudohimalayense, Tuber indicum, and Tuber sinense) from Panxi were better discriminated, with R2 X, R2 Y, and Q2 being 0.821, 0.993, and 0.947, respectively. In this study, 87 components were identified. T. pesudohimalayense contained significantly higher levels of nine different compounds than the other two species. Hence, it was possible to identify similarities and differences between three species of truffles from Panxi in terms of chemical composition. This can be used as a basis for quality control.

Two previously undescribed phthalides from Talaromyces amestolkiae, a symbiotic fungus of Syngnathus acus.

Amestolkins A (1) and B (2), two previously undescribed phthalides sharing the same planar structure of (1, 5-dihydroxyhexyl)-7-hydroxyisobenzofuran-1(3H)-one were isolated from Talaromyces amestolkiae. Their absolute configurations were elucidated by comprehensive analyses of spectroscopic evidences in high-resolution electrospray mass spectra (HRESIMS) and nuclear magnetic resonance (NMR) combined with electronic circular dichroism (ECD) and NMR calculations. 1 and 2 showed anti-neuroinflammatory activity by inhibiting the gene expressions of proinflammatory factors including C-C motif chemokine ligand 2 (CCL-2), tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6), as well as attenuating the excretion of inducible nitric oxide synthase (iNOS) in BV-2 microglial cells at the concentration of 30 µM.

NLRP3 inflammasome mechanism and therapeutic targets in diabetic cardiomyopathy.

Diabetic cardiomyopathy (DCM) is a serious complication of diabetes caused by oxidative stress, inflammation, insulin resistance, myocardial fibrosis, and lipotoxicity; its nature is insidious, complex and difficult to treat. NLRP3 inflammasome triggers the maturation and release of pro-inflammatory cytokines, participates in pathophysiological processes such as insulin resistance and myocardial fibrosis, in addition to being closely related to the development and progression of diabetic cardiomyopathy. The development of inhibitors targeting specific aspects of inflammation suggests that NLRP3 inflammasome can be used to treat diabetic cardiomyopathy. This paper aims to summarize NLRP3 inflammasome mechanism and therapeutic targets in diabetic cardiomyopathy, and to provide new suggestions for the treatment of this disease.

La cardiomiopatía diabética es una complicación grave de la diabetes causada por estrés oxidativo, inflamación, resistencia a la insulina, fibrosis miocárdica y lipotoxicidad. Se trata de un padecimiento insidioso, complejo y difícil de tratar. El inflamasoma NLRP3 desencadena la maduración y liberación de citoquinas proinflamatorias, participa en procesos fisiopatológicos como la resistencia a la insulina y la fibrosis miocárdica, además de estar estrechamente relacionado con la aparición y progresión de la cardiomiopatía diabética. El desarrollo de inhibidores dirigidos a aspectos específicos de la inflamación sugiere que el inflamasoma NLRP3 puede utilizarse para tratar la cardiomiopatía diabética. Este artículo pretende resumir el mecanismo y las dianas terapéuticas del inflamasoma NLRP3 en la cardiomiopatía diabética, así como aportar nuevas sugerencias para el tratamiento de esta enfermedad.

Hydroanthraquinones from Nigrospora sphaerica and Their Anti-inflammatory Activity Uncovered by Transcriptome Analysis.

Transcriptome analysis is shown to be an effective strategy to understand the potential function of natural products. Here, it is reported that 11 previously undescribed hydroanthraquinones [nigroquinones A-K (1-11)], along with eight known congeners, were isolated from Nigrospora sphaerica. Their structures were elucidated by interpreting spectroscopic and spectrometric data including high-resolution mass spectra and nuclear magnetic resonance. The absolute configurations of 1-11 were confirmed by electronic circular dichroism calculations. Transcriptome analysis revealed that 3 (isolated in the largest amount) might be anti-inflammatory. Assays based on LPS-induced RAW264.7 macrophages and zebrafish embryos confirmed that some of the isolated hydroanthraquinones attenuated the secretion of pro-inflammatory mediators in vitro and in vivo. Further Western blotting and immunofluorescence experiments indicated that 4 (which showed the most obvious nitric oxide inhibition) could suppress the expression of nuclear factor-kappa-B (NF-κB), phosphorylation of the inhibitor of NF-κB kinase and inhibit the transportation of NF-κB to the nucleus. Hence, the suppression of the NF-κB signaling pathway may be responsible for the anti-inflammatory effect. These results show that bioactivity evaluation on the basis of transcriptome analysis may be effective in the functional exploration of natural products.

First Report of Meloidogyne arenaria on Cynanchum versicolor Bunge in China.

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

Aureonitol Analogues and Orsellinic Acid Esters Isolated from Chaetomium elatum and Their Antineuroinflammatory Activity.

Overexpression of various pro-inflammatory factors in microglial cells tends to induce neurodegenerative diseases, for which there is no effective therapy available. Aureonitol (1) and seven analogues, including six previously undescribed [elatumenol A-F (2-4, 6-8, respectively)], along with two new orsellinic acid esters [elatumone A and B (9 and 10)], were isolated from Chaetomium elatum. The structures of the compounds were established through comprehensive analysis of spectroscopic data, including high-resolution mass spectra and one- and two-dimensional NMR, and absolute configurations determined by the Mosher method, dimolybdenum tetraacetate-induced circular dichroism, and theoretical calculations including electronic circular dichroism and NMR. Metabolites 3, 4, 7, and 8 exhibited antineuroinflammatory activity by attenuating the production of inflammatory mediators, such as nitric oxide, interleukin-6, interleukin-1ß, tumor necrosis factor-α, and reactive oxygen species. Western blot results indicated 8 decreases the level of inducible nitric oxide synthase and cyclooxygenase-2 and suppresses the expression of Toll-like receptor 4 and nuclear factor kappa-B (NF-κB) as well as the phosphorylation of the inhibitor of NF-κB and p38 mitogen-activated protein kinases in lipopolysaccharide-activated BV-2 microglial cells.

Three Previously Undescribed Chlorophenyl Glycosides from the Bulbs of Lilium regale.

Three previously undescribed chlorophenyl glycosides, (2,4,6-trichloro-3-hydroxy-5-methoxyphenyl)methyl ß-D-glucopyranoside (1), (2,4-dichloro-3,5-dimethoxyphenyl)methyl 6-O-ß-D-glucopyranosyl-ß-D-glucopyranoside (2) and 4-chloro-3-methoxy-5-methylphenyl 6-O-(6-deoxy-ß-L-mannopyranosyl)-ß-D-glucopyranoside (3) were obtained from Lilium regale. The absolute configurations of these new finds were elucidated by comprehensive analyses of spectroscopic data combined with acid hydrolysis derivatization. (2,4-dichloro-3,5-dimethoxyphenyl)methyl 6-O-ß-D-glucopyranosyl-ß-D-glucopyranoside (2) can inhibit the proliferation of lung carcinoma A549 cells with an IC50 value of 29 µΜ.

Glutamine supported early enteral therapy for severe acute pancreatitis: A systematic review and meta-analysis.

BACKGROUND AND OBJECTIVES: Several studies have shown that glutamine (Gln) may play an important role in energy metabolism, inflammatory reactions, and immune processes in patients with severe acute pancreatitis (SAP). Nevertheless, the results of individual randomized controlled trials (RCTs) on Gln nutrition support for SAP are contradictory. This systematic review and meta-analysis evaluated the clinical benefit of Gln-supported early enteral nutrition (G+EEN) in patients with SAP. METHODS AND STUDY DESIGN: Cochrane Library, PubMed, Embase, CNKI, Wan Fang, and Chinese Biomedical Literature Database were searched for relevant studies published before December 2018. RCTs of G+EEN versus standard early enteral nutrition (EEN) for SAP were selected, with both started within 48 h of admission. RESULTS: Seven clinical RCTs including a total of 433 patients (EEN group: 218 patients; G+EEN group: 215 patients) were included. Compared with EEN, G+EEN increased serum albumin (standard mean difference [SMD]=0.74; 95% confidence interval [CI], 0.33-1.15; p<0.01), reduced serum hypersensitive C-reactive protein (SMD=-1.62; 95% CI, -1.98 to -1.26; p<0.01) and risks of mortality risk (risk ratio= 0.38; 95% CI, 0.16-0.90; p=0.03) and multiple organ dysfunction syndrome (MODS)(risk ratio=0.37; 95% CI, 0.15-0.94; p<0.01), and shortened length of hospital stay (SMD=-1.19; 95% CI, -1.88 to 0.49; p<0.01); moreover, it did not significantly increase the incidence of infection-related complications, operative interventions, or APACHE II scores. CONCLUSIONS: G+EEN is beneficial in SAP management.

Seasonal Variation Influences on Intestinal Microbiota in Rats.

Recently, several studies have indicated that the intestinal microbiota can be regulated by the individual attributes, and even the alternation of circadian rhythm. Inspired by this, we speculated that seasonal variation might also have some effect on the intestinal microbiota. A total of 11 Sprague-Dawley male rats, weighing 250-280 g, were divided into summer group (n = 5) and winter group (n = 6). Cages were individually ventilated at 20 ± 2 °C and 45-65% relative humidity with a circadian rhythm of 12/12 h. After 1 week of adaptively feeding, mucosal contents of jejunum, terminal ileum, and ascending colon were collected and analyzed by 16S rRNA Gene Amplicon Pyrosequencing. The results showed that intestinal microbiota of rats for the same strain were affected by season change under the same feeding condition and living environment. We should take seasonal factor into account in the future experimental design based on intestinal microbiome.

Dai-Huang-Fu-Zi-Tang alleviates pulmonary and intestinal injury with severe acute pancreatitis via regulating aquaporins in rats.

BACKGROUND: Dai-Huang-Fu-Zi-Tang (DHFZT) is a famous traditional Chinese prescription with intestinal obstruction, acute pancreatitis and cholecystalgia for thousands of years. Our previous work found that DHFZT could act against pulmonary and intestinal pathological injury in rats with severe acute pancreatitis (SAP). But the underlying mechanism has not been fully elucidated. The aim of present study was to investigate whether DHFZT could relieve pulmonary and intestinal injury by regulating aquaporins after SAP induced by sodium taurocholate in rats. METHODS: Forty of SD rats were used for dose dependant experiments of DHFZT.Accurate-mass Time-of-flight liquid chromatography-mass spectrometry was used for qualitative screening of chemical compositions of DHFZT. Twenty-four rats were randomly divided into 3 groups: sham group (n = 8), model group (SAP, n = 8), DHFZT group (SAP with DHFZT treatment, n = 8). SAP models were established by retrograde injections of 5% sodium taurocholate solutions into rat pancreaticobiliary ducts. Blood samples were taken at 0, 12, 24, 48 h post-operation for detecting serum amylase, lipase, endotoxin, TNF-α, IL-6 and IL-10. Protein expression and location of aquaporin (AQP)1, 5, 8 and 9 were assessed by immunohistochemistry, western blot and immunofluorescence respectively. RESULTS: The study showed that 27 kinds of chemical composition were identified, including 10 kinds in positive ion mode and 17 kinds in negative ion mode. The results showed that AQP1, AQP5 of lung, and AQP1, AQP5, AQP8 of intestine in model group were significantly lower than that of sham group (P < 0.05), and which were obviously reversed by treatment with DHFZT. In addition, protein levels of pro-inflammatory cytokines such as TNF-α, IL-6 and endotoxin in peripheral blood were significantly suppressed by DHFZT, and that anti-inflammatory cytokine like IL-10 was just opposite. Finally, we also noted that DHFZT reduced serum levels of amylase, lipase and endotoxin, and also improved edema and pathological scores of lung and intestine after SAP. CONCLUSIONS: DHFZT ameliorated the pulmonary and intestinal edema and injury induced by SAP via the upregulation of different AQPs in lung and intestine, and suppressed TNF-α, IL-6 expression and enhanced IL-10 expression.

[Design of Non-Invasive Blood Oxygen Measurement Based on AFE4490].

From the perspective of portable monitoring devices,we use an analog front-end AFE4490 design a module of Non-invasive blood oxygen measurement, used to collect human pulse wave signal and peak (valley) value detection and then use the principles of non-invasive oximetry calculated oxygen saturation (SPO2). This design of noninvasive oximetry module has the characteristics of small size, low power consumption, and the results of test show that the measurement of oxygen saturation are correct.

A Bio-inspired Model for Bee Simulations.

As eusocial creatures, bees display unique macro collective behavior and local body dynamics that hold potential applications in various fields, such as computer animation, robotics, and social behavior. Unlike birds and fish, bees fly in a low-aligned zigzag pattern. Additionally, bees rely on visual cues for foraging and predator avoidance, exhibiting distinctive local body oscillations, such as body lifting, thrusting, and swaying. These inherent features pose significant challenges for realistic bee simulations in practical animation applications. In this paper, we present a bio-inspired model for bee simulations capable of replicating both macro collective behavior and local body dynamics of bees. Our approach utilizes a visually-driven system to simulate a bee's local body dynamics, incorporating obstacle perception and body rolling control for effective collision avoidance. Moreover, we develop an oscillation rule that captures the dynamics of the bee's local bodies, drawing on insights from biological research. Our model extends beyond simulating individual bees' dynamics; it can also represent bee swarms by integrating a fluid-based field with the bees' innate noise and zigzag motions. To fine-tune our model, we utilize pre-collected honeybee flight data. Through extensive simulations and comparative experiments, we demonstrate that our model can efficiently generate realistic low-aligned and inherently noisy bee swarms.

Synthesis of tetraphenylethylene-based small molecular sensor for the selective "turn-on" detection of pyrophosphoric acid in the aqueous solution.

Pyrophosphoric acid (PPi) is a crucial indicator for monitoring adenosine triphosphate hydrolysis processes, and abnormal PPi levels in the human body seriously threaten human health. Thus the efficient detection of the concentration of PPi in the aqueous solution is important and urgent. This paper described the successful synthesis of a tetraphenylethylene (TPE) derivative, named as TPE-4B, which contained four chelate pyridinium groups exhibiting aggregation-induced emission characteristics. TPE-4B was explicitly developed for the selective and sensitive fluorescence detection of PPi in aqueous solutions, showing a fluorescence "turn-on" response, and the detection limit was 65 nM. The four chelate pyridinium moieties of TPE-4B exhibited robust electrostatic interactions and binding capacity towards PPi, leading to the formation of aggregations, which was confirmed by zeta potential, dynamic light scattering, and scanning electron microscopy. Compared with free TPE-4B in the aqueous solution, the zeta potential of aggregations decreased from 20.7 to 4.2 mV, the average diameter increased from 155 to 403 nm, and the morphology transformed from porous nanostructures into a block-like format. Leveraging these properties, TPE-4B is a promising candidate for a "turn-on" fluorescence sensor designed to detect PPi in the aqueous solution.

Advances in Radiomics Research for Endometrial Cancer: A Comprehensive Review.

Endometrial cancer (EC) is a common gynecologic malignancy, with a rising trend in related mortality rates. The assessment based on imaging examinations contributes to the preoperative staging and surgical management of EC. However, conventional imaging diagnosis has limitations such as low accuracy and subjectivity. Radiomics, utilizing advanced feature analysis from medical images, extracts more information, ultimately establishing associations between imaging features and disease phenotypes. In recent years, radiomic studies on EC have emerged, employing radiomic features combined with clinical characteristics to model and predict histopathological features, protein expression, and clinical prognosis. This article elaborates on the application of radiomics in EC research and discusses its implications.

Progress of immunotherapies in gestational trophoblastic neoplasms.

BACKGROUND: Different from other malignant gynecologic tumors, gestational trophoblastic neoplasms (GTNs) exhibit an exceptionally high cure rate primarily through chemotherapeutic interventions. However, there exists a small subset of refractory GTNs that do not respond to conventional chemotherapies. In such cases, the emergence of immunotherapies has demonstrated significant benefits in managing various challenging GTNs. PURPOSE: This article aims to provide a comprehensive and systematic review of the immune microenvironment and immunotherapeutic approaches for GTNs. The purpose is to identify potential biomarkers that could enhance disease management and summarize the available immunotherapies for ease of reference. METHODS: We reviewed the relevant literatures toward immunotherapies of GTNs from PubMed. CONCLUSION: Current immunotherapeutic strategies for GTNs mainly revolve around immune checkpoint inhibitors (ICIs) targeting programmed death receptor 1 (PD-1) and programmed cell death ligand 1 (PD-L1). Prominent examples include avelumab, pembrolizumab, and camrelizumab. However, existing researches into the underlying mechanisms are still limited.

Role of Dynamic Contrast-Enhanced Magnetic Resonance Imaging Parameters and Extracellular Volume Fraction as Predictors of Lung Cancer Subtypes and Lymph Node Status in Non-Small-Cell Lung Cancer Patients.

Objective: The aim of this study is to determine whether dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI)-based quantitative parameters and the extracellular volume fraction (ECV) can differentiate small-cell lung cancer (SCLC) from non-small-cell lung cancer (NSCLC), squamous-cell carcinoma (SCC) from adenocarcinoma (Adeno-Ca), and NSCLC with lymph node metastasis from NSCLC without lymph node metastasis. Materials and methods: We prospectively enrolled patients with lung cancer (41 Adeno-Ca, 29 SCC, and 23 SCLC) who underwent DCE-MRI and enhanced T1 mapping prior to histopathological confirmation. Quantitative parameters based on DCE-MRI and ECV based on T1 mapping were compared between SCLC and NSCLC patients, between SCC and Adeno-Ca patients, and between NSCLC patients with and without lymph node metastasis. The area under the receiver-operating characteristic curve (AUC) was used to evaluate the diagnostic performance of each parameter. Spearman rank correlation was used to clarify the associations between ECV and DCE-MRI-derived parameters. Results: Ktrans, Kep, Ve, and ECV all performed well in differentiating SCLC from NSCLC (AUC > 0.729). Ktrans showed the best performance in differentiating SCC from Adeno-Ca (AUC = 0.836). ECV could differentiate NSCLCs with and without lymph node metastases (AUC = 0.764). ECV showed a significant positive correlation with both Ktrans and Ve. Conclusions: Ktrans is the most promising imaging parameter to differentiate SCLC from NSCLC, and Adeno-Ca from SCC. ECV was helpful in detecting lymph node metastasis in NSCLC. These imaging parameters may help guide the selection of lung cancer treatment.

Dissection and Grading of Ovarian Development in Wild-Type Female Insects.

Migratory insect pests pose serious challenges to food production and security all over the world. The migratory pests can be monitored and captured using searchlight traps. One of the most important techniques for migratory pest forecasting is to identify the migratory species. However, in most cases, it is difficult to get the information just by appearance. Therefore, using knowledge acquired by systematic analysis of the female reproductive system can help to understand the combined anatomic morphology of the ovarian mating sac and ovary developmental grading of wild-type migratory insects captured with searchlight traps. To demonstrate the applicability of this method, ovarian development status and egg grain development stages were directly assessed in Helicoverpa armigera, Mythimna separata, Spodoptera litura, and Spodoptera exigua for the ovarian anatomy, and the ovarian mating sacs were studied in Agrotis ipsilon, Spaelotis valida, Helicoverpa armigera, Athetis lepigone, Mythimna separata, Spodoptera litura, Mamestra brassicae, and Spodoptera exigua, to explore their relationships. This work shows the specific dissection method to predict wild-type migratory insects, comparing the unique reproductive system of different migratory insects. Then, both tissues, namely, the ovary and mating sacs, were further investigated. This method helps to predict the dynamics and the structural development of reproductive systems in wild-type female migratory insects.

Redox Biology in Adipose Tissue Physiology and Obesity.

Reactive oxygen species (ROS), a by-product of mitochondrial oxidative phosphorylation and cellular metabolism, is vital for cellular survival, proliferation, damage, and senescence. In recent years, studies have shown that ROS levels and redox status in adipose tissue are strongly associated with obesity and metabolic diseases. Although it was previously considered that excessive production of ROS and impairment of antioxidant capability leads to oxidative stress and potentially contributes to increased adiposity, it has become increasingly evident that an adequate amount of ROS is vital for adipocyte differentiation and thermogenesis. In this review, by providing a systematic overview of the recent understanding of the key factors of redox systems, endogenous mechanisms for redox homeostasis, advanced techniques for dynamic redox monitoring, as well as exogenous stimuli for redox production in adipose tissues and obesity, the importance of redox biology in metabolic health is emphasized.