Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 52
Filtrar
Mais filtros

Base de dados
Tipo de documento
Intervalo de ano de publicação
1.
Semin Cancer Biol ; 95: 1-12, 2023 10.
Artigo em Inglês | MEDLINE | ID: mdl-37364663

RESUMO

Altered energy metabolism is one of the hallmarks of tumorigenesis and essential for fulfilling the high demand for metabolic energy in a tumor through accelerating glycolysis and reprogramming the glycolysis metabolism through the Warburg effect. The dysregulated glucose metabolic pathways are coordinated not only by proteins coding genes but also by non-coding RNAs (ncRNAs) during the initiation and cancer progression. The ncRNAs are responsible for regulating numerous cellular processes under developmental and pathological conditions. Recent studies have shown that various ncRNAs such as microRNAs, circular RNAs, and long noncoding RNAs are extensively involved in rewriting glucose metabolism in human cancers. In this review, we demonstrated the role of ncRNAs in the progression of breast cancer with a focus on outlining the aberrant expression of glucose metabolic pathways. Moreover, we have discussed the existing and probable future applications of ncRNAs to regulate energy pathways along with their importance in the prognosis, diagnosis, and future therapeutics for human breast carcinoma.


Assuntos
Neoplasias da Mama , MicroRNAs , RNA Longo não Codificante , Humanos , Feminino , Neoplasias da Mama/genética , Neoplasias da Mama/patologia , RNA não Traduzido/genética , RNA não Traduzido/metabolismo , MicroRNAs/genética , RNA Longo não Codificante/genética , RNA Longo não Codificante/metabolismo , Glucose/metabolismo
2.
Environ Monit Assess ; 196(3): 279, 2024 Feb 17.
Artigo em Inglês | MEDLINE | ID: mdl-38367185

RESUMO

Efficient waste management is essential for human well-being and environmental health, as neglecting proper disposal practices can lead to financial losses and the depletion of natural resources. Given the rapid urbanization and population growth, developing an automated, innovative waste classification model becomes imperative. To address this need, our paper introduces a novel and robust solution - a smart waste classification model that leverages a hybrid deep learning model (Optimized DenseNet-121 + SVM) to categorize waste items using the TrashNet datasets. Our proposed approach uses the advanced deep learning model DenseNet-121, optimized for superior performance, to extract meaningful features from an expanded TrashNet dataset. These features are subsequently fed into a support vector machine (SVM) for precise classification. Employing data augmentation techniques further enhances classification accuracy while mitigating the risk of overfitting, especially when working with limited TrashNet data. The results of our experimental evaluation of this hybrid deep learning model are highly promising, with an impressive accuracy rate of 99.84%. This accuracy surpasses similar existing models, affirming the efficacy and potential of our approach to revolutionizing waste classification for a sustainable and cleaner future.


Assuntos
Aprendizado Profundo , Humanos , Monitoramento Ambiental , Saúde Ambiental , Recursos Naturais , Crescimento Demográfico
3.
Environ Monit Assess ; 196(8): 720, 2024 Jul 10.
Artigo em Inglês | MEDLINE | ID: mdl-38985219

RESUMO

Managing e-waste involves collecting it, extracting valuable metals at low costs, and ensuring environmentally safe disposal. However, monitoring this process has become challenging due to e-waste expansion. With IoT technology like LoRa-LPWAN, pre-collection monitoring becomes more cost-effective. Our paper presents an e-waste collection and recovery system utilizing the LoRa-LPWAN standard, integrating intelligence at the edge and fog layers. The system incentivizes WEEE holders, encouraging participation in the innovative collection process. The city administration oversees this process using innovative trucks, GPS, LoRaWAN, RFID, and BLE technologies. Analysis of IoT performance factors and quantitative assessments (latency and collision probability on LoRa, Sigfox, and NB-IoT) demonstrate the effectiveness of our incentive-driven IoT solution, particularly with LoRa standard and Edge AI integration. Additionally, cost estimates show the advantage of LoRaWAN. Moreover, the proposed IoT-based e-waste management solution promises cost savings, stakeholder trust, and long-term effectiveness through streamlined processes and human resource training. Integration with government databases involves data standardization, API development, security measures, and functionality testing for efficient management.


Assuntos
Resíduo Eletrônico , Gerenciamento de Resíduos , Gerenciamento de Resíduos/métodos , Inteligência Artificial , Monitoramento Ambiental/métodos , Internet das Coisas , Conservação dos Recursos Naturais/métodos
4.
Semin Cancer Biol ; 86(Pt 3): 682-692, 2022 11.
Artigo em Inglês | MEDLINE | ID: mdl-34051351

RESUMO

Pancreatic carcinoma is associated with one of the worst clinical outcomes throughout the globe because of its aggressive, metastatic, and drug-resistant nature. During the past decade, several studies have shown that oral, gut, and tumor microbiota play a critical role in the modulation of metabolism and immune responses. Growing pieces of evidence have proved beyond a doubt that the microbiota has a unique ability to influence the tumor microenvironment as well as the metabolism of chemotherapeutic agents or drugs. Given this, microbiota, known as the ecological community of microorganisms, stands to be an avenue of quality research. In this review, we provide detailed and critical information on the role of oral, gut, and pancreatic microbiota disruptions in the development of pancreatic carcinoma. Moreover, we comprehensively discuss the different types of microbiota, their potential role, and mechanism associated with pancreatic carcinoma. The microbiome provides the unique opportunity to enhance the effectiveness of chemotherapeutic agents and immunotherapies for pancreatic cancer by maintaining the right type of microbiota and holds a promising future to enhance the clinical outcomes of patients with pancreatic carcinoma.


Assuntos
Antineoplásicos , Microbioma Gastrointestinal , Microbiota , Neoplasias Pancreáticas , Humanos , Neoplasias Pancreáticas/terapia , Neoplasias Pancreáticas/patologia , Imunoterapia , Microambiente Tumoral , Neoplasias Pancreáticas
5.
Cell Mol Life Sci ; 79(7): 362, 2022 Jun 14.
Artigo em Inglês | MEDLINE | ID: mdl-35699794

RESUMO

Pancreatic ductal adenocarcinoma (PDAC) is correlated with poor outcomes because of limited therapeutic options. Laminin-5 gamma-2 (LAMC2) plays a critical role in key biological processes. However, the detailed molecular mechanism and potential roles of LAMC2 in PDAC stay unexplored. The present study examines the essential role and molecular mechanisms of LAMC2 in the tumorigenesis of PDAC. Here, we identified that LAMC2 is significantly upregulated in microarray cohorts and TCGA RNA sequencing data of PDAC patients compared to non-cancerous/normal tissues. Patients with higher transcript levels of LAMC2 were correlated with clinical stages; dismal overall, as well as, disease-free survival. Additionally, we confirmed significant upregulation of LAMC2 in a panel of PDAC cell lines and PDAC tumor specimens in contrast to normal pancreatic tissues and cells. Inhibition of LAMC2 significantly decreased cell growth, clonogenic ability, migration and invasion of PDAC cells, and tumor growth in the PDAC xenograft model. Mechanistically, silencing of LAMC2 suppressed expression of ZEB1, SNAIL, N-cadherin (CDH2), vimentin (VIM), and induced E-cadherin (CDH1) expression leading to a reversal of mesenchymal to an epithelial phenotype. Interestingly, co-immunoprecipitation experiments demonstrated LAMC2 interaction with epidermal growth factor receptor (EGFR). Further, stable knockdown of LAMC2 inhibited phosphorylation of EGFR, ERK1/2, AKT, mTOR, and P70S6 kinase signaling cascade in PDAC cells. Altogether, our findings suggest that silencing of LAMC2 inhibited PDAC tumorigenesis and metastasis through repression of epithelial-mesenchymal transition and modulation of EGFR/ERK1/2/AKT/mTOR axis and could be a potential diagnostic, prognostic, and therapeutic target for PDAC.


Assuntos
Carcinoma Ductal Pancreático , Laminina , Sistema de Sinalização das MAP Quinases , Neoplasias Pancreáticas , Proteínas Proto-Oncogênicas c-akt , Serina-Treonina Quinases TOR , Carcinogênese/genética , Carcinoma Ductal Pancreático/genética , Carcinoma Ductal Pancreático/metabolismo , Carcinoma Ductal Pancreático/patologia , Moléculas de Adesão Celular , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células/genética , Transição Epitelial-Mesenquimal/genética , Receptores ErbB/genética , Receptores ErbB/metabolismo , Humanos , Laminina/biossíntese , Laminina/genética , Laminina/metabolismo , Neoplasias Pancreáticas/genética , Neoplasias Pancreáticas/metabolismo , Neoplasias Pancreáticas/patologia , Proteínas Proto-Oncogênicas c-akt/genética , Proteínas Proto-Oncogênicas c-akt/metabolismo , Serina-Treonina Quinases TOR/genética , Serina-Treonina Quinases TOR/metabolismo
6.
J Microencapsul ; 40(4): 263-278, 2023 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-36989347

RESUMO

The purpose of this study was to evaluate the drug delivery and therapeutic potential of berberine (Br) loaded nanoformulation in rheumatoid arthritis (RA)-induced animal model. The Br-loaded NLCs (nanostructured lipid carriers) were prepared employing melt-emulsification process, and optimised through Box-Behnken design. The prepared NLCs were assessed for in-vitro and in-vivo evaluations. The optimised NLCs exhibited a mean diameter of 180.2 ± 0.31 nm with 88.32 ± 2.43% entrapment efficiency. An enhanced anti-arthritic activity with reduced arthritic scores to 0.66 ± 0.51, reduction in ankle diameter to 5.80 ± 0.27 mm, decline in paw withdrawal timing, and improvements in walking behaviour were observed in the Br-NLCs treated group. The radiographic images revealed a reduction in bone and cartilage deformation. The Br-NLCs showed promising results in the management of RA disease, can be developed as an efficient delivery system at commercial levels, and may be explored for clinical application after suitable experiments in the future.


Assuntos
Artrite Reumatoide , Berberina , Nanoestruturas , Animais , Portadores de Fármacos/uso terapêutico , Berberina/farmacologia , Berberina/uso terapêutico , Sistemas de Liberação de Medicamentos , Artrite Reumatoide/tratamento farmacológico , Modelos Animais , Lipídeos , Tamanho da Partícula
7.
Semin Cancer Biol ; 68: 258-278, 2021 01.
Artigo em Inglês | MEDLINE | ID: mdl-32380233

RESUMO

Human malignancies are one of the major health-related issues though out the world and anticipated to rise in the future. The development of novel drugs/agents requires a huge amount of cost and time that represents a major challenge for drug discovery. In the last three decades, the number of FDA approved drugs has dropped down and this led to increasing interest in drug reposition or repurposing. The present review focuses on recent concepts and therapeutic opportunities for the utilization of antidiabetics, antibiotics, antifungal, anti-inflammatory, antipsychotic, PDE inhibitors and estrogen receptor antagonist, Antabuse, antiparasitic and cardiovascular agents/drugs as an alternative approach against human malignancies. The repurposing of approved non-cancerous drugs is an effective strategy to develop new therapeutic options for the treatment of cancer patients at an affordable cost in clinics. In the current scenario, most of the countries throughout the globe are unable to meet the medical needs of cancer patients because of the high cost of the available cancerous drugs. Some of these drugs displayed potential anti-cancer activity in preclinic and clinical studies by regulating several key molecular mechanisms and oncogenic pathways in human malignancies. The emerging pieces of evidence indicate that repurposing of drugs is crucial to the faster and cheaper discovery of anti-cancerous drugs.


Assuntos
Antineoplásicos/uso terapêutico , Descoberta de Drogas , Reposicionamento de Medicamentos/métodos , Neoplasias/tratamento farmacológico , Preparações Farmacêuticas/administração & dosagem , Animais , Humanos
8.
Trop Anim Health Prod ; 53(2): 322, 2021 May 14.
Artigo em Inglês | MEDLINE | ID: mdl-33988782

RESUMO

Bovine tuberculosis is an economically important disease with very high zoonotic potential. Single intradermal cervical tuberculin test (SICT) is considered a gold standard assay for the diagnosis of bovine tuberculosis. However, bovines especially buffaloes may produce a false negative result when the animal becomes cell-mediated immune (CMI) anergic in the advanced stage of the disease. In the present study, ELISA and PCR assays were successfully demonstrated to be useful in diagnosing tuberculosis especially in the CMI anergic buffaloes infected with Mycobacterium bovis. ELISA and PCR assays are able to detect 8.94% and 8.13%, respectively, more animals as positive in comparison to standard SICT assay in a selected population of 123 buffaloes. The moderate agreement between SICT and ELISA (k: 0.528; 0.249-0.807), a substantial agreement between SICT and PCR (k: 0.648; 0.364-0.931), and high agreement between ELISA and PCR (k: 0.856; 0.697-1.0) highlight that ELISA and PCR, if used in parallel with SICT, will provide better sensitivity over single assay. Reduction of false negative reactors may help in minimizing the zoonotic threat from bovine tuberculosis especially in disease endemic region where human and livestock interface is quite high.


Assuntos
Doenças dos Bovinos , Mycobacterium bovis , Tuberculose Bovina , Tuberculose , Animais , Búfalos , Bovinos , Ensaio de Imunoadsorção Enzimática/veterinária , Reação em Cadeia da Polimerase/veterinária , Sensibilidade e Especificidade , Tuberculina , Teste Tuberculínico/veterinária , Tuberculose/diagnóstico , Tuberculose/veterinária , Tuberculose Bovina/diagnóstico
9.
PLoS Pathog ; 13(10): e1006681, 2017 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-29045464

RESUMO

HIV1-TAT interactive protein (TIP60) is a haploinsufficient tumor suppressor. However, the potential mechanisms endowing its tumor suppressor ability remain incompletely understood. It plays a vital role in virus-induced cancers where TIP60 down-regulates the expression of human papillomavirus (HPV) oncoprotein E6 which in turn destabilizes TIP60. This intrigued us to identify the role of TIP60, in the context of a viral infection, where it is targeted by oncoproteins. Through an array of molecular biology techniques such as Chromatin immunoprecipitation, expression analysis and mass spectrometry, we establish the hitherto unknown role of TIP60 in repressing the expression of the catalytic subunit of the human telomerase complex, TERT, a key driver for immortalization. TIP60 acetylates Sp1 at K639, thus inhibiting Sp1 binding to the TERT promoter. We identified that TIP60-mediated growth suppression of HPV-induced cervical cancer is mediated in part due to TERT repression through Sp1 acetylation. In summary, our study has identified a novel substrate for TIP60 catalytic activity and a unique repressive mechanism acting at the TERT promoter in virus-induced malignancies.


Assuntos
Regulação Enzimológica da Expressão Gênica , Regulação Neoplásica da Expressão Gênica , Histona Acetiltransferases/metabolismo , Proteínas de Neoplasias/metabolismo , Elementos de Resposta , Fator de Transcrição Sp1/metabolismo , Telomerase/biossíntese , Neoplasias do Colo do Útero/metabolismo , Feminino , Células HeLa , Histona Acetiltransferases/genética , Humanos , Lisina Acetiltransferase 5 , Proteínas de Neoplasias/genética , Fator de Transcrição Sp1/genética , Telomerase/genética , Neoplasias do Colo do Útero/genética
10.
Biotechnol Appl Biochem ; 65(3): 397-406, 2018 May.
Artigo em Inglês | MEDLINE | ID: mdl-28795444

RESUMO

Aflatoxin M1 (AFM1) is present in milk of lactating animals fed on aflatoxin B1 contaminated feeds. Aptamers are new emerging ligand molecules and can be employed in assay protocols. Shorter aptamers have several advantages. Untruncated (72-nucleotide long) and truncated (18- to 42-nucleotide long) aptamers were evaluated for AFM1 recognition that was detected by color change in aptamer-conjugated gold nanoparticles in the presence of AFM1. Truncation of 10 aptamers was designed to retain motifs. Untruncated and truncated aptamers recognized AFM1. Binding region on truncated aptamers was predicted by aligning sequences with reported aptamer "ACTGCTAGAGATTTTCCACAT". Aptamer "AFAS3Tr" (ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGA), APM15Tr (CAACGCCAGTCAGTATCTTATATGCTATACTGGCTGGTGTTG), AFA4Tr (AAAA-ACACTATGTAGTGGTGT), AFAM7Tr (CCGGCGGATGCTAATTGCAGAGCAGGTGTGCCGG), and APM6Tr (AAAAATAATTCTAGGTTA) derived from random region of oligonucleotide library had strong homology with 8-nucleotide (ACTGCTAG) sequence at 5' end of reported aptamer. Comparison of sequence alignment of each of five truncated aptamers with reported sequence has allowed concluding that CTGCTCTGACGCTG in AFAS3Tr, ACGCCAG in APM15Tr, ACTATGTAG in AFA4Tr, TGCTA in AFAM7Tr, AATTCTAG in APM6Tr, and ACTGCTAG in reported aptamer are probable binding regions in aptamers. Truncated aptamers APM15Tr, AFAS3Tr, AFAM7Tr, APM6Tr, AFA4Tr, and predicted shorter nucleotide sequences offer promise for further exploitation in developing sensitive methods for AFM1 measurement.


Assuntos
Aflatoxina M1/análise , Oligonucleotídeos/química , Aflatoxina M1/administração & dosagem , Animais , Sequência de Bases , Humanos , Camundongos
11.
J Antimicrob Chemother ; 72(11): 3117-3121, 2017 Nov 01.
Artigo em Inglês | MEDLINE | ID: mdl-28961864

RESUMO

BACKGROUND: Novel drug discovery against non-tuberculous mycobacteria is beset with a large number of challenges including the existence of myriad innate drug resistance mechanisms as well as a lack of suitable animal models, which hinders effective translation. In order to identify molecules acting via novel mechanisms of action, we screened the Library of Pharmacologically Active Compounds against non-tuberculous mycobacteria to identify such compounds. METHODS: Whole-cell growth inhibition assays were used to screen and identify novel inhibitors. The hit compounds were tested for cytotoxicity against Vero cells to determine the selectivity index, and time-kill kinetics were determined against Mycobacterium fortuitum. The compound's ability to synergize with amikacin, ceftriaxone, ceftazidime and meropenem was determined using fractional inhibitory concentration indexes followed by its ability to decimate mycobacterial infections ex vivo. Finally, the in vivo potential was determined in a neutropenic murine model mimicking mycobacterial infection. RESULTS: We have identified diphenyleneiodonium chloride (DPIC), an NADPH/NADH oxidase inhibitor, as possessing potent antimicrobial activity against non-tuberculous mycobacteria. DPIC exhibited concentration-dependent bactericidal activity against M. fortuitum and synergized with amikacin, ceftriaxone, ceftazidime and meropenem. When tested in a murine neutropenic M. fortuitum infection model, DPIC caused a significant reduction in bacterial load in kidney and spleen. The reduction in bacterial count is comparable to amikacin at a 100-fold lower concentration. CONCLUSIONS: DPIC exhibits all properties to be repositioned as a novel anti-mycobacterial therapy and possesses a potentially new mechanism of action. Thus, it can be projected as a potential new therapeutic against ever-increasing non-tuberculous mycobacterial infections.


Assuntos
Antibacterianos/farmacologia , Antibacterianos/uso terapêutico , Infecções por Mycobacterium não Tuberculosas/tratamento farmacológico , Micobactérias não Tuberculosas/efeitos dos fármacos , Oniocompostos/farmacologia , Oniocompostos/uso terapêutico , Amicacina/farmacologia , Animais , Carga Bacteriana/efeitos dos fármacos , Chlorocebus aethiops , Modelos Animais de Doenças , Descoberta de Drogas , Cinética , Meropeném , Camundongos , Testes de Sensibilidade Microbiana , Infecções por Mycobacterium não Tuberculosas/microbiologia , Neutropenia , Micobactérias não Tuberculosas/crescimento & desenvolvimento , Oniocompostos/administração & dosagem , Bibliotecas de Moléculas Pequenas , Tienamicinas/farmacologia , Células Vero
12.
Drug Discov Today ; 29(10): 104140, 2024 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-39168403

RESUMO

Glioblastoma multiforme (GBM) is a highly severe primary brain tumor. Despite extensive research, effective treatments remain elusive. Long noncoding RNAs (lncRNAs) play a significant role in both cancer and normal biology. They influence alternative splicing (AS), which is crucial in cancer. Advances in lncRNA-specific microarrays and next-generation sequencing have enhanced understanding of AS. Abnormal AS contributes to cancer invasion, metastasis, apoptosis, therapeutic resistance, and tumor development, including glioma. lncRNA-mediated AS affects several cellular signaling pathways, promoting or suppressing cancer malignancy. This review discusses the lncRNAs regulating AS in glioblastoma and their mechanisms.


Assuntos
Processamento Alternativo , Neoplasias Encefálicas , Glioblastoma , RNA Longo não Codificante , Humanos , Glioblastoma/genética , Glioblastoma/patologia , RNA Longo não Codificante/genética , RNA Longo não Codificante/metabolismo , Processamento Alternativo/genética , Neoplasias Encefálicas/genética , Neoplasias Encefálicas/patologia , Animais , Regulação Neoplásica da Expressão Gênica
13.
Biochim Biophys Acta Gene Regul Mech ; 1867(2): 195017, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38341138

RESUMO

Alternative splicing (AS) is a fundamental post-transcriptional process in eukaryotes, enabling a single gene to generate diverse mRNA transcripts, thereby enhancing protein variability. This process involves the excision of introns and the joining of exons in pre-mRNA(s) to form mature mRNA. The resulting mature mRNAs exhibit various combinations of exons, contributing to functional diversity. Dysregulation of AS can substantially modulate protein functions, impacting the onset and progression of numerous diseases, including cancer. Non-coding RNAs (ncRNAs) are distinct from protein-coding RNAs and consist of short and long types. Long non-coding RNAs (lncRNAs) play an important role in regulating several cellular processes, particularly alternative splicing, according to new research. This review provides insight into the latest discoveries concerning how lncRNAs influence alternative splicing within the realm of breast cancer. Additionally, it explores potential therapeutic strategies focused on targeting lncRNAs.


Assuntos
Processamento Alternativo , Neoplasias da Mama , Regulação Neoplásica da Expressão Gênica , RNA Longo não Codificante , RNA Longo não Codificante/genética , RNA Longo não Codificante/metabolismo , Humanos , Neoplasias da Mama/genética , Feminino
14.
Front Immunol ; 15: 1302163, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38515752

RESUMO

Mechanistic understanding of antibiotic persistence is a prerequisite in controlling the emergence of MDR cases in Tuberculosis (TB). We have reported that the cholesterol-induced activation of VapC12 ribonuclease is critical for disease persistence in TB. In this study, we observed that relative to the wild type, mice infected with ΔvapC12 induced a pro-inflammatory response, had a higher pathogen load, and responded better to the anti-TB treatment. In a high-dose infection model, all the mice infected with ΔvapC12 succumbed early to the disease. Finally, we reported that the above phenotype of ΔvapC12 was dependent on the presence of the TLR4 receptor. Overall, the data suggests that failure of a timely resolution of the early inflammation by the ΔvapC12 infected mice led to hyperinflammation, altered T-cell response and high bacterial load. In conclusion, our findings suggest the role of the VapC12 toxin in modulating the innate immune response of the host in ways that favor the long-term survival of the pathogen inside the host.


Assuntos
Mycobacterium tuberculosis , Ribonucleases , Tuberculose , Animais , Camundongos , Imunidade Inata , Mycobacterium tuberculosis/genética , Mycobacterium tuberculosis/patogenicidade , Fenótipo , Toxinas Biológicas , Tuberculose/imunologia , Tuberculose/metabolismo , Ribonucleases/genética , Ribonucleases/metabolismo
15.
Adv Biol (Weinh) ; 8(1): e2300349, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-37786307

RESUMO

Solubilizing extracellular matrix (ECM) materials and transforming them into hydrogels has expanded their potential applications both in vitro and in vivo. In this study, hydrogels are prepared by decellularization of human placental tissue using detergent and enzymes and by the subsequent creation of a homogenized acellular placental tissue powder (P-ECM). A perfusion-based decellularization approach is employed using detergent and enzymes. The P-ECM with and without gamma irradiation is then utilized to prepare P-ECM hydrogels. Physical and biological evaluations are conducted to assess the suitability of the P-ECM hydrogels for biocompatibility. The decellularized tissue has significantly reduced cellular content and retains the major ECM proteins. Increasing the concentration of P-ECM leads to improved mechanical properties of the P-ECM hydrogels. The biocompatibility of the P-ECM hydrogel is demonstrated through cell proliferation and viability assays. Notably, gamma-sterilized P-ECM does not support the formation of a stable hydrogel. Nonetheless, the use of HCl during the digestion process effectively decreases spore growth and bacterial bioburden. The study demonstrates that P-ECM hydrogels exhibit physical and biological attributes conducive to soft tissue reconstruction. These hydrogels establish a favorable microenvironment for cell growth and the need for investigating innovative sterilization methods.


Assuntos
Detergentes , Hidrogéis , Feminino , Gravidez , Humanos , Hidrogéis/farmacologia , Detergentes/metabolismo , Placenta , Matriz Extracelular/metabolismo , Bioensaio
16.
Biochimie ; 219: 74-83, 2024 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-37619809

RESUMO

Glioblastoma (GBM) is the most aggressive and frequent type of primary brain cancer in adult patients. One of the key molecular features associated with GBM pathogenesis is the dysfunction of PTEN oncosuppressor. In addition to PTEN gene, humans and several primates possess processed PTEN pseudogene (PTENP1) that gives rise to long non-coding RNA lncPTENP1-S. Regulation and functions of PTEN and PTENP1 are highly interconnected, however, the exact molecular mechanism of how these two genes affect each other remains unclear. Here, we analyzed the methylation level of the CpG islands (CpGIs) in the promoter regions of PTEN and PTENP1 in patient-derived GBM neurospheres. We found that increased PTEN methylation corelates with decreased PTEN mRNA level. Unexpectedly, we showed the opposite trend for PTENP1. Using targeted methylation and demethylation of PTENP1 CpGI, we demonstrated that DNA methylation increases lncPTENP1-S expression in the presence of wild type PTEN protein but decreases lncPTENP1-S expression if PTEN protein is absent. Further experiments revealed that PTEN protein binds to PTENP1 promoter region and inhibits lncPTENP1-S expression if its CpGI is demethylated. Interestingly, we did not detect any effect of lncPTENP1-S on the level of PTEN mRNA, indicating that in GBM cells PTENP1 is a downstream target of PTEN rather than its upstream regulator. Finally, we studied the functions of lncPTENP1-S and demonstrated that it plays a pro-oncogenic role in GBM cells by upregulating the expression of cancer stem cell markers and decreasing cell adhesion.


Assuntos
Glioblastoma , MicroRNAs , Adulto , Animais , Humanos , MicroRNAs/metabolismo , PTEN Fosfo-Hidrolase/genética , PTEN Fosfo-Hidrolase/metabolismo , Pseudogenes , Metilação de DNA , Glioblastoma/genética , RNA Mensageiro/genética , RNA Mensageiro/metabolismo
17.
Elife ; 122024 Apr 09.
Artigo em Inglês | MEDLINE | ID: mdl-38593125

RESUMO

Inflammation in ulcerative colitis is typically restricted to the mucosal layer of distal gut. Disrupted mucus barrier, coupled with microbial dysbiosis, has been reported to occur prior to the onset of inflammation. Here, we show the involvement of vesicular trafficking protein Rab7 in regulating the colonic mucus system. We identified a lowered Rab7 expression in goblet cells of colon during human and murine colitis. In vivo Rab7 knocked down mice (Rab7KD) displayed a compromised mucus layer, increased microbial permeability, and depleted gut microbiota with enhanced susceptibility to dextran sodium-sulfate induced colitis. These abnormalities emerged owing to altered mucus composition, as revealed by mucus proteomics, with increased expression of mucin protease chloride channel accessory 1 (CLCA1). Mechanistically, Rab7 maintained optimal CLCA1 levels by controlling its lysosomal degradation, a process that was dysregulated during colitis. Overall, our work establishes a role for Rab7-dependent control of CLCA1 secretion required for maintaining mucosal homeostasis.


Assuntos
Colite , Células Caliciformes , Animais , Humanos , Camundongos , Canais de Cloreto/genética , Canais de Cloreto/metabolismo , Colite/induzido quimicamente , Colite/metabolismo , Colo/metabolismo , Modelos Animais de Doenças , Células Caliciformes/metabolismo , Homeostase , Inflamação/metabolismo , Mucosa Intestinal/metabolismo , Camundongos Endogâmicos C57BL
18.
Tuberculosis (Edinb) ; 145: 102477, 2024 03.
Artigo em Inglês | MEDLINE | ID: mdl-38211498

RESUMO

Mycobacterium tuberculosis (Mtb) has evolved sophisticated surveillance mechanisms to neutralize the ROS-induces toxicity which otherwise would degrade a variety of biological molecules including proteins, nucleic acids and lipids. In the present study, we find that Mtb lacking the Rv0495c gene (ΔRv0495c) is presented with a highly oxidized cytosolic environment. The superoxide-induced lipid peroxidation resulted in altered colony morphology and loss of membrane integrity in ΔRv0495c. As a consequence, ΔRv0495c demonstrated enhanced susceptibility when exposed to various host-induced stress conditions. Further, as expected, we observed a mutant-specific increase in the abundance of transcripts that encode proteins involved in antioxidant defence. Surprisingly, despite showing a growth defect phenotype in macrophages, the absence of the Rv0495c enhanced the pathogenicity and augmented the ability of the Mtb to grow inside the host. Additionally, our study revealed that Rv0495c-mediated immunomodulation by the pathogen helps create a favorable niche for long-term survival of Mtb inside the host. In summary, the current study underscores the fact that the truce in the war between the host and the pathogen favours long-term disease persistence in tuberculosis. We believe targeting Rv0495c could potentially be explored as a strategy to potentiate the current anti-TB regimen.


Assuntos
Mycobacterium tuberculosis , Tuberculose , Humanos , Proteínas de Bactérias/metabolismo , Tuberculose/microbiologia , Oxirredução , Homeostase/fisiologia
19.
Front Pharmacol ; 14: 1244597, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37711177

RESUMO

Breast cancer is the most common malignancy in women worldwide and despite significant advancements in detection, treatment, and management of cancer, it is still the leading cause of malignancy related deaths in women. Understanding the fundamental biology of breast cancer and creating fresh diagnostic and therapeutic strategies have gained renewed focus in recent studies. In the onset and spread of breast cancer, a group of enzymes known as kinases are extremely important. Small-molecule kinase inhibitors have become a promising class of medications for the treatment of breast cancer owing to their capacity to specifically target kinases involved in the growth and progression of cancer. The creation of targeted treatments that block these kinases and the signalling pathways that they activate has completely changed how breast cancer is treated. Many of these targeted treatments have been approved for the treatment of breast cancer as clinical trials have demonstrated their great efficacy. CDK4/6 inhibitors, like palbociclib, abemaciclib, and ribociclib, EGFR inhibitors such as gefitinib and erlotinib and HER2-targeting small-molecule kinases like neratinib and tucatinib are some examples that have shown potential in treating breast cancer. Yet, there are still difficulties in the development of targeted medicines for breast cancer, such as figuring out which patient subgroups may benefit from these therapies and dealing with drug resistance problems. Notwithstanding these difficulties, kinase-targeted treatments for breast cancer still have a lot of potential. The development of tailored medicines will continue to be fuelled by the identification of novel targets and biomarkers for breast cancer as a result of advancements in genomic and proteomic technology.

20.
Res Microbiol ; 174(7): 104082, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37244349

RESUMO

Transcription factors (TFs) of Mycobacterium tuberculosis (Mtb), an etiological agent of tuberculosis, regulate a network of pathways that help prolong the survival of Mtb inside the host. In this study, we have characterized a transcription repressor gene (mce3R) from the TetR family, that encodes for Mce3R protein in Mtb. We demonstrated that the mce3R gene is dispensable for the growth of Mtb on cholesterol. Gene expression analysis suggests that the transcription of genes belonging to the mce3R regulon is independent of the carbon source. We found that, in comparison to the wild type, the mce3R deleted strain (Δmce3R) generated more intracellular ROS and demonstrated reduced susceptibility to oxidative stress. Total lipid analysis suggests that mce3R regulon encoded proteins modulate the biosynthesis of cell wall lipids in Mtb. Interestingly, the absence of Mce3R increased the frequency of generation of antibiotic persisters in Mtb and imparted in-vivo growth advantage phenotype in guinea pigs. In conclusion, genes belonging to the mce3R regulon modulate the frequency of generation of persisters in Mtb. Hence, targeting mce3R regulon encoded proteins could potentiate the current regimen by eliminating persisters during Mtb infection.

SELEÇÃO DE REFERÊNCIAS
Detalhe da pesquisa