Enhanced efficacy of the novel recombinant clone VasSF in a mouse model of antineutrophil cytoplasmic antibody-associated vasculitis.

Based on the efficacy of intravenous immunoglobulin (IVIg) for the treatment of antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV), we developed a recombinant single-chain-fragment variable clone, VasSF, therapeutic against AAV in a mouse model (SCG/Kj mice). VasSF is thought to bind to vasculitis-associated apolipoprotein A-II (APOA2) as a target molecule. VasSF is a promising new drug against AAV, but difficulties in the yield and purification of VasSF remain unresolved. We produced monomers of new VasSF molecules by modifying the plasmid structure for VasSF expression and simplifying the purification method using high-performance liquid chromatography. We compared the therapeutic effects between 5-day continuous administration of the monomers, as in IVIg treatment, and single shots of 5-day-equivalent doses. We also evaluated the life-prolonging effect of the single-shot treatment. Two-dimensional western blots were used to examine the binding of VasSF to APOA2. Our improved manufacturing method resulted in a 100-fold higher yield of VasSF than in our previous study. Monomerization of VasSF stabilized its efficacy. Single shots of a small amount (1/80 000 of IVIg) produced sufficient therapeutic effects, including decreased glomerular crescent formation, a decreasing trend of serum ANCA against myeloperoxidase (MPO-ANCA), decreases in multiple proinflammatory cytokines, and a trend toward prolonged survival. Two-dimensional western blots confirmed the binding of VasSF to APOA2. The newly produced pure VasSF monomers are stable and therapeutic for AAV with a single low-dose injection, possibly by removing vasculitis-associated APOA2. Thus, the new VasSF described herein is a promising drug against AAV.

Adult onset cardiac dilatation in a transgenic mouse line with Galß1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy.

Sugar chain abnormalities in glycolipids and glycoproteins are associated with various diseases. Here, we report an adult onset cardiac dilatation in a transgenic mouse line with Galß1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes. The transgenic hearts at the end-stage, at around 7 months old, were enlarged, with enlarged cavities and thin, low-tensile walls, typical of dilated cardiomyopathy. Although no apparent change was found in heart gangliosides, glycosylation of heart proteins was altered. Interestingly, sugar moieties not directly related to the ST3Gal-II catalytic reaction were also changed. Significant increases in calreticulin and calnexin were observed in hearts of the transgenic mice. These results suggest that expression of ST3Gal-II transgenes induces abnormal protein glycosylation, which disorganizes the endoplasmic/sarcoplasmic reticulum quality control system and elevates the calreticulin/calnexin level, resulting in suppression of cardiac function. The transgenic mice showed 100% incidence of adult onset cardiac dilatation, suggesting great potential as a new model for dilated cardiomyopathy.

Urinary protein analysis in mice lacking major urinary proteins.

Mouse urine contains major urinary proteins (MUPs) that are not found in human urine. Therefore, even healthy mice exhibit proteinuria, unlike healthy humans, making it challenging to use mice as models for human diseases. It was also unknown whether dipsticks for urinalysis could measure protein concentrations precisely in urine containing MUPs. To resolve these problems, we produced MUP-knockout (Mup-KO) mice by removing the Mup gene cluster using Cas9 proteins and two guide RNAs and characterized the urinary proteins in these mice. We measured the urinary protein concentrations in Mup-KO and wild-type mice using a protein quantitation kit and dipsticks. We also examined the urinary protein composition using SDS-PAGE and two-dimensional electrophoresis (2DE). The urinary protein concentration was significantly lower (P<0.001) in Mup-KO mice (17.9 ± 1.8 mg/dl, mean ± SD, n=3) than in wild-type mice (73.7 ± 8.2 mg/dl, n=3). This difference was not reflected in the dipstick values, perhaps due to the low sensitivity to MUPs. This suggests that dipsticks have limited ability to measure changes in MUPs with precision. SDS-PAGE and 2DE confirmed that Mup-KO mice, like humans, had no MUPs in their urine, whereas wild-type mice had abundant MUPs in their urine. The absence of the masking effect of MUPs in 2DE would enable clear comparisons of urinary proteins, especially low-molecular-weight proteins. Thus, Mup-KO mice may provide a useful model for human urinalysis.

Analysis of the transgene insertion pattern in a transgenic mouse strain using long-read sequencing.

Transgene insertion patterns are critical for the analysis of transgenic animals because the influence of transgenes may change depending on the insertion pattern (such as copy numbers and orientations of concatenations) and the insertion position in the genome. We previously reported a genomic walking strategy to locate transgenes in the genomes of transgenic mice (Exp. Anim. 53: 103-111, 2004) and to analyze transgene insertion patterns (Exp. Anim. 55: 65-69, 2006). With such strategies, however, we could not determine the copy number of transgenes or global genome modification induced by transgene insertion due to read-length limitation. In this study, we used a long-read sequencer (MinION, Oxford Nanopore Technologies) to overcome this limitation. We obtained 922,210 reads using MinION with genomic DNA from a transgenic mouse strain (4C30, Proc. Jpn. Acad. Ser. B. Phys. Biol. Sci. 87: 550-562, 2011). Among the reads, we found one 21,457-bp read containing the transgene using a local BLAST search. Nucleotide dot plot analysis revealed that the transgene was inserted in the genome as a tandem concatemer with an almost entire construct (15-3,508 of 3,508 bp) and a partial fragment (4-660, 657 bp). Ensembl's BLAST search against the C57BL/6N genome revealed a 9,388-bp deletion at the insertion position in the intron of the Sgcd gene, confirming that mutations such as a large genomic deletion could occur at the time of transgene insertion. Thus, long-read sequencers are useful tools for the analysis of transgene insertion patterns.

Efficacy of a recombinant single-chain fragment variable region, VasSF, as a new drug for vasculitis.

BACKGROUND: Anti-neutrophil cytoplasmic autoantibodies (ANCA) associated vasculitis is a pauci-immune disease with the inflammation of the small blood vessels. The efficacies of antibody drugs for induction therapies of vasculitis vary among cases. Here, we developed a novel clone of a single chain Fv region (ScFv) with vasculitis-specific therapeutic potential. MATERIALS AND METHODS: The clone, termed VasSF, was selected from our Escherichia coli expression library of recombinant human ScFv based on the therapeutic efficacy in an SCG/Kj mouse model of MPO-ANCA-associated vasculitis (MAAV), such as improvement of the urinary score and decreased crescent formation in glomeruli, granulomatous in lung, MPO-ANCA biomarkers, the anti-moesin antibody, and some cytokine levels. RESULTS: We identified vasculitis-associated apolipoprotein A-II (VAP2) as a target molecule of the clone and confirmed the independently-established VAP2 antibodies were also therapeutic in SCG/Kj mice. In MAAV, MPO-ANCA and cytokines stimulate neutrophils by facilitating heterodimer formation of VAP2 with apolipoprotein A-I in HDL. CONCLUSION: VasSF would constitute a novel antibody drug for vasculitis by suppressing the heterodimer formation of the apolipoproteins.

Vasculitis and crescentic glomerulonephritis in a newly established congenic mouse strain derived from ANCA-associated vasculitis-prone SCG/Kj mice.

Lupus nephritis (LN) is the secondary glomerulonephritis (GN) involved in systemic lupus erythematosus (SLE) and a typical immune complex-type GN. Antineutrophil cytoplasmic autoantibody (ANCA)-associated vasculitis (AAV) is an autoimmune disease characterized by systemic vasculitis and pauci-immune-type crescentic glomerulonephritis (CrGN) with ANCA production. Human AAV causes death due to lung haemorrhage and end-stage renal disease, for which renal replacement therapies are necessary. The SLE/AAV overlap syndrome was recently reported in humans. The spontaneous crescentic glomerulonephritis-forming/Kinjoh (SCG/Kj) mouse is a unique model of human AAV showing production of myeloperoxidase (MPO)-ANCA. We previously discovered seven disease susceptibility quantitative trait loci (QTL) derived from SCG/Kj mice by linkage analysis. To investigate the individual functions of each QTL, and to identify AAV susceptibility genes, we introduced them into a B6/lpr background to establish SCG/Kj interval congenic mice (SICM). B6/lpr.C1scg mice, a type of SICM, exhibited the production of autoantibodies, including MPO-ANCA. The GN in B6/lpr.C1scg mice was not pauci-immune type: deposition of immunoglobulins and complement components was observed in nephritic glomeruli, similar to that in LN. The incidence of GN in female B6/lpr.C1scg mice was 100%. Granulocyte infiltration was also observed in the glomerular tuft and crescents. B6/lpr.C1scg mice also displayed vasculitis in multiple organs, most frequently the lung and kidney. Vasculitis was characterized by the infiltration of mononuclear cells to vascular walls followed by granulocyte infiltration, resembling human lupus vasculitis. The incidence of lung vasculitis was over 90% in male and female B6/lpr.C1scg mice. Blood MPO-ANCA levels were significantly associated with histopathological disease phenotypes. MPO deposition was observed in nephritic glomeruli, and granulocytes infiltrated into inflamed vessels and glomeruli. These observations suggest that the activation of granulocytes and local MPO release contribute to the pathogenesis of GN and vasculitis. As a monocongenic mouse, B6/lpr.C1scg mice show the association between murine chromosome 1 segment and autoimmunity. This strain can be used as a model of the SLE/AAV overlap syndrome, and will be useful for elucidating the mechanism of ANCA generation and the pathogenesis of CrGN and vasculitis, as well as in the search for genetic factors related to AAV.

[Genetic diversity of Mongolian gerbils (Meriones unguiculatus)].

Genetic diversity of Z:ZCLA Mongolian gerbils, wild Mongolian gerbils and 3 inbred M. gerbil strains was evaluated with 17 microsatellite loci. The genetic variabilities within and between populations were estimated. The results showed that 9 microsatellite DNA, AF200940, AF200941, AF200942, AF200945, AF200946, AF200947, D11Mit128, PKC, and SCN, were amplified efficiently both in Z:ZCLA M. gerbils and the wild M. gerbils. Forty-one alleles were amplified with the number of alleles per locus ranging from 1 to 7. The average expected heterozygosity (He) and polymorphism information content (PIC) of all the loci were 0.5032 and 0.4656, respectively. The mean effective allele number of Z:ZCLA M. gerbils and wild M. gerbils were 2.78 and 2.89. The PIC of Z:ZCLA M. gerbils and the wild M. gerbils were 0.3704 and 0.3893. In the 3 inbred M. gerbils strains, 8 microsatellite DNA were amplified efficiently with 11 alleles. It displayed heterozygosity in AF200941, AF200945, AF200946, D11Mit128, and SCN loci with fragment lengths from 140 to 215 bp; and homozygosity in AF200942, AF200946, and AF200947 with fragment lengths from 203 to 241 bp. All of the 8 microsatellite loci were monomorphic both within and among the strains. These results suggested that the moderate genetic diversity of the conventional closed colony of Z:ZCLA M. gerbils was observed; and inbred M. gerbils strains basically met the re-quest. Microsatellite markers can be used in monitoring of M. gerbils populations.

Transgene insertion pattern analysis using genomic walking in a transgenic mouse line.

A transgene mapping technique (Noguchi et al., Exp. Anim. 53:103-111, 2004) is described that can be used to analyze transgene integration patterns in transgenic mice. The technique was used to reveal that a transgenic mouse line (GM1-sy#116) harbored inverted and direct tandem repeats of both intact and partial pCAGGS-based transgenes in the G2 region of chromosome 1. This complicated concatenation of transgenes may have been caused by simple end-joining of DNA constructs fragmented by exposure to UV transillumination during gel-purification, and by nuclease digestion inside zygote pronuclei. The results suggest that care should be taken to avoid unwanted fragmentation during the preparation of vector constructs.

FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and formation of desmosomes.

FAM83H is essential for the formation of dental enamel because a mutation in the FAM83H gene causes amelogenesis imperfecta (AI). We previously reported that the overexpression of FAM83H often occurs and disorganizes the keratin cytoskeleton in colorectal cancer cells. We herein show that FAM83H regulates the organization of the keratin cytoskeleton and maintains the formation of desmosomes in ameloblastoma cells. FAM83H is expressed and localized on keratin filaments in human ameloblastoma cell lines and in mouse ameloblasts and epidermal germinative cells in vivo. FAM83H shows preferential localization to keratin filaments around the nucleus that often extend to cell-cell junctions. Alterations in the function of FAM83H by its overexpression, knockdown, or an AI-causing truncated mutant prevent the proper organization of the keratin cytoskeleton in ameloblastoma cells. Furthermore, the AI-causing mutant prevents desmosomal proteins from being localized to cell-cell junctions. The effects of the AI-causing mutant depend on its binding to and possible inhibition of casein kinase I (CK-1). The suppression of CK-1 by its inhibitor, D4476, disorganizes the keratin cytoskeleton. Our results suggest that AI caused by the FAM83H mutation is mediated by the disorganization of the keratin cytoskeleton and subsequent disruption of desmosomes in ameloblasts.

Chromosomal mapping and zygosity check of transgenes based on flanking genome sequences determined by genomic walking.

Transgenes can affect transgenic mice via transgene expression or via the so-called positional effect. DNA sequences can be localized in chromosomes using recently established mouse genomic databases. In this study, we describe a chromosomal mapping method that uses the genomic walking technique to analyze genomic sequences that flank transgenes, in combination with mouse genome database searches. Genomic DNA was collected from two transgenic mouse lines harboring pCAGGS-based transgenes, and adaptor-ligated, enzyme restricted genomic libraries for each mouse line were constructed. Flanking sequences were determined by sequencing amplicons obtained by PCR amplification of genomic libraries with transgene-specific and adaptor primers. The insertion positions of the transgenes were located by BLAST searches of the Ensembl genome database using the flanking sequences of the transgenes, and the transgenes of the two transgenic mouse lines were mapped onto chromosomes 11 and 3. In addition, flanking sequence information was used to construct flanking primers for a zygosity check. The zygosity (homozygous transgenic, hemizygous transgenic and non-transgenic) of animals could be identified by differential band formation in PCR analyses with the flanking primers. These methods should prove useful for genetic quality control of transgenic animals, even though the mode of transgene integration and the specificity of flanking sequences needs to be taken into account.

A new mouse allele of glutamate receptor delta 2 with cerebellar atrophy and progressive ataxia.

Spinocerebellar degenerations (SCDs) are a large class of sporadic or hereditary neurodegenerative disorders characterized by progressive motion defects and degenerative changes in the cerebellum and other parts of the CNS. Here we report the identification and establishment from a C57BL/6J mouse colony of a novel mouse line developing spontaneous progressive ataxia, which we refer to as ts3. Frequency of the phenotypic expression was consistent with an autosomal recessive Mendelian trait of inheritance, suggesting that a single gene mutation is responsible for the ataxic phenotype of this line. The onset of ataxia was observed at about three weeks of age, which slowly progressed until the hind limbs became entirely paralyzed in many cases. Micro-MRI study revealed significant cerebellar atrophy in all the ataxic mice, although individual variations were observed. Detailed histological analyses demonstrated significant atrophy of the anterior folia with reduced granule cells (GC) and abnormal morphology of cerebellar Purkinje cells (PC). Study by ultra-high voltage electron microscopy (UHVEM) further indicated aberrant morphology of PC dendrites and their spines, suggesting both morphological and functional abnormalities of the PC in the mutants. Immunohistochemical studies also revealed defects in parallel fiber (PF)-PC synapse formation and abnormal distal extension of climbing fibers (CF). Based on the phenotypic similarities of the ts3 mutant with other known ataxic mutants, we performed immunohistological analyses and found that expression levels of two genes and their products, glutamate receptor delta2 (grid2) and its ligand, cerebellin1 (Cbln1), are significantly reduced or undetectable. Finally, we sequenced the candidate genes and detected a large deletion in the coding region of the grid2 gene. Our present study suggests that ts3 is a new allele of the grid2 gene, which causes similar but different phenotypes as compared to other grid2 mutants.

Altered Actions of Memantine and NMDA-Induced Currents in a New Grid2-Deleted Mouse Line.

Memantine is a non-competitive antagonist of the N-methyl-D-aspartate (NMDA) receptor, and is an approved drug for the treatment of moderate-to-severe Alzheimer's disease. We identified a mouse strain with a naturally occurring mutation and an ataxic phenotype that presents with severe leg cramps. To investigate the phenotypes of these mutant mice, we screened several phenotype-modulating drugs and found that memantine (10 mg/kg) disrupted the sense of balance in the mutants. Moreover, the mutant mice showed an attenuated optokinetic response (OKR) and impaired OKR learning, which was also observed in wild-type mice treated with memantine. Microsatellite analyses indicated that the Grid2 gene-deletion is responsible for these phenotypes. Patch-clamp analysis showed a relatively small change in NMDA-dependent current in cultured granule cells from Grid2 gene-deleted mice, suggesting that GRID2 is important for correct NMDA receptor function. In general, NMDA receptors are activated after the activation of non-NMDA receptors, such as AMPA receptors, and AMPA receptor dysregulation also occurs in Grid2 mutant mice. Indeed, the AMPA treatment enhanced memantine susceptibility in wild-type mice, which was indicated by balance sense and OKR impairments. The present study explores a new role for GRID2 and highlights the adverse effects of memantine in different genetic backgrounds.

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

Involvement of SIK3 in glucose and lipid homeostasis in mice.

Salt-inducible kinase 3 (SIK3), an AMP-activated protein kinase-related kinase, is induced in the murine liver after the consumption of a diet rich in fat, sucrose, and cholesterol. To examine whether SIK3 can modulate glucose and lipid metabolism in the liver, we analyzed phenotypes of SIK3-deficent mice. Sik3(-/-) mice have a malnourished the phenotype (i.e., lipodystrophy, hypolipidemia, hypoglycemia, and hyper-insulin sensitivity) accompanied by cholestasis and cholelithiasis. The hypoglycemic and hyper-insulin-sensitive phenotypes may be due to reduced energy storage, which is represented by the low expression levels of mRNA for components of the fatty acid synthesis pathways in the liver. The biliary disorders in Sik3(-/-) mice are associated with the dysregulation of gene expression programs that respond to nutritional stresses and are probably regulated by nuclear receptors. Retinoic acid plays a role in cholesterol and bile acid homeostasis, wheras ALDH1a which produces retinoic acid, is expressed at low levels in Sik3(-/-) mice. Lipid metabolism disorders in Sik3(-/-) mice are ameliorated by the treatment with 9-cis-retinoic acid. In conclusion, SIK3 is a novel energy regulator that modulates cholesterol and bile acid metabolism by coupling with retinoid metabolism, and may alter the size of energy storage in mice.

Use of sample mixtures for standard curve creation in quantitative western blots.

For accurate protein quantification when using quantitative western blot analysis with chemiluminescence reagents, standard curves are needed because of the narrow quantifiable ranges. However, they are often difficult to obtain because authentic proteins are not always available. Here we present our original and convenient method using a sample mixture as a scale to create standard curves. This method allowed us to determine the quantifiable range of target and loading control proteins, making quantitative comparisons among independent blots more reproducible. Our results indicate that using a sample mixture to create standard curves is a practical method that guarantees the accuracy and reproducibility of quantitative western blot analysis.

Analyses of the cDNA and genomic DNA sequences encoding the luteinizing hormone beta-subunit precursor protein in the rabbit.

To examine the molecular basis for efficient induction of superovulation in the rabbit, we determined the cDNA sequences of the luteinizing hormone beta-subunit (LHB) from Japanese White (JW), New Zealand White (NZW), and Dutch-Belted (Dutch) rabbits, and we compared these LHB sequences with those of other mammals. Using 5'- and 3'-rapid amplification of cDNA ends (RACE) with pituitary cDNA libraries, we found that the LHB cDNAs of all three breeds are the same length (523 bp from the 5'-end to the polyA site) and have putative AATAAA polyadenylation signal sequences at nucleotides 504 to 509. Northern blot analysis indicated that the approximately 600-nt mRNA encoding JW LHB is slightly longer than the LHB mRNAs of the other two breeds. The NZW and Dutch rabbit LHB coding sequences are 426 bp long, and their G+C contents are higher (>73%) than those of other mammalian LHBs (<70%). The predicted 141-amino-acid sequences of the JW and NZW LHB proteins are identical, and the Dutch LHB and JW/NZW sequences differ at only two residues. The exon-intron configuration of the NZW LHB gene (three exons and two introns) is similar to that of other mammalian LHB genes, and the sequences of NZW rabbit and other mammalian LHB promoter regions are highly conserved. Phylogenetic analysis of the deduced amino acid sequences of the three rabbit LHB proteins indicated that the rabbit occupies a phylogenetic position between rodents and domestic animals, and is far from humans. The results suggest that LH prepared from rodents or domestic animals, if available, would be a better inducer for superovulation in rabbits than human LH/CG.

Sequence analysis of cDNA encoding rabbit follicle-stimulating hormone beta-subunit precursor protein.

To understand the molecular basis of the rabbit's efficient superovulation, we determined the cDNA sequence of the follicle-stimulating hormone (FSH) beta-subunit precursor protein using a combination of 5'- and 3'-rapid amplification of cDNA ends (RACE) with pituitary cDNA libraries of the Japanese White rabbit and compared it with those of other mammals. RACE experiments detected at least three transcripts for the FSHbeta precursor protein in the libraries. The transcripts had lengths of 457, 1,621, and 1,767 bp, from the 5'-end to the poly(A) site. The shortest and mid-length transcripts had the putative polyadenylation signal sequence AATAAA at nucleotides 436 and 1,601, respectively, whereas the longest form had an ATTAAA sequence at nucleotide 1,745 of the cDNA sequence. These transcripts are likely to be polyadenylation variants of one large transcript because they share the same coding sequence for the precursor protein (130 amino acid residues in length). However, only a few shortest variants seem to be formed because the shortest variants were not detected by Northern blot analysis. Phylogenetic analysis of the deduced amino acid sequence indicates that the rabbit is phylogenetically closer to humans than to the other mammals, suggesting that an FSH preparation from human sources would be superior as a follicle stimulant for the induction of superovulation.

Induction of Bad-mediated apoptosis by Sindbis virus infection: involvement of pro-survival members of the Bcl-2 family.

It is known that infection with Sindbis virus (SNV) induces apoptosis, which is inhibited by two pro-survival members of the Bcl-2 family, Bcl-2 and Bcl-xL. However, the mechanism of involvement of the other members of the Bcl-2 family in SNV-induced apoptosis remains unclear. In this study we report that Bad protein, one of the pro-apoptotic Bcl-2 family members, mediates apoptosis in the mammalian cells infected with SNV. Expression of Bad was shown to promote SNV-induced apoptosis in human embryonic kidney 293T and baby hamster kidney cells. SNV infection also induced translocation of endogenous Bad into mitochondria and heterodimerization of Bad with Bcl-xL. On the other hand, the structurally most similar pro-survival members, Bcl-2, Bcl-xL, and Bcl-w, suppressed SNV-induced apoptosis in the absence of Bad, whereas Mcl-1 and A1 did not. Bcl-w could inhibit SNV-induced apoptosis in the presence of Bad, but Bcl-xL could not. Bad could be coimmunoprecipitated with Bcl-xL or Bcl-2, but not with Bcl-w. Two viral Bcl-2 homologs, E1B19K and BHRF1, also suppressed SNV-induced apoptosis irrespective of the presence of Bad and no physical association with Bad was observed. These results suggest that direct interaction of Bad with pro-survival members of the Bcl-2 family contributes to the progress of SNV-induced apoptosis and that nonbinding members restrain SNV-induced apoptosis irrespective of Bad expression.

Sequence analysis of cDNA encoding follicle-stimulating hormone and luteinizing hormone beta-subunits in the Mongolian gerbil (Meriones unguiculatus).

To examine the molecular basis for efficient superovulation in the Mongolian gerbil, the cDNA sequences of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) beta-subunits were determined and compared with those of other mammals. FSHbeta and LHbeta cDNAs were 1637 and 507bp long, respectively, from the 5'-end to putative polyA sites. The deduced sequences of the FSHbeta and LHbeta precursor proteins were 129 and 141 amino acids in length, respectively. The amino acid sequences of both Mongolian gerbil hormone subunits showed overall similarity to those of other rodents, confirming that the combination of equine chorionic gonadotropin (eCG) and human chorionic gonadotropin (hCG) should be effective for induction of superovulation in Mongolian gerbils, as in mice and rats. However, the use of hCG might need to be re-evaluated owing to its low homology to rodent LH.

Optimization of superovulation induction by human menopausal gonadotropin in guinea pigs based on follicular waves and FSH-receptor homologies.

The guinea pig represents an excellent animal model for the study of reproduction in humans and most domestic animals because unlike the mouse and rat, it undergoes a complete estrous cycle. In this study, we investigated the availability of ovarian oocytes during the estrous cycle, and the follicle stimulating hormone (FSH) receptor (FSH-R) homologies between guinea pigs and other species, in order to identify an effective gonadotropin and optimal time-of-application for the induction of superovulation in the guinea pig. The number of collectable ovarian oocytes showed biphasic changes with peaks at the midluteal and pre-ovulatory stages. On the other hand, the number of oocytes that matured in vitro remained constant ( approximately 10 oocytes) until day 14 post-ovulation and increased thereafter. The deduced amino acid sequence of the guinea pig FSH-R showed greater similarity to the primate FSH-R than to the rodent FSH-R, which suggests that commercially available human menopausal gonadotropin (hMG) may be a better inducer of superovulation in guinea pigs. Indeed, significantly more oocytes (5.4 +/- 1.6, range 0-17, n = 10) were obtained from hMG-treated guinea pigs at the pre-ovulatory stage than during spontaneous ovulation (3.6 +/- 0.1, n = 96; P < 0.05), whereas guinea pigs that received hMG at the midluteal stage (n = 3) did not ovulate. These results indicate that hMG is an effective, albeit stage-dependent, inducer of superovulation in the guinea pig, and that FSH-R homologies should be taken into account when choosing hormones for superovulation.