Directing in Vitro Selection towards G-quadruplex-forming Aptamers to Inhibit HMGB1 Pathological Activity.

In the search for novel, effective inhibitors of High-Mobility Group Box1 (HMGB1)-a protein involved in various inflammatory and autoimmune diseases as well as in cancer-we herein discovered a set of anti-HMGB1 G-quadruplex(G4)-forming aptamers by using an in vitro selection procedure applied to a doped library of guanine-rich oligonucleotides. The selected DNA sequences were then studied in a pseudo-physiological buffer mimicking the extracellular medium, where HMGB1 exerts its pathological activity, using spectroscopic, electrophoretic, and chromatographic techniques. All the oligonucleotides proved to fold into monomeric G4s and in some cases also dimeric species, stable at physiological temperature. Remarkably, the protein preferentially recognized the sequences forming dimeric parallel G4 structures, as evidenced by a properly designed chemiluminescent binding assay which also highlighted a good selectivity of these aptamers for HMGB1. Moreover, all aptamers showed anti-HMGB1 activity, inhibiting protein-induced cell migration. The acquired data allowed identifying L12 as the best anti-HMGB1 aptamer, featured by high thermal and enzymatic stability, no toxicity at least up to 5 µM concentration on healthy cells, along with potent anti-HMGB1 activity (IC50 ca. 28 nM) and good binding affinity for the protein, thus indicating it as a very promising lead candidate for in vivo studies.

Exploring the Binding of Natural Compounds to Cancer-Related G-Quadruplex Structures: From 9,10-Dihydrophenanthrenes to Their Dimeric and Glucoside Derivatives.

In-depth studies on the interaction of natural compounds with cancer-related G-quadruplex structures have been undertaken only recently, despite their high potential as anticancer agents, especially due to their well-known and various bioactivities. In this frame, aiming at expanding the repertoire of natural compounds able to selectively recognize G-quadruplexes, and particularly focusing on phenanthrenoids, a mini-library including dimeric (1-3) and glucoside (4-5) analogues of 9,10-dihydrophenanthrenes, a related tetrahydropyrene glucoside (6) along with 9,10-dihydrophenanthrene 7 were investigated here by several biophysical techniques and molecular docking. Compounds 3 and 6 emerged as the most selective G-quadruplex ligands within the investigated series. These compounds proved to mainly target the grooves/flanking residues of the hybrid telomeric and parallel oncogenic G-quadruplex models exploiting hydrophobic, hydrogen bond and π-π interactions, without perturbing the main folds of the G-quadruplex structures. Notably, a binding preference was found for both ligands towards the hybrid telomeric G-quadruplex. Moreover, compounds 3 and 6 proved to be active on different human cancer cells in the low micromolar range. Overall, these compounds emerged as useful ligands able to target G-quadruplex structures, which are of interest as promising starting scaffolds for the design of analogues endowed with high and selective anticancer activity.

Selective Targeting of Cancer-Related G-Quadruplex Structures by the Natural Compound Dicentrine.

Aiming to identify highly effective and selective G-quadruplex ligands as anticancer candidates, five natural compounds were investigated here, i.e., the alkaloids Canadine, D-Glaucine and Dicentrine, as well as the flavonoids Deguelin and Millettone, selected as analogs of compounds previously identified as promising G-quadruplex-targeting ligands. A preliminary screening with the G-quadruplex on the Controlled Pore Glass assay proved that, among the investigated compounds, Dicentrine is the most effective ligand of telomeric and oncogenic G-quadruplexes, also showing good G-quadruplex vs. duplex selectivity. In-depth studies in solution demonstrated the ability of Dicentrine to thermally stabilize telomeric and oncogenic G-quadruplexes without affecting the control duplex. Interestingly, it showed higher affinity for the investigated G-quadruplex structures over the control duplex (Kb~106 vs. 105 M-1), with some preference for the telomeric over the oncogenic G-quadruplex model. Molecular dynamics simulations indicated that Dicentrine preferentially binds the G-quadruplex groove or the outer G-tetrad for the telomeric and oncogenic G-quadruplexes, respectively. Finally, biological assays proved that Dicentrine is highly effective in promoting potent and selective anticancer activity by inducing cell cycle arrest through apoptosis, preferentially targeting G-quadruplex structures localized at telomeres. Taken together, these data validate Dicentrine as a putative anticancer candidate drug selectively targeting cancer-related G-quadruplex structures.

Design, Synthesis, and Characterization of an Amphiphilic Lipoic Acid-Based Ru(III) Complex as a Versatile Tool for the Functionalization of Different Nanosystems.

Ru-based chemotherapy is emerging as an effective alternative to the well-established Pt-based one, typically associated with high toxicity. In this context, our recent efforts were devoted to the preparation of nucleolipid-based Ru(III) complexes able to form, under physiological conditions, supramolecular aggregates which can efficiently prevent metal deactivation and convey Ru(III) inside the cells where it exerts its activity. Within an interdisciplinary program for the development of multifunctional nanoparticles for theranostic applications, we here report the design, synthesis, and characterization of a novel functionalized Ru(III) salt, carrying a lipoic acid moiety in the nucleolipid-based scaffold to allow its incorporation onto metal-based nanoparticles.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Anti-VEGF DNA-based aptamers in cancer therapeutics and diagnostics.

The vascular endothelial growth factor (VEGF) family and its receptors play fundamental roles not only in physiological but also in pathological angiogenesis, characteristic of cancer progression. Aiming at finding putative treatments for several malignancies, various small molecules, antibodies, or protein-based drugs have been evaluated in vitro and in vivo as VEGF inhibitors, providing efficient agents approved for clinical use. Due to the high clinical importance of VEGF, also a great number of anti-VEGF nucleic acid-based aptamers-that is, oligonucleotides able to bind with high affinity and specificity a selected biological target-have been developed as promising agents in anticancer strategies. Notable research efforts have been made in optimization processes of the identified aptamers, searching for increased target affinity and/or bioactivity by exploring structural analogues of the lead compounds. This review is focused on recent studies devoted to the development of DNA-based aptamers designed to target VEGF. Their therapeutic potential as well as their significance in the construction of highly selective biosensors is here discussed.

Natural compounds from Juncus plants interacting with telomeric and oncogene G-quadruplex structures as potential anticancer agents.

Aiming at discovering novel, putative anticancer drugs featuring low-to-null side effects, natural compounds isolated from Juncaceae were studied here for their ability to target G-quadruplex structures originating from cancer-related telomeric and oncogene DNA sequences. Particularly, various dihydrophenanthrene, benzocoumarin and dihydrodibenzoxepin derivatives were firstly screened by the affinity chromatography-based G4-CPG assay, and the compound with the highest affinity and selectivity for G-quadruplexes (named J10) was selected for further studies. Fluorescence spectroscopy and circular dichroism experiments corroborated its capability to selectively recognize and stabilize G-quadruplexes over duplex DNA, also showing a preference for parallel G-quadruplexes. Molecular docking proved that the selective G-quadruplex interactions over duplex interactions could be due to the ability of J10 to bind to the grooves of the telomeric and oncogene G-quadruplex structures. Finally, biological assays demonstrated that J10 induces significant antiproliferative effects on human leukemia cells, with no relevant effects on healthy human fibroblasts. Interestingly, J10 exerts its antiproliferative action on tumor cells by activating the apoptotic pathway.

Insights into the G-rich VEGF-binding aptamer V7t1: when two G-quadruplexes are better than one!

The G-quadruplex-forming VEGF-binding aptamer V7t1 was previously found to be highly polymorphic in a K+-containing solution and, to restrict its conformational preferences to a unique, well-defined form, modified nucleotides (LNA and/or UNA) were inserted in its sequence. We here report an in-depth biophysical characterization of V7t1 in a Na+-rich medium, mimicking the extracellular environment in which VEGF targeting should occur, carried out combining several techniques to analyse the conformational behaviour of the aptamer and its binding to the protein. Our results demonstrate that, in the presence of high Na+ concentrations, V7t1 behaves in a very different way if subjected or not to annealing procedures, as evidenced by native gel electrophoresis, size exclusion chromatography and dynamic light scattering analysis. Indeed, not-annealed V7t1 forms both monomeric and dimeric G-quadruplexes, while the annealed oligonucleotide is a monomeric species. Remarkably, only the dimeric aptamer efficiently binds VEGF, showing higher affinity for the protein compared to the monomeric species. These findings provide new precious information for the development of improved V7t1 analogues, allowing more efficient binding to the cancer-related protein and the design of effective biosensors or theranostic devices based on VEGF targeting.

DNA Binding Mode Analysis of a Core-Extended Naphthalene Diimide as a Conformation-Sensitive Fluorescent Probe of G-Quadruplex Structures.

G-quadruplex existence was proved in cells by using both antibodies and small molecule fluorescent probes. However, the G-quadruplex probes designed thus far are structure- but not conformation-specific. Recently, a core-extended naphthalene diimide (cex-NDI) was designed and found to provide fluorescent signals of markedly different intensities when bound to G-quadruplexes of different conformations or duplexes. Aiming at evaluating how the fluorescence behaviour of this compound is associated with specific binding modes to the different DNA targets, cex-NDI was here studied in its interaction with hybrid G-quadruplex, parallel G-quadruplex, and B-DNA duplex models by biophysical techniques, molecular docking, and biological assays. cex-NDI showed different binding modes associated with different amounts of stacking interactions with the three DNA targets. The preferential binding sites were the groove, outer quartet, or intercalative site of the hybrid G-quadruplex, parallel G-quadruplex, and B-DNA duplex, respectively. Interestingly, our data show that the fluorescence intensity of DNA-bound cex-NDI correlates with the amount of stacking interactions formed by the ligand with each DNA target, thus providing the rationale behind the conformation-sensitive properties of cex-NDI and supporting its use as a fluorescent probe of G-quadruplex structures. Notably, biological assays proved that cex-NDI mainly localizes in the G-quadruplex-rich nuclei of cancer cells.

From Prebiotic Chemistry to Supramolecular Biomedical Materials: Exploring the Properties of Self-Assembling Nucleobase-Containing Peptides.

Peptides and their synthetic analogs are a class of molecules with enormous relevance as therapeutics for their ability to interact with biomacromolecules like nucleic acids and proteins, potentially interfering with biological pathways often involved in the onset and progression of pathologies of high social impact. Nucleobase-bearing peptides (nucleopeptides) and pseudopeptides (PNAs) offer further interesting possibilities related to their nucleobase-decorated nature for diagnostic and therapeutic applications, thanks to their reported ability to target complementary DNA and RNA strands. In addition, these chimeric compounds are endowed with intriguing self-assembling properties, which are at the heart of their investigation as self-replicating materials in prebiotic chemistry, as well as their application as constituents of innovative drug delivery systems and, more generally, as novel nanomaterials to be employed in biomedicine. Herein we describe the properties of nucleopeptides, PNAs and related supramolecular systems, and summarize some of the most relevant applications of these systems.

Synthesis and nucleic acid binding evaluation of a thyminyl l-diaminobutanoic acid-based nucleopeptide.

Herein we present the synthesis of a l-diaminobutanoic acid (DABA)-based nucleopeptide (3), with an oligocationic backbone, realized by solid phase peptide synthesis using thymine-bearing DABA moieties alternating in the sequence with free ones. CD studies evidenced the ability of this oligothymine nucleopeptide, well soluble in aqueous solution, to alter the secondary structure particularly of complementary RNA (poly rA vs poly rU) and inosine-rich RNAs, like poly rI and poly rIC, and showed its preference in binding double vs single-stranded DNAs. Furthermore, ESI mass spectrometry revealed that 3 bound also G-quadruplex (G4) DNAs, with either parallel or antiparallel topologies (adopted in our experimental conditions by c-myc and tel22, respectively). However, it caused detectable changes only in the CD of c-myc (whose parallel G4 structure was also thermally stabilized by ~3 °C), while leaving unaltered the antiparallel structure of tel22. Interestingly, CD and UV analyses suggested that 3 induced a hybrid mixed parallel/antiparallel G4 DNA structure in a random-coil tel22 DNA obtained under salt-free buffer conditions. Titration of the random-coil telomeric DNA with 3 gave quantitative information on the stoichiometry of the obtained complex. Overall, the findings of this work suggest that DABA-based nucleopeptides are synthetic nucleic acid analogues potentially useful in antigene and antisense strategies. Nevertheless, the hexathymine DABA-nucleopeptide shows an interesting behaviour as molecular tool per se thanks to its efficacy in provoking G4 induction in random coil G-rich DNA, as well as for the possibility to bind and stabilize c-myc oncogene in a G4 structure.

Tuning the Polymorphism of the Anti-VEGF G-rich V7t1 Aptamer by Covalent Dimeric Constructs.

In the optimization process of nucleic acid aptamers, increased affinity and/or activity are generally searched by exploring structural analogues of the lead compound. In many cases, promising results have been obtained by dimerization of the starting aptamer. Here we studied a focused set of covalent dimers of the G-quadruplex (G4) forming anti-Vascular Endothelial Growth Factor (VEGF) V7t1 aptamer with the aim of identifying derivatives with improved properties. In the design of these covalent dimers, connecting linkers of different chemical nature, maintaining the same polarity along the strand or inverting it, have been introduced. These dimeric aptamers have been investigated using several biophysical techniques to disclose the conformational behavior, molecularity and thermal stability of the structures formed in different buffers. This in-depth biophysical characterization revealed the formation of stable G4 structures, however in some cases accompanied by alternative tridimensional arrangements. When tested for their VEGF165 binding and antiproliferative activity in comparison with V7t1, these covalent dimers showed slightly lower binding ability to the target protein but similar if not slightly higher antiproliferative activity on human breast adenocarcinoma MCF-7 cells. These results provide useful information for the design of improved dimeric aptamers based on further optimization of the linker joining the two consecutive V7t1 sequences.

Trifunctionalized Naphthalene Diimides and Dimeric Analogues as G-Quadruplex-Targeting Anticancer Agents Selected by Affinity Chromatography.

A focused library of newly designed monomeric and dimeric naphthalene diimides (NDIs) was analyzed in its ability to recognize specific G-quadruplex (G4) structures discriminating duplex DNA. The best G4 ligands-according to an affinity chromatography-based screening method named G4-CPG-were tested on human cancer and healthy cells, inducing DNA damage at telomeres, and in parallel, showing selective antiproliferative activity on HeLa cancer cells with IC50 values in the low nanomolar range. CD and fluorescence spectroscopy studies allowed detailed investigation of the interaction in solution with different G4 and duplex DNA models of the most promising NDI of the series, as determined by combining the biophysical and biological assays' data.

Dimeric and Multimeric DNA Aptamers for Highly Effective Protein Recognition.

Multivalent interactions frequently occur in biological systems and typically provide higher binding affinity and selectivity in target recognition than when only monovalent interactions are operative. Thus, taking inspiration by nature, bivalent or multivalent nucleic acid aptamers recognizing a specific biological target have been extensively studied in the last decades. Indeed, oligonucleotide-based aptamers are suitable building blocks for the development of highly efficient multivalent systems since they can be easily modified and assembled exploiting proper connecting linkers of different nature. Thus, substantial research efforts have been put in the construction of dimeric/multimeric versions of effective aptamers with various degrees of success in target binding affinity or therapeutic activity enhancement. The present review summarizes recent advances in the design and development of dimeric and multimeric DNA-based aptamers, including those forming G-quadruplex (G4) structures, recognizing different key proteins in relevant pathological processes. Most of the designed constructs have shown improved performance in terms of binding affinity or therapeutic activity as anti-inflammatory, antiviral, anticoagulant, and anticancer agents and their number is certainly bound to grow in the next future.

On the pH-Modulated Ru-Based Prodrug Activation Mechanism.

The RuIII-based prodrug AziRu efficiently binds to proteins, but the mechanism of its release is still disputed. Herein, in order to test the hypothesis of a reduction-mediated Ru release from proteins, a Raman-assisted crystallographic study on AziRu binding to a model protein (hen egg white lysozyme), in two different oxidation states, RuII and RuIII, was carried out. Our results indicate Ru reduction, but the Ru release upon reduction is dependent on the reducing agent. To better understand this process, a pH-dependent, spectroelectrochemical surface-enhanced Raman scattering (SERS) study was performed also on AziRu-functionalized Au electrodes as a surrogate and simplest model system of RuII- and RuIII-based drugs. This SERS study provided a p Ka of 6.0 ± 0.4 for aquated AziRu in the RuIII state, which falls in the watershed range of pH values separating most cancer environments from their physiological counterparts. These experiments also indicate a dramatic shift of the redox potential E0 by >600 mV of aquated AziRu toward more positive potentials upon acidification, suggesting a selective AziRu reduction in cancer lumen but not in healthy ones. It is expected that the nature of the ligands (e.g., pyridine vs imidazole, present in well-known RuIII complex NAMI-A) will modulate the p Ka and E0, without affecting the underlying reaction mechanism.

Ionophores at work: Exploring the interaction of guanosine-based amphiphiles with phospholipid membranes.

An amphiphilic derivative of guanosine, carrying a myristoyl group at the 5'-position and two methoxy(triethylene glycol) appendages at the 2' and 3'-positions (1), endowed with high ionophoric activity, has been here studied in its interaction mode with a model lipid membrane along with its 5'-spin-labelled analogue 2, bearing the 5-doxyl-stearic in lieu of the myristic residue. Electron spin resonance spectra, carried out on the spin-labelled nucleolipid 2 in mixture with a DOPC/DOPG phospholipid bilayer, on one side, and on spin-labelled lipids mixed with 1, on the other, integrated with dynamic light scattering and neutron reflectivity measurements, allowed getting an in-depth picture of the effect of the ionophores on membrane structure, relevant to clarify the ion transport mechanism through lipid bilayers. Particularly, dehydration of lipid headgroups and lowering of both the local polarity and acyl chains order across the bilayer, due to the insertion of the oligo(ethylene glycol) chains in the bilayer hydrophobic core, have been found to be the main effects of the amphiphilic guanosines interaction with the membrane. These results furnish directions to rationally implement future ionophores design.

G-quadruplex-based aptamers against protein targets in therapy and diagnostics.

Nucleic acid aptamers are single-stranded DNA or RNA molecules identified to recognize with high affinity specific targets including proteins, small molecules, ions, whole cells and even entire organisms, such as viruses or bacteria. They can be identified from combinatorial libraries of DNA or RNA oligonucleotides by SELEX technology, an in vitro iterative selection procedure consisting of binding (capture), partitioning and amplification steps. Remarkably, many of the aptamers selected against biologically relevant protein targets are G-rich sequences that can fold into stable G-quadruplex (G4) structures. Aiming at disseminating novel inspiring ideas within the scientific community in the field of G4-structures, the emphasis of this review is placed on: 1) recent advancements in SELEX technology for the efficient and rapid identification of new candidate aptamers (introduction of microfluidic systems and next generation sequencing); 2) recurrence of G4 structures in aptamers selected by SELEX against biologically relevant protein targets; 3) discovery of several G4-forming motifs in important regulatory regions of the human or viral genome bound by endogenous proteins, which per se can result into potential aptamers; 4) an updated overview of G4-based aptamers with therapeutic potential and 5) a discussion on the most attractive G4-based aptamers for diagnostic applications. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.

Antitumour activity of resveratrol on human melanoma cells: A possible mechanism related to its interaction with malignant cell telomerase.

BACKGROUND: trans-Resveratrol (tRES) is a polyphenolic stilbene found in plant products which has attracted great attention because of its antioxidant, anti-inflammatory and anticancer properties. METHODS: The possible correlation between tRES-induced suppression of melanoma cell growth and its influence on telomerase expression has been investigated by biological assays. Moreover, in order to gain new knowledge about possible mechanisms of action of tRES as antineoplastic agent, its interaction with biologically relevant secondary structure-forming DNA sequences, its aggregation properties and copper-binding activity have been studied by CD, UV and fluorescence spectroscopies. RESULTS: Biological assays have confirmed that growth inhibitory properties of tRES well correlate with the reduction of telomerase activity and hTERT gene transcript levels in human melanoma cells. Biophysical studies in solution have proved that tRES binds all the studied DNA model systems with low affinity, however showing high ability to discriminate G-quadruplex vs. duplex DNA. In addition, tRES has shown no propensity to form aggregates in the explored concentration range and has been found able to bind Cu2+ ions with a 2:1 stoichiometry. CONCLUSIONS: From these biological and biophysical analyses it has emerged that tRES produces cytotoxic effects on human melanoma cells and, at a molecular level, is able to bind Cu2+ and cancer-involved G-quadruplexes, suggesting that multiple mechanisms of action could be involved in its antineoplastic activity. GENERAL SIGNIFICANCE: Expanding the knowledge on the putative mechanisms of action of tRES as antitumour agent can help to develop novel, effective tRES-based anticancer drugs.

Tandem application of ligand-based virtual screening and G4-OAS assay to identify novel G-quadruplex-targeting chemotypes.

BACKGROUND: G-quadruplex (G4) structures are key elements in the regulation of cancer cell proliferation and their targeting is deemed to be a promising strategy in anticancer therapy. METHODS: A tandem application of ligand-based virtual screening (VS) calculations together with the experimental G-quadruplex on Oligo Affinity Support (G4-OAS) assay was employed to discover novel G4-targeting compounds. The interaction of the selected compounds with the investigated G4 in solution was analysed through a series of biophysical techniques and their biological activity investigated by immunofluorescence and MTT assays. RESULTS: A focused library of 60 small molecules, designed as putative G4 groove binders, was identified through the VS. The G4-OAS experimental screening led to the selection of 7 ligands effectively interacting with the G4-forming human telomeric DNA. Evaluation of the biological activity of the selected compounds showed that 3 ligands of this sub-library induced a marked telomere-localized DNA damage response in human tumour cells. CONCLUSIONS: The combined application of virtual and experimental screening tools proved to be a successful strategy to identify new bioactive chemotypes able to target the telomeric G4 DNA. These compounds may represent useful leads for the development of more potent and selective G4 ligands. GENERAL SIGNIFICANCE: Expanding the repertoire of the available G4-targeting chemotypes with improved physico-chemical features, in particular aiming at the discovery of novel, selective G4 telomeric ligands, can help in developing effective anti-cancer drugs with fewer side effects. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.

Guanine-based amphiphiles: synthesis, ion transport properties and biological activity.

Novel amphiphilic guanine derivatives, here named Gua1 and Gua2, have been prepared through few, simple and efficient synthetic steps. In ion transport experiments through phospholipid bilayers, carried out to evaluate their ability to mediate H(+) transport, Gua2 showed high activity. When this compound was investigated for ion-selective transport activities, no major differences were observed in the behaviour with cations while, in the case of anions, selective activity was observed in the series I(-)>Br(-)>Cl(-)>F(-). The bioactivity of these guanine analogues has been evaluated on a panel of human tumour and non-tumour cell lines in preliminary in vitro cytotoxicity assays, showing a relevant antiproliferative profile for Gua2.