First report of Mal de Rio Cuarto Virus and a picorna-like virus naturally infecting rice (Oryza sativa) in Argentina.

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

Prolonged dysbiosis and altered immunity under nutritional intervention in a physiological mouse model of severe acute malnutrition.

Severe acute malnutrition (SAM) is a multifactorial disease affecting millions of children worldwide. It is associated with changes in intestinal physiology, microbiota, and mucosal immunity, emphasizing the need for multidisciplinary studies to unravel its full pathogenesis. We established an experimental model in which weanling mice fed a high-deficiency diet mimic key anthropometric and physiological features of SAM in children. This diet alters the intestinal microbiota (less segmented filamentous bacteria, spatial proximity to epithelium), metabolism (decreased butyrate), and immune cell populations (depletion of LysoDC in Peyer's patches and intestinal Th17 cells). A nutritional intervention leads to a fast zoometric and intestinal physiology recovery but to an incomplete restoration of the intestinal microbiota, metabolism, and immune system. Altogether, we provide a preclinical model of SAM and have identified key markers to target with future interventions during the education of the immune system to improve SAM whole defects.

Peyer's patch phagocytes acquire specific transcriptional programs that influence their maturation and activation profiles.

Peyer's patches (PPs) are secondary lymphoid organs in contact with the external environment via the intestinal lumen, thus combining antigen sampling and immune response initiation sites. Therefore, they provide a unique opportunity to study the entire process of phagocyte differentiation and activation in vivo. Here, we deciphered the transcriptional and spatial landscape of PP phagocyte populations from their emergence in the tissue to their final maturation state at homeostasis and under stimulation. Activation of monocyte-derived Lysozyme-expressing dendritic cells (LysoDCs) differs from that of macrophages by their upregulation of conventional DC (cDC) signature genes such as Ccr7 and downregulation of typical monocyte-derived cell genes such as Cx3cr1. We identified gene sets that distinguish PP cDCs from the villus ones and from LysoDCs. We also identified key immature, early, intermediate, and late maturation markers of PP phagocytes. Finally, exploiting the ability of the PP interfollicular region to host both villous and subepithelial dome emigrated cDCs, we showed that the type of stimulus, the subset, but also the initial location of cDCs shape their activation profile and thus direct the immune response. Our study highlights the importance of targeting the right phagocyte subset at the right place and time to manipulate the immune response.

Dendritic cell functions in the inductive and effector sites of intestinal immunity.

The intestine is constantly exposed to foreign antigens, which are mostly innocuous but can sometimes be harmful. Therefore, the intestinal immune system has the delicate task of maintaining immune tolerance to harmless food antigens while inducing tailored immune responses to pathogens and regulating but tolerating the microbiota. Intestinal dendritic cells (DCs) play a central role in these functions as sentinel cells able to prime and polarize the T cell responses. DCs are deployed throughout the intestinal mucosa but with local specializations along the gut length and between the diffuse effector sites of the gut lamina propria (LP) and the well-organized immune inductive sites comprising isolated lymphoid follicles (ILFs), Peyer's patches (PPs), and other species-specific gut-associated lymphoid tissues (GALTs). Understanding the specificities of each intestinal DC subset, how environmental factors influence DC functions, and how these can be modulated is key to harnessing the therapeutic potential of mucosal adaptive immune responses, whether by enhancing the efficacy of mucosal vaccines or by increasing tolerogenic responses in inflammatory disorders. In this review, we summarize recent findings related to intestinal DCs in steady state and upon inflammation, with a special focus on their functional specializations, highly dependent on their microenvironment.