RESUMO
Bioenergy sorghum is a low-input, drought-resilient, deep-rooting annual crop that has high biomass yield potential enabling the sustainable production of biofuels, biopower, and bioproducts. Bioenergy sorghum's 4-5 m stems account for ~80% of the harvested biomass. Stems accumulate high levels of sucrose that could be used to synthesize bioethanol and useful biopolymers if information about cell-type gene expression and regulation in stems was available to enable engineering. To obtain this information, laser capture microdissection was used to isolate and collect transcriptome profiles from five major cell types that are present in stems of the sweet sorghum Wray. Transcriptome analysis identified genes with cell-type-specific and cell-preferred expression patterns that reflect the distinct metabolic, transport, and regulatory functions of each cell type. Analysis of cell-type-specific gene regulatory networks (GRNs) revealed that unique transcription factor families contribute to distinct regulatory landscapes, where regulation is organized through various modes and identifiable network motifs. Cell-specific transcriptome data was combined with known secondary cell wall (SCW) networks to identify the GRNs that differentially activate SCW formation in vascular sclerenchyma and epidermal cells. The spatial transcriptomic dataset provides a valuable source of information about the function of different sorghum cell types and GRNs that will enable the engineering of bioenergy sorghum stems, and an interactive web application developed during this project will allow easy access and exploration of the data (https://mc-lab.shinyapps.io/lcm-dataset/).
Assuntos
Biocombustíveis , Parede Celular , Regulação da Expressão Gênica de Plantas , Redes Reguladoras de Genes , Caules de Planta , Sorghum , Transcriptoma , Sorghum/genética , Sorghum/metabolismo , Caules de Planta/genética , Caules de Planta/metabolismo , Parede Celular/metabolismo , Parede Celular/genética , Perfilação da Expressão GênicaRESUMO
Circadian misalignment due to night work has been associated with an elevated risk for chronic diseases. We investigated the effects of circadian misalignment using shotgun protein profiling of peripheral blood mononuclear cells taken from healthy humans during a constant routine protocol, which was conducted immediately after participants had been subjected to a 3-day simulated night shift schedule or a 3-day simulated day shift schedule. By comparing proteomic profiles between the simulated shift conditions, we identified proteins and pathways that are associated with the effects of circadian misalignment and observed that insulin regulation pathways and inflammation-related proteins displayed markedly different temporal patterns after simulated night shift. Further, by integrating the proteomic profiles with previously assessed metabolomic profiles in a network-based approach, we found key associations between circadian dysregulation of protein-level pathways and metabolites of interest in the context of chronic metabolic diseases. Endogenous circadian rhythms in circulating glucose and insulin differed between the simulated shift conditions. Overall, our results suggest that circadian misalignment is associated with a tug of war between central clock mechanisms controlling insulin secretion and peripheral clock mechanisms regulating insulin sensitivity, which may lead to adverse long-term outcomes such as diabetes and obesity. Our study provides a molecular-level mechanism linking circadian misalignment and adverse long-term health consequences of night work.
Assuntos
Ritmo Circadiano , Inflamação , Insulina , Leucócitos Mononucleares , Humanos , Leucócitos Mononucleares/metabolismo , Insulina/metabolismo , Insulina/sangue , Inflamação/metabolismo , Inflamação/sangue , Masculino , Adulto , Jornada de Trabalho em Turnos , Feminino , Proteômica/métodos , Glicemia/metabolismo , Transdução de Sinais , Resistência à Insulina , Adulto JovemRESUMO
Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.
Assuntos
Regulação da Expressão Gênica de Plantas , Plantas Geneticamente Modificadas , Populus , Regiões Promotoras Genéticas , Populus/genética , Populus/metabolismo , Regiões Promotoras Genéticas/genética , Plantas Geneticamente Modificadas/genética , Desidratação/genética , Estresse Fisiológico/genética , Especificidade de Órgãos/genética , Folhas de Planta/genética , Folhas de Planta/metabolismoRESUMO
Lignin is a biopolymer found in plant cell walls that accounts for 30% of the organic carbon in the biosphere. White-rot fungi (WRF) are considered the most efficient organisms at degrading lignin in nature. While lignin depolymerization by WRF has been extensively studied, the possibility that WRF are able to utilize lignin as a carbon source is still a matter of controversy. Here, we employ 13C-isotope labeling, systems biology approaches, and in vitro enzyme assays to demonstrate that two WRF, Trametes versicolor and Gelatoporia subvermispora, funnel carbon from lignin-derived aromatic compounds into central carbon metabolism via intracellular catabolic pathways. These results provide insights into global carbon cycling in soil ecosystems and furthermore establish a foundation for employing WRF in simultaneous lignin depolymerization and bioconversion to bioproducts-a key step toward enabling a sustainable bioeconomy.
Assuntos
Fungos/metabolismo , Lignina/metabolismo , Redes e Vias Metabólicas , Biopolímeros/metabolismo , Biotransformação , Ecossistema , Compostos Orgânicos/metabolismo , Microbiologia do SoloRESUMO
OBJECTIVES: The objective of this study was to collect information on human Chorionic Gonadotrophin (hCG) laboratory testing and reporting in women with Gestational Trophoblastic Disease (GTD), to assess the associated challenges, and to offer perspectives on hCG testing harmonisation. DESIGN: Information was collected from laboratories by electronic survey (Survey Monkey®) using a questionnaire designed by members of the European Organisation for the Treatment of Trophoblastic Disease (EOTTD) hCG Working Party. PARTICIPANTS: The questionnaire was distributed by the EOTTD board to member laboratories and their associated scientists who work within the GTD field. SETTING: The questionnaire was distributed and accessed via an online platform. METHODS: The questionnaire consisted of 5 main sections. These included methods used for hCG testing, quality procedures, reporting of results, laboratory operational aspects, and non-GTD testing capability. In addition to reporting these survey results, examples of case scenarios which illustrate the difficulties faced by laboratories providing hCG measurement for GTD patient management were described. The benefits and challenges of using centralised versus non-centralised hCG testing were discussed alongside the utilisation of regression curves for management of GTD patients. RESULTS: Information from the survey was collated and presented for each section and showed huge variability in responses across laboratories even for those using the same hCG testing platforms. An educational example was presented, highlighting the consequence of using inappropriate hCG assays on clinical patient management (Educational Example A), along with an example of biotin interference (Educational Example B) and an example of high-dose hook effect (Educational Example C), demonstrating the importance of knowing the limitations of hCG tests. The merits of centralised versus non-centralised hCG testing and use of hCG regression curves to aid patient management were discussed. LIMITATIONS: To ensure the survey was completed by laboratories providing hCG testing for GTD management, the questionnaire was distributed by the EOTTD board. It was assumed the EOTTD board held the correct laboratory contact, and that the questionnaire was completed by a scientist with in-depth knowledge of laboratory procedures. CONCLUSIONS: The hCG survey highlighted a lack of harmonisation of hCG testing across laboratories. Healthcare professionals involved in the management of women with GTD should be aware of this limitation. Further work is needed to ensure an appropriate quality assured laboratory service is available for hCG monitoring in women with GTD.
RESUMO
Metaproteomics has been increasingly utilized for high-throughput characterization of proteins in complex environments and has been demonstrated to provide insights into microbial composition and functional roles. However, significant challenges remain in metaproteomic data analysis, including creation of a sample-specific protein sequence database. A well-matched database is a requirement for successful metaproteomics analysis, and the accuracy and sensitivity of PSM identification algorithms suffer when the database is incomplete or contains extraneous sequences. When matched DNA sequencing data of the sample is unavailable or incomplete, creating the proteome database that accurately represents the organisms in the sample is a challenge. Here, we leverage a de novo peptide sequencing approach to identify the sample composition directly from metaproteomic data. First, we created a deep learning model, Kaiko, to predict the peptide sequences from mass spectrometry data and trained it on 5 million peptide-spectrum matches from 55 phylogenetically diverse bacteria. After training, Kaiko successfully identified organisms from soil isolates and synthetic communities directly from proteomics data. Finally, we created a pipeline for metaproteome database generation using Kaiko. We tested the pipeline on native soils collected in Kansas, showing that the de novo sequencing model can be employed as an alternative and complementary method to construct the sample-specific protein database instead of relying on (un)matched metagenomes. Our pipeline identified all highly abundant taxa from 16S rRNA sequencing of the soil samples and uncovered several additional species which were strongly represented only in proteomic data.
Assuntos
Microbiota , Proteômica , Microbiota/genética , Peptídeos/análise , Peptídeos/genética , Proteoma/genética , Proteômica/métodos , RNA Ribossômico 16S/genética , SoloRESUMO
Brown rot fungi dominate the carbon degradation of northern terrestrial conifers. These fungi adapted unique genetic inventories to degrade lignocellulose and to rapidly release a large quantity of carbohydrates for fungal catabolism. We know that brown rot involves "two-step" gene regulation to delay most hydrolytic enzyme expression until after harsh oxidative pretreatments. This implies the crucial role of concise gene regulation to brown rot efficacy, but the underlying regulatory mechanisms remain uncharacterized. Here, using the combined transcriptomic and enzyme analyses we investigated the roles of carbon catabolites in controlling gene expression in model brown rot fungus Rhodonia placenta. We identified co-regulated gene regulons as shared transcriptional responses to no-carbon controls, glucose, cellobiose, or aspen wood (Populus sp.). We found that cellobiose, a common inducing catabolite for fungi, induced expression of main chain-cleaving cellulases in GH5 and GH12 families (cellobiose vs. no-carbon > 4-fold, Padj < 0.05), whereas complex aspen was a universal inducer for Carbohydrate Active Enzymes (CAZymes) expression. Importantly, we observed the attenuated glucose-mediated repression effects on cellulases expression, but not on hemicellulases and lignin oxidoreductases, suggesting fungi might have adapted diverged regulatory routes to boost cellulase production for the fast carbohydrate release. Using carbon regulons, we further predicted the cis- and trans-regulatory elements and assembled a network model of the distinctive regulatory machinery of brown rot. These results offer mechanistic insights into the energy efficiency traits of a common group of decomposer fungi with enormous influence on the carbon cycle.
Assuntos
Celulase , Polyporales , Carbono , Celobiose , Glucose , Humanos , MadeiraRESUMO
Brown rot fungi dominate wood decomposition in coniferous forests, and their carbohydrate-selective mechanisms are of commercial interest. Brown rot was recently described as a two-step, sequential mechanism orchestrated by fungi using differentially expressed genes (DEGs) and consisting of oxidation via reactive oxygen species (ROS) followed by enzymatic saccharification. There have been indications, however, that the initial oxidation step itself might require induction. To capture this early gene regulation event, here, we integrated fine-scale cryosectioning with whole-transcriptome sequencing to dissect gene expression at the single-hyphal-cell scale (tens of micrometers). This improved the spatial resolution 50-fold, relative to previous work, and we were able to capture the activity of the first 100 µm of hyphal front growth by Rhodonia placenta in aspen wood. This early decay period was dominated by delayed gene expression patterns as the fungus ramped up its mechanism. These delayed DEGs included many genes implicated in ROS pathways (lignocellulose oxidation [LOX]) that were previously and incorrectly assumed to be constitutively expressed. These delayed DEGs, which include those with and without predicted functions, also create a focused subset of target genes for functional genomics. However, this delayed pattern was not universal, with a few genes being upregulated immediately at the hyphal front. Most notably, this included a gene commonly implicated in hydroquinone and iron redox cycling: benzoquinone reductase. IMPORTANCE Earth's aboveground terrestrial biomass is primarily wood, and fungi dominate wood decomposition. Here, we studied these fungal pathways in a common "brown rot"-type fungus, Rhodonia placenta, that selectively extracts sugars from carbohydrates embedded within wood lignin. Using a space-for-time design to map fungal gene expression at the extreme hyphal front in wood, we made two discoveries. First, we found that many genes long assumed to be "on" (constitutively expressed) from the very beginning of decay were instead "off" before being upregulated, when mapped (via transcriptome sequencing [RNA-seq]) at a high resolution. Second, we found that the gene encoding benzoquinone reductase was "on" in incipient decay and quickly downregulated, implying a key role in "kick-starting" brown rot.
Assuntos
Polyporales , Madeira , Benzoquinonas/metabolismo , Expressão Gênica , Oxirredutases/metabolismo , Espécies Reativas de Oxigênio/metabolismo , Madeira/microbiologiaRESUMO
BACKGROUND: Representing biological networks as graphs is a powerful approach to reveal underlying patterns, signatures, and critical components from high-throughput biomolecular data. However, graphs do not natively capture the multi-way relationships present among genes and proteins in biological systems. Hypergraphs are generalizations of graphs that naturally model multi-way relationships and have shown promise in modeling systems such as protein complexes and metabolic reactions. In this paper we seek to understand how hypergraphs can more faithfully identify, and potentially predict, important genes based on complex relationships inferred from genomic expression data sets. RESULTS: We compiled a novel data set of transcriptional host response to pathogenic viral infections and formulated relationships between genes as a hypergraph where hyperedges represent significantly perturbed genes, and vertices represent individual biological samples with specific experimental conditions. We find that hypergraph betweenness centrality is a superior method for identification of genes important to viral response when compared with graph centrality. CONCLUSIONS: Our results demonstrate the utility of using hypergraphs to represent complex biological systems and highlight central important responses in common to a variety of highly pathogenic viruses.
Assuntos
Algoritmos , Modelos Biológicos , Genômica , ProteínasRESUMO
A generalized goal of many high-throughput data studies is to identify functional mechanisms that underlie observed biological phenomena, whether they be disease outcomes or metabolic output. Increasingly, studies that rely on multiple sources of high-throughput data (genomic, transcriptomic, proteomic, metabolomic) are faced with a challenge of summarizing the data to generate testable hypotheses. However, this requires a time-consuming process to evaluate numerous statistical methods across numerous data sources. Here, we introduce the leapR package, a framework to rapidly assess biological pathway activity using diverse statistical tests and data sources, allowing facile integration of multisource data. The leapR package with a user manual and example workflow is available for download from GitHub (https://github.com/biodataganache/leapR).
Assuntos
Proteômica , Software , Biologia Computacional , Genômica , MetabolômicaRESUMO
Circadian disruption has been identified as a risk factor for health disorders such as obesity, cardiovascular disease, and cancer. Although epidemiological studies suggest an increased risk of various cancers associated with circadian misalignment due to night shift work, the underlying mechanisms have yet to be elucidated. We sought to investigate the potential mechanistic role that circadian disruption of cancer hallmark pathway genes may play in the increased cancer risk in shift workers. In a controlled laboratory study, we investigated the circadian transcriptome of cancer hallmark pathway genes and associated biological pathways in circulating leukocytes obtained from healthy young adults during a 24-hour constant routine protocol following 3 days of simulated day shift or night shift. The simulated night shift schedule significantly altered the normal circadian rhythmicity of genes involved in cancer hallmark pathways. A DNA repair pathway showed significant enrichment of rhythmic genes following the simulated day shift schedule, but not following the simulated night shift schedule. In functional assessments, we demonstrated that there was an increased sensitivity to both endogenous and exogenous sources of DNA damage after exposure to simulated night shift. Our results suggest that circadian dysregulation of DNA repair may increase DNA damage and potentiate elevated cancer risk in night shift workers.
Assuntos
Biomarcadores Tumorais/genética , Transtornos Cronobiológicos/etiologia , Ritmo Circadiano , Dano ao DNA , Reparo do DNA , Neoplasias/etiologia , Jornada de Trabalho em Turnos/efeitos adversos , Transcriptoma , Ciclos de Atividade , Adulto , Transtornos Cronobiológicos/genética , Transtornos Cronobiológicos/fisiopatologia , Feminino , Perfilação da Expressão Gênica , Regulação Neoplásica da Expressão Gênica , Humanos , Masculino , Neoplasias/genética , Neoplasias/patologia , Medição de Risco , Fatores de Risco , Sono , Fatores de Tempo , Adulto JovemRESUMO
Convergent evolution dictates that diverse groups of viruses will target both similar and distinct host pathways to manipulate the immune response and improve infection. In this study, we sought to leverage this uneven viral antagonism to identify critical host factors that govern disease outcome. Utilizing a systems-based approach, we examined differential regulation of IFN-γ-dependent genes following infection with robust respiratory viruses including influenza viruses [A/influenza/Vietnam/1203/2004 (H5N1-VN1203) and A/influenza/California/04/2009 (H1N1-CA04)] and coronaviruses [severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome CoV (MERS-CoV)]. Categorizing by function, we observed down-regulation of gene expression associated with antigen presentation following both H5N1-VN1203 and MERS-CoV infection. Further examination revealed global down-regulation of antigen-presentation gene expression, which was confirmed by proteomics for both H5N1-VN1203 and MERS-CoV infection. Importantly, epigenetic analysis suggested that DNA methylation, rather than histone modification, plays a crucial role in MERS-CoV-mediated antagonism of antigen-presentation gene expression; in contrast, H5N1-VN1203 likely utilizes a combination of epigenetic mechanisms to target antigen presentation. Together, the results indicate a common mechanism utilized by H5N1-VN1203 and MERS-CoV to modulate antigen presentation and the host adaptive immune response.
Assuntos
Apresentação de Antígeno , Epigênese Genética , Virus da Influenza A Subtipo H5N1/patogenicidade , Coronavírus da Síndrome Respiratória do Oriente Médio/patogenicidade , Animais , Variação Antigênica , Linhagem Celular , Chlorocebus aethiops , Metilação de DNA , Cães , Regulação para Baixo , Histonas/química , Humanos , Células Madin Darby de Rim Canino , Complexo Principal de Histocompatibilidade , Mutação , Fases de Leitura Aberta , Proteômica , Células VeroRESUMO
Saprobic fungi, such as Aspergillus niger, grow as colonies consisting of a network of branching and fusing hyphae that are often considered to be relatively uniform entities in which nutrients can freely move through the hyphae. In nature, different parts of a colony are often exposed to different nutrients. We have investigated, using a multi-omics approach, adaptation of A. niger colonies to spatially separated and compositionally different plant biomass substrates. This demonstrated a high level of intra-colony differentiation, which closely matched the locally available substrate. The part of the colony exposed to pectin-rich sugar beet pulp and to xylan-rich wheat bran showed high pectinolytic and high xylanolytic transcript and protein levels respectively. This study therefore exemplifies the high ability of fungal colonies to differentiate and adapt to local conditions, ensuring efficient use of the available nutrients, rather than maintaining a uniform physiology throughout the colony.
Assuntos
Adaptação Fisiológica , Aspergillus niger/metabolismo , Carbono/metabolismo , Biomassa , Hifas/metabolismo , Pectinas/metabolismoRESUMO
Wood-decomposing fungi efficiently decompose plant lignocellulose, and there is increasing interest in characterizing and perhaps harnessing the fungal gene regulation strategies that enable wood decomposition. Proper interpretation of these fungal mechanisms relies on accurate quantification of gene expression, demanding reliable internal control genes (ICGs) as references. Commonly used ICGs such as actin, however, fluctuate among wood-decomposing fungi under defined conditions. In this study, by mining RNA-seq data in silico and validating ICGs in vitro using qRT-PCR, we targeted more reliable ICGs for studying transcriptional responses in wood-decomposing fungi, particularly responses to changing environments (e.g., carbon sources, decomposition stages) in various culture conditions. Using the model brown rot fungus Postia placenta in a first-pass study, our mining efforts yielded 15 constitutively-expressed genes robust in variable carbon sources (e.g., no carbon, glucose, cellobiose, aspen) and cultivation stages (e.g., 15â¯h, 72â¯h) in submerged cultures. Of these, we found 7 genes as most suitable ICGs. Expression stabilities of these newly selected ICGs were better than commonly used ICGs, analyzed by NormFinder algorithm and qRT-PCR. In a second-pass, multi-species study in solid wood, our RNA-seq mining efforts revealed hundreds of highly constitutively expressed genes among four wood-decomposing fungi with varying nutritional modes (brown rot, white rot), including a shared core set of ICGs numbering 11 genes. Together, the newly selected ICGs highlighted here will increase reliability when studying gene regulatory mechanisms of wood-decomposing fungi.
Assuntos
Fungos/genética , Lignina/genética , Madeira/microbiologia , Perfilação da Expressão Gênica , Regulação Fúngica da Expressão Gênica/genética , Madeira/genéticaRESUMO
MAIN CONCLUSION: Unlike rosette leaves, the mature Arabidopsis rosette core can display full resistance to Botrytis cinerea revealing the importance for spatial and developmental aspects of plant fungal resistance. Arabidopsis thaliana is a model host to investigate plant defense against fungi. However, many of the reports investigating Arabidopsis fungal defense against the necrotrophic fungus, Botrytis cinerea, utilize rosette leaves as host tissue. Here we report organ-dependent differences in B. cinerea resistance of Arabidopsis. Although wild-type Arabidopsis rosette leaves mount a jasmonate-dependent defense that slows fungal growth, this defense is incapable of resisting fungal devastation. In contrast, as the fungus spreads through infected leaf petioles towards the plant center, or rosette core, there is a jasmonate- and age-dependent fungal penetration blockage into the rosette core. We report evidence for induced and preformed resistance in the rosette core, as direct rosette core inoculation can also result in resistance, but at a lower penetrance relative to infections that approach the core from infected leaf petioles. The Arabidopsis rosette core displays a distinct transcriptome relative to other plant organs, and BLADE ON PETIOLE (BOP) transcripts are abundant in the rosette core. The BOP genes, with known roles in abscission zone formation, are required for full Arabidopsis rosette core B. cinerea resistance, suggesting a possible role for BOP-dependent modifications that may help to restrict fungal susceptibility of the rosette core. Finally, we demonstrate that cabbage and cauliflower, common Brassicaceae crops, also display leaf susceptibility and rosette core resistance to B. cinerea that can involve leaf abscission. Thus, spatial and developmental aspects of plant host resistance play critical roles in resistance to necrotrophic fungal pathogens and are important to our understanding of plant defense mechanisms.
Assuntos
Arabidopsis/imunologia , Resistência à Doença , Doenças das Plantas/microbiologia , Folhas de Planta/microbiologia , Arabidopsis/microbiologia , Arabidopsis/fisiologia , Botrytis , Perfilação da Expressão Gênica , Doenças das Plantas/imunologia , Reguladores de Crescimento de Plantas/metabolismo , Folhas de Planta/imunologia , Reação em Cadeia da Polimerase em Tempo RealRESUMO
With an ongoing threat posed by circulating zoonotic strains, new strategies are required to prepare for the next emergent coronavirus (CoV). Previously, groups had targeted conserved coronavirus proteins as a strategy to generate live attenuated vaccine strains against current and future CoVs. With this in mind, we explored whether manipulation of CoV NSP16, a conserved 2'O methyltransferase (MTase), could provide a broad attenuation platform against future emergent strains. Using the severe acute respiratory syndrome-CoV mouse model, an NSP16 mutant vaccine was evaluated for protection from heterologous challenge, efficacy in the aging host, and potential for reversion to pathogenesis. Despite some success, concerns for virulence in the aged and potential for reversion makes targeting NSP16 alone an untenable approach. However, combining a 2'O MTase mutation with a previously described CoV fidelity mutant produced a vaccine strain capable of protection from heterologous virus challenge, efficacy in aged mice, and no evidence for reversion. Together, the results indicate that targeting the CoV 2'O MTase in parallel with other conserved attenuating mutations may provide a platform strategy for rapidly generating live attenuated coronavirus vaccines.IMPORTANCE Emergent coronaviruses remain a significant threat to global public health and rapid response vaccine platforms are needed to stem future outbreaks. However, failure of many previous CoV vaccine formulations has clearly highlighted the need to test efficacy under different conditions and especially in vulnerable populations such as the aged and immunocompromised. This study illustrates that despite success in young models, the 2'O methyltransferase mutant carries too much risk for pathogenesis and reversion in vulnerable models to be used as a stand-alone vaccine strategy. Importantly, the 2'O methyltransferase mutation can be paired with other attenuating approaches to provide robust protection from heterologous challenge and in vulnerable populations. Coupled with increased safety and reduced pathogenesis, the study highlights the potential for 2'O methyltransferase attenuation as a major component of future live attenuated coronavirus vaccines.
Assuntos
Infecções por Coronavirus/prevenção & controle , Coronavirus/imunologia , Metiltransferases/genética , Proteínas não Estruturais Virais/genética , Vacinas Virais/genética , Envelhecimento/imunologia , Animais , Proteínas Arqueais/genética , Chlorocebus aethiops , Infecções por Coronavirus/imunologia , Infecções por Coronavirus/virologia , Modelos Animais de Doenças , Hospedeiro Imunocomprometido , Metilação , Metiltransferases/imunologia , Camundongos , Camundongos Endogâmicos BALB C , Mutação , Coronavírus Relacionado à Síndrome Respiratória Aguda Grave/genética , Coronavírus Relacionado à Síndrome Respiratória Aguda Grave/imunologia , Vacinas Atenuadas/genética , Vacinas Atenuadas/imunologia , Células Vero , Proteínas não Estruturais Virais/imunologia , Vacinas Virais/imunologia , Replicação ViralRESUMO
Alcohols are commonly derived from the degradation of organic matter and yet are rarely measured in environmental samples. Wetlands in the Prairie Pothole Region (PPR) support extremely high methane emissions and the highest sulfate reduction rates reported to date, likely contributing to a significant proportion of organic matter mineralization in this system. While ethanol and isopropanol concentrations up to 4 to 5 mM in PPR wetland pore fluids have been implicated in sustaining these high rates of microbial activity, the mechanisms that support alcohol cycling in this ecosystem are poorly understood. We leveraged metagenomic and transcriptomic tools to identify genes, pathways, and microorganisms potentially accounting for alcohol cycling in PPR wetlands. Phylogenetic analyses revealed diverse alcohol dehydrogenases and putative substrates. Alcohol dehydrogenase and aldehyde dehydrogenase genes were included in 62 metagenome-assembled genomes (MAGs) affiliated with 16 phyla. The most frequently encoded pathway (in 30 MAGs) potentially accounting for alcohol production was a Pyrococcus furiosus-like fermentation which can involve pyruvate:ferredoxin oxidoreductase (PFOR). Transcripts for 93 of 137 PFOR genes in these MAGs were detected, as well as for 158 of 243 alcohol dehydrogenase genes retrieved from these same MAGs. Mixed acid fermentation and heterofermentative lactate fermentation were also frequently encoded. Finally, we identified 19 novel putative isopropanol dehydrogenases in 15 MAGs affiliated with Proteobacteria, Acidobacteria, Chloroflexi, Planctomycetes, Ignavibacteriae, Thaumarchaeota, and the candidate divisions KSB1 and Rokubacteria We conclude that diverse microorganisms may use uncommon and potentially novel pathways to produce ethanol and isopropanol in PPR wetland sediments.IMPORTANCE Understanding patterns of organic matter degradation in wetlands is essential for identifying the substrates and mechanisms supporting greenhouse gas production and emissions from wetlands, the main natural source of methane in the atmosphere. Alcohols are common fermentation products but are poorly studied as key intermediates in organic matter degradation in wetlands. By investigating genes, pathways, and microorganisms potentially accounting for the high concentrations of ethanol and isopropanol measured in Prairie Pothole wetland sediments, this work advanced our understanding of alcohol fermentations in wetlands linked to extremely high greenhouse gas emissions. Moreover, the novel alcohol dehydrogenases and microbial taxa potentially involved in alcohol metabolism may serve biotechnological efforts in bioengineering commercially valuable alcohol production and in the discovery of novel isopropanol producers or isopropanol fermentation pathways.
Assuntos
Álcoois/metabolismo , Archaea/metabolismo , Bactérias/metabolismo , Sedimentos Geológicos/microbiologia , Metagenoma , Microbiota , North Dakota , Análise de Sequência de DNA , Áreas AlagadasRESUMO
Biochemical networks mediating normal lung morphogenesis and function have important implications for ameliorating morbidity and mortality in premature infants. Although several transcript-level studies have examined normal lung development, corresponding protein-level analyses are lacking. Here we performed proteomics analysis of murine lungs from embryonic to early adult ages to identify the molecular networks mediating normal lung development. We identified 8,932 proteins, providing a deep and comprehensive view of the lung proteome. Analysis of the proteomics data revealed discrete modules and the underlying regulatory and signaling network modulating their expression during development. Our data support the cell proliferation that characterizes early lung development and highlight responses of the lung to exposure to a nonsterile oxygen-rich ambient environment and the important role of lipid (surfactant) metabolism in lung development. Comparison of dynamic regulation of proteomic and recent transcriptomic analyses identified biological processes under posttranscriptional control. Our study provides a unique proteomic resource for understanding normal lung formation and function and can be freely accessed at Lungmap.net.
Assuntos
Perfilação da Expressão Gênica , Regulação da Expressão Gênica no Desenvolvimento/fisiologia , Pulmão/embriologia , Proteoma/metabolismo , Transdução de Sinais/fisiologia , Transcriptoma/fisiologia , Animais , Feminino , Redes Reguladoras de Genes/fisiologia , Masculino , CamundongosRESUMO
The mraZ and mraW genes are highly conserved in bacteria, both in sequence and in their position at the head of the division and cell wall (dcw) gene cluster. Located directly upstream of the mraZ gene, the Pmra promoter drives the transcription of mraZ and mraW, as well as many essential cell division and cell wall genes, but no regulator of Pmra has been found to date. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin and MraW is known to methylate the 16S rRNA, mraZ and mraW null mutants have no detectable phenotypes. Here we show that overproduction of Escherichia coli MraZ inhibited cell division and was lethal in rich medium at high induction levels and in minimal medium at low induction levels. Co-overproduction of MraW suppressed MraZ toxicity, and loss of MraW enhanced MraZ toxicity, suggesting that MraZ and MraW have antagonistic functions. MraZ-green fluorescent protein localized to the nucleoid, suggesting that it binds DNA. Consistent with this idea, purified MraZ directly bound a region of DNA containing three direct repeats between Pmra and the mraZ gene. Excess MraZ reduced the expression of an mraZ-lacZ reporter, suggesting that MraZ acts as a repressor of Pmra, whereas a DNA-binding mutant form of MraZ failed to repress expression. Transcriptome sequencing (RNA-seq) analysis suggested that MraZ also regulates the expression of genes outside the dcw cluster. In support of this, purified MraZ could directly bind to a putative operator site upstream of mioC, one of the repressed genes identified by RNA-seq.
Assuntos
Proteínas de Escherichia coli/metabolismo , Escherichia coli/metabolismo , Regulação Bacteriana da Expressão Gênica/fisiologia , Sequência de Aminoácidos , Sequência de Bases , Sequência Conservada , DNA Bacteriano/genética , Escherichia coli/genética , Proteínas de Escherichia coli/genética , Genoma Bacteriano , Ligação Proteica , Transporte Proteico , RNA Bacteriano/genética , TranscriptomaRESUMO
BACKGROUND: Cyanothece sp. PCC 7822 is an excellent cyanobacterial model organism with great potential to be applied as a biocatalyst for the production of high value compounds. Like other unicellular diazotrophic cyanobacterial species, it has a tightly regulated metabolism synchronized to the light-dark cycle. Utilizing transcriptomic and proteomic methods, we quantified the relationships between transcription and translation underlying central and secondary metabolism in response to nitrogen free, 12 hour light and 12 hour dark conditions. RESULTS: By combining mass-spectrometry based proteomics and RNA-sequencing transcriptomics, we quantitatively measured a total of 6766 mRNAs and 1322 proteins at four time points across a 24 hour light-dark cycle. Photosynthesis, nitrogen fixation, and carbon storage relevant genes were expressed during the preceding light or dark period, concurrent with measured nitrogenase activity in the late light period. We describe many instances of disparity in peak mRNA and protein abundances, and strong correlation of light dependent expression of both antisense and CRISPR-related gene expression. The proteins for nitrogenase and the pentose phosphate pathway were highest in the dark, whereas those for glycolysis and the TCA cycle were more prominent in the light. Interestingly, one copy of the psbA gene encoding the photosystem II (PSII) reaction center protein D1 (psbA4) was highly upregulated only in the dark. This protein likely cannot catalyze O2 evolution and so may be used by the cell to keep PSII intact during N2 fixation. The CRISPR elements were found exclusively at the ends of the large plasmid and we speculate that their presence is crucial to the maintenance of this plasmid. CONCLUSIONS: This investigation of parallel transcriptional and translational activity within Cyanothece sp. PCC 7822 provided quantitative information on expression levels of metabolic pathways relevant to engineering efforts. The identification of expression patterns for both mRNA and protein affords a basis for improving biofuel production in this strain and for further genetic manipulations. Expression analysis of the genes encoded on the 6 plasmids provided insight into the possible acquisition and maintenance of some of these extra-chromosomal elements.