Multiple wheat genomes reveal global variation in modern breeding.

Advances in genomics have expedited the improvement of several agriculturally important crops but similar efforts in wheat (Triticum spp.) have been more challenging. This is largely owing to the size and complexity of the wheat genome1, and the lack of genome-assembly data for multiple wheat lines2,3. Here we generated ten chromosome pseudomolecule and five scaffold assemblies of hexaploid wheat to explore the genomic diversity among wheat lines from global breeding programs. Comparative analysis revealed extensive structural rearrangements, introgressions from wild relatives and differences in gene content resulting from complex breeding histories aimed at improving adaptation to diverse environments, grain yield and quality, and resistance to stresses4,5. We provide examples outlining the utility of these genomes, including a detailed multi-genome-derived nucleotide-binding leucine-rich repeat protein repertoire involved in disease resistance and the characterization of Sm16, a gene associated with insect resistance. These genome assemblies will provide a basis for functional gene discovery and breeding to deliver the next generation of modern wheat cultivars.

An autoactive NB-LRR gene causes Rht13 dwarfism in wheat.

Semidwarfing genes have greatly increased wheat yields globally, yet the widely used gibberellin (GA)-insensitive genes Rht-B1b and Rht-D1b have disadvantages for seedling emergence. Use of the GA-sensitive semidwarfing gene Rht13 avoids this pleiotropic effect. Here, we show that Rht13 encodes a nucleotide-binding site/leucine-rich repeat (NB-LRR) gene. A point mutation in the semidwarf Rht-B13b allele autoactivates the NB-LRR gene and causes a height reduction comparable with Rht-B1b and Rht-D1b in diverse genetic backgrounds. The autoactive Rht-B13b allele leads to transcriptional up-regulation of pathogenesis-related genes including class III peroxidases associated with cell wall remodeling. Rht13 represents a new class of reduced height (Rht) gene, unlike other Rht genes, which encode components of the GA signaling or metabolic pathways. This discovery opens avenues to use autoactive NB-LRR genes as semidwarfing genes in a range of crop species, and to apply Rht13 in wheat breeding programs using a perfect genetic marker.

Copy number variation of TdDof controls solid-stemmed architecture in wheat.

Stem solidness is an important agronomic trait of durum (Triticum turgidum L. var. durum) and bread (Triticum aestivum L.) wheat that provides resistance to the wheat stem sawfly. This dominant trait is conferred by the SSt1 locus on chromosome 3B. However, the molecular identity and mechanisms underpinning stem solidness have not been identified. Here, we demonstrate that copy number variation of TdDof, a gene encoding a putative DNA binding with one finger protein, controls the stem solidness trait in wheat. Using map-based cloning, we localized TdDof to within a physical interval of 2.1 Mb inside the SSt1 locus. Molecular analysis revealed that hollow-stemmed wheat cultivars such as Kronos carry a single copy of TdDof, whereas solid-stemmed cultivars such as CDC Fortitude carry multiple identical copies of the gene. Deletion of all TdDof copies from CDC Fortitude resulted in the loss of stem solidness, whereas the transgenic overexpression of TdDof restored stem solidness in the TdDof deletion mutant pithless1 and conferred stem solidness in Kronos. In solid-stemmed cultivars, increased TdDof expression was correlated with the down-regulation of genes whose orthologs have been implicated in programmed cell death (PCD) in other species. Anatomical and histochemical analyses revealed that hollow-stemmed lines had stronger PCD-associated signals in the pith cells compared to solid-stemmed lines, which suggests copy number-dependent expression of TdDof could be directly or indirectly involved in the negative regulation of PCD. These findings provide opportunities to manipulate stem development in wheat and other monocots for agricultural or industrial purposes.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

De Novo Genome Assembly of the Japanese Wheat Cultivar Norin 61 Highlights Functional Variation in Flowering Time and Fusarium-Resistant Genes in East Asian Genotypes.

Bread wheat is a major crop that has long been the focus of basic and breeding research. Assembly of its genome has been difficult because of its large size and allohexaploid nature (AABBDD genome). Following the first reported assembly of the genome of the experimental strain Chinese Spring (CS), the 10+ Wheat Genomes Project was launched to produce multiple assemblies of worldwide modern cultivars. The only Asian cultivar in the project is Norin 61, a representative Japanese cultivar adapted to grow across a broad latitudinal range, mostly characterized by a wet climate and a short growing season. Here, we characterize the key aspects of its chromosome-scale genome assembly spanning 15 Gb with a raw scaffold N50 of 22 Mb. Analysis of the repetitive elements identified chromosomal regions unique to Norin 61 that encompass a tandem array of the pathogenesis-related 13 family. We report novel copy-number variations in the B homeolog of the florigen gene FT1/VRN3, pseudogenization of its D homeolog and the association of its A homeologous alleles with the spring/winter growth habit. Furthermore, the Norin 61 genome carries typical East Asian functional variants different from CS, ranging from a single nucleotide to multi-Mb scale. Examples of such variation are the Fhb1 locus, which confers Fusarium head-blight resistance, Ppd-D1a, which confers early flowering, Glu-D1f for Asian noodle quality and Rht-D1b, which introduced semi-dwarfism during the green revolution. The adoption of Norin 61 as a reference assembly for functional and evolutionary studies will enable comprehensive characterization of the underexploited Asian bread wheat diversity.

Genomic prediction of agronomic traits in wheat using different models and cross-validation designs.

KEY MESSAGE: Genomic predictions across environments and within populations resulted in moderate to high accuracies but across-population genomic prediction should not be considered in wheat for small population size. Genomic selection (GS) is a marker-based selection suggested to improve the genetic gain of quantitative traits in plant breeding programs. We evaluated the effects of training population (TP) composition, cross-validation design, and genetic relationship between the training and breeding populations on the accuracy of GS in spring wheat (Triticum aestivum L.). Two populations of 231 and 304 spring hexaploid wheat lines that were phenotyped for six agronomic traits and genotyped with the wheat 90 K array were used to assess the accuracy of seven GS models (RR-BLUP, G-BLUP, BayesB, BL, RKHS, GS + de novo GWAS, and reaction norm) using different cross-validation designs. BayesB outperformed the other models for within-population genomic predictions in the presence of few quantitative trait loci (QTL) with large effects. However, including fixed-effect marker covariates gave better performance for an across-population prediction when the same QTL underlie traits in both populations. The accuracy of prediction was highly variable based on the cross-validation design, which suggests the importance to use a design that resembles the variation within a breeding program. Moderate to high accuracies were obtained when predictions were made within populations. In contrast, across-population genomic prediction accuracies were very low, suggesting that the evaluated models are not suitable for prediction across independent populations. On the other hand, across-environment prediction and forward prediction designs using the reaction norm model resulted in moderate to high accuracies, suggesting that GS can be applied in wheat to predict the performance of newly developed lines and lines in incomplete field trials.

The Aegilops ventricosa 2NvS segment in bread wheat: cytology, genomics and breeding.

KEY MESSAGE: The first cytological characterization of the 2NvS segment in hexaploid wheat; complete de novo assembly and annotation of 2NvS segment; 2NvS frequency is increasing 2NvS and is associated with higher yield. The Aegilops ventricosa 2NvS translocation segment has been utilized in breeding disease-resistant wheat crops since the early 1990s. This segment is known to possess several important resistance genes against multiple wheat diseases including root knot nematode, stripe rust, leaf rust and stem rust. More recently, this segment has been associated with resistance to wheat blast, an emerging and devastating wheat disease in South America and Asia. To date, full characterization of the segment including its size, gene content and its association with grain yield is lacking. Here, we present a complete cytological and physical characterization of this agronomically important translocation in bread wheat. We de novo assembled the 2NvS segment in two wheat varieties, 'Jagger' and 'CDC Stanley,' and delineated the segment to be approximately 33 Mb. A total of 535 high-confidence genes were annotated within the 2NvS region, with > 10% belonging to the nucleotide-binding leucine-rich repeat (NLR) gene families. Identification of groups of NLR genes that are potentially N genome-specific and expressed in specific tissues can fast-track testing of candidate genes playing roles in various disease resistances. We also show the increasing frequency of 2NvS among spring and winter wheat breeding programs over two and a half decades, and the positive impact of 2NvS on wheat grain yield based on historical datasets. The significance of the 2NvS segment in wheat breeding due to resistance to multiple diseases and a positive impact on yield highlights the importance of understanding and characterizing the wheat pan-genome for better insights into molecular breeding for wheat improvement.

Fusarium Head Blight in Durum Wheat: Recent Status, Breeding Directions, and Future Research Prospects.

Fusarium head blight (FHB) is a major fungal disease affecting wheat production worldwide. Since the early 1990s, FHB, caused primarily by Fusarium graminearum, has become one of the most significant diseases faced by wheat producers in Canada and the United States. The increasing FHB problem is likely due to the increased adoption of conservation tillage practices, expansion of maize production, use of susceptible wheat varieties in rotation, and climate variability. Durum wheat (Triticum turgidum sp. durum) is notorious for its extreme susceptibility to FHB and breeding for resistance is complicated because sources of FHB resistance are rare in the primary gene pool of tetraploid wheat. Losses due to this disease include yield, test weight, seed quality, food and feed quality, and when severe, market access. More importantly, it is the contamination with mycotoxins, such as deoxynivalenol, in Fusarium-infected durum kernels that causes the most serious economic as well as food and feed safety concerns. Several studies and thorough reviews have been published on germplasm development and breeding for FHB resistance and the genetics and genomics of FHB resistance in bread or common wheat (T. aestivum); however, similar reviews have not been conducted in durum wheat. Thus, the aim of this review is to summarize and discuss the recent research efforts to mitigate FHB in durum wheat, including quantitative trait locus mapping, genome-wide association studies, genomic prediction, mutagenesis and characterization of genes and pathways involved in FHB resistance. It also highlights future directions, FHB-resistant germplasm, and the potential role of morphological traits to enhance FHB resistance in durum wheat.

Whole genome sequencing and comparative genomics of closely related Fusarium Head Blight fungi: Fusarium graminearum, F. meridionale and F. asiaticum.

BACKGROUND: The Fusarium graminearum species complex is composed of many distinct fungal species that cause several diseases in economically important crops, including Fusarium Head Blight of wheat. Despite being closely related, these species and individuals within species have distinct phenotypic differences in toxin production and pathogenicity, with some isolates reported as non-pathogenic on certain hosts. In this report, we compare genomes and gene content of six new isolates from the species complex, including the first available genomes of F. asiaticum and F. meridionale, with four other genomes reported in previous studies. RESULTS: A comparison of genome structure and gene content revealed a 93-99% overlap across all ten genomes. We identified more than 700 k base pairs (kb) of single nucleotide polymorphisms (SNPs), insertions, and deletions (indels) within common regions of the genome, which validated the species and genetic populations reported within species. We constructed a non-redundant pan gene list containing 15,297 genes from the ten genomes and among them 1827 genes or 12% were absent in at least one genome. These genes were co-localized in telomeric regions and select regions within chromosomes with a corresponding increase in SNPs and indels. Many are also predicted to encode for proteins involved in secondary metabolism and other functions associated with disease. Genes that were common between isolates contained high levels of nucleotide variation and may be pseudogenes, allelic, or under diversifying selection. CONCLUSIONS: The genomic resources we have contributed will be useful for the identification of genes that contribute to the phenotypic variation and niche specialization that have been reported among members of the F. graminearum species complex.

Leucine metabolism regulates TRI6 expression and affects deoxynivalenol production and virulence in Fusarium graminearum.

TRI6 is a positive regulator of the trichothecene gene cluster and the production of trichothecene mycotoxins [deoxynivalenol (DON)] and acetylated forms such as 15-Acetyl-DON) in the cereal pathogen Fusarium graminearum. As a global transcriptional regulator, TRI6 expression is modulated by nitrogen-limiting conditions, sources of nitrogen and carbon, pH and light. However, the mechanism by which these diverse environmental factors affect TRI6 expression remains underexplored. In our effort to understand how nutrients affect TRI6 regulation, comparative digital expression profiling was performed with a wild-type F. graminearum and a Δtri6 mutant strain, grown in nutrient-rich conditions. Analysis showed that TRI6 negatively regulates genes of the branched-chain amino acid (BCAA) metabolic pathway. Feeding studies with deletion mutants of MCC, encoding methylcrotonyl-CoA-carboxylase, one of the key enzymes of leucine metabolism, showed that addition of leucine specifically down-regulated TRI6 expression and reduced 15-ADON accumulation. Constitutive expression of TRI6 in the Δmcc mutant strain restored 15-ADON production. A combination of cellophane breach assays and pathogenicity experiments on wheat demonstrated that disrupting the leucine metabolic pathway significantly reduced disease. These findings suggest a complex interaction between one of the primary metabolic pathways with a global regulator of mycotoxin biosynthesis and virulence in F. graminearum.

Intraspecies Interaction of Fusarium graminearum Contributes to Reduced Toxin Production and Virulence.

Fusarium graminearum is a pathogenic fungus that causes Fusarium head blight in wheat and lowers the yield and quality of grains by contamination with the trichothecene mycotoxin deoxynivalenol. The fungi coexist and interact with several different fusaria as well as other plant pathogenic fungi and bacteria in the field. In Canada, F. graminearum exists as two main trichothecene chemotypes: 3-acetyldeoxynivalenol and 15-acetyldeoxynivalenol. To understand the potential interactions between two isolates of these chemotypes, we conducted coinoculation studies both in culture and in planta. The studies showed that intraspecies interaction reduces trichothecene yield in culture and disease symptoms in wheat. To elucidate the genes involved in the intraspecies interaction, expression profiling was performed on RNA samples isolated from coinoculated cultures, and potential genes were identified by using the genome sequences of the respective isolates.

Draft genome sequence of Enterobacter sp. from wheat grain.

Here, we report the draft genome sequence of an isolate from the Enterobacter cloacae species complex. Enterobacter spp. are plant growth-promoting microbes and biocontrol agents. Analyses of this genome will serve as a useful resource for future studies of similar microbes isolated from grain.

Comparative secretome analysis of Fusarium graminearum and two of its non-pathogenic mutants upon deoxynivalenol induction in vitro.

To understand early events in plant-pathogen interactions, it is necessary to explore the pathogen secretome to identify secreted proteins that help orchestrate pathology. The secretome can be obtained from pathogens grown in vitro, and then characterized using standard proteomic approaches based on protein extraction and subsequent identification of tryptic peptides by LC-MS. A subset of the secretome is composed of proteins whose presence is required to initiate infection and their removal from the secretome would result in pathogens with reduced or no virulence. We present here comparative secretome from Fusarium graminearum. This filamentous fungus causes Fusarium head blight on wheat, a serious cereal disease found in many cereal-growing regions. Affected grain is contaminated with mycotoxins and cannot be used for food or feed. We used label-free quantitative MS to compare the secretomes of wild-type with two nonpathogenic deletion mutants of F. graminearum, Δtri6, and Δtri10. These mutations in mycotoxin-regulating transcription factors revealed a subset of 29 proteins whose relative abundance was affected in their secretomes, as measured by spectral counting. Proteins that decreased in abundance are potential candidate virulence factors and these included cell wall-degrading enzymes, metabolic enzymes, pathogenesis-related proteins, and proteins of unknown function.

Tri6 is a global transcription regulator in the phytopathogen Fusarium graminearum.

In F. graminearum, the transcriptional regulator Tri6 is encoded within the trichothecene gene cluster and regulates genes involved in the biosynthesis of the secondary metabolite deoxynivalenol (DON). The Tri6 protein with its Cys2His2 zinc-finger may also conform to the class of global transcription regulators. This class of global transcriptional regulators mediate various environmental cues and generally responds to the demands of cellular metabolism. To address this issue directly, we sought to find gene targets of Tri6 in F. graminearum grown in optimal nutrient conditions. Chromatin immunoprecipitation followed by Illumina sequencing (ChIP-Seq) revealed that in addition to identifying six genes within the trichothecene gene cluster, Tri1, Tri3, Tri6, Tri7, Tri12 and Tri14, the ChIP-Seq also identified 192 additional targets potentially regulated by Tri6. Functional classification revealed that, among the annotated genes, ∼40% are associated with cellular metabolism and transport and the rest of the target genes fall into the category of signal transduction and gene expression regulation. ChIP-Seq data also revealed Tri6 has the highest affinity toward its own promoter, suggesting that this gene could be subject to self-regulation. Electro mobility shift assays (EMSA) performed on the promoter of Tri6 with purified Tri6 protein identified a minimum binding motif of GTGA repeats as a consensus sequence. Finally, expression profiling of F. graminearum grown under nitrogen-limiting conditions revealed that 49 out of 198 target genes are differentially regulated by Tri6. The identification of potential new targets together with deciphering novel binding sites for Tri6, casts new light into the role of this transcriptional regulator in the overall growth and development of F. graminearum.

Artificial Intelligence: A Promising Tool in Exploring the Phytomicrobiome in Managing Disease and Promoting Plant Health.

There is increasing interest in harnessing the microbiome to improve cropping systems. With the availability of high-throughput and low-cost sequencing technologies, gathering microbiome data is becoming more routine. However, the analysis of microbiome data is challenged by the size and complexity of the data, and the incomplete nature of many microbiome databases. Further, to bring microbiome data value, it often needs to be analyzed in conjunction with other complex data that impact on crop health and disease management, such as plant genotype and environmental factors. Artificial intelligence (AI), boosted through deep learning (DL), has achieved significant breakthroughs and is a powerful tool for managing large complex datasets such as the interplay between the microbiome, crop plants, and their environment. In this review, we aim to provide readers with a brief introduction to AI techniques, and we introduce how AI has been applied to areas of microbiome sequencing taxonomy, the functional annotation for microbiome sequences, associating the microbiome community with host traits, designing synthetic communities, genomic selection, field phenotyping, and disease forecasting. At the end of this review, we proposed further efforts that are required to fully exploit the power of AI in studying phytomicrobiomes.

Unraveling Plant-Pathogen Interactions in Cereals Using RNA-seq.

Over the past two decades, there have been significant advancements in the realm of transcriptomics, or the study of genes and their expression. Modern RNA sequencing technologies and high-performance computing are creating a "big data" revolution that provides new opportunities to explore the interactions between cereals and pathogens that affect grain yield and food safety. These data are being used to annotate genes and gene variants, as well as identify differentially expressed genes and create global gene co-expression networks. Moreover, these data can unravel the complex interactions between pathogen and host and identify genes and pathways involved in these interactions. This information can then be used for disease mitigation and the development of crops with superior resistance.

Wheat doubled haploids have a marked prevalence of chromosomal aberrations.

Double haploid (DH) population development is widely used in many crops, including wheat (Triticum aestivum L.), to rapidly produce fixed germplasm for breeding and genetic studies. The genome shock that takes place during DH induction could induce chromosomal aberrations that can impact genome integrity and subsequently plant fitness and agronomic performance. To evaluate the extent of chromosomal aberrations that exist as a result of the DH process, we studied two wheat DH populations: CDC Stanley×CDC Landmark and KS13H9×SYMonument. We utilized high-throughput skim sequencing to construct digital karyotypes of these populations to quantify deletions and aneuploidy with high resolution and accuracy, which was confirmed in selected plants by cytological analysis. The two populations studied showed high proportion of abnormal primary DH lines, 55 and 45%, respectively, based on at least one abnormality per progeny. The chromosomal abnormalities are genetically unstable and were observed segregating in the subsequent generations. These observations have important implications for the use of DH lines in genetics and breeding.

Corrigendum: A survey of Fusarium species and ADON genotype on Canadian wheat grain.

[This corrects the article DOI: 10.3389/ffunb.2022.1062444.].

Transposable Element Populations Shed Light on the Evolutionary History of Wheat and the Complex Co-Evolution of Autonomous and Non-Autonomous Retrotransposons.

Wheat has one of the largest and most repetitive genomes among major crop plants, containing over 85% transposable elements (TEs). TEs populate genomes much in the way that individuals populate ecosystems, diversifying into different lineages, sub-families and sub-populations. The recent availability of high-quality, chromosome-scale genome sequences from ten wheat lines enables a detailed analysis how TEs evolved in allohexaploid wheat, its diploids progenitors, and in various chromosomal haplotype segments. LTR retrotransposon families evolved into distinct sub-populations and sub-families that were active in waves lasting several hundred thousand years. Furthermore, It is shown that different retrotransposon sub-families were active in the three wheat sub-genomes, making them useful markers to study and date polyploidization events and chromosomal rearrangements. Additionally, haplotype-specific TE sub-families are used to characterize chromosomal introgressions in different wheat lines. Additionally, populations of non-autonomous TEs co-evolved over millions of years with their autonomous partners, leading to complex systems with multiple types of autonomous, semi-autonomous and non-autonomous elements. Phylogenetic and TE population analyses revealed the relationships between non-autonomous elements and their mobilizing autonomous partners. TE population analysis provided insights into genome evolution of allohexaploid wheat and genetic diversity of species, and may have implication for future crop breeding.

A survey of Fusarium species and ADON genotype on Canadian wheat grain.

Introduction: Wheat is a staple food that is important to global food security, but in epidemic years, fungal pathogens can threaten production, quality, and safety of wheat grain. Globally, one of the most important fungal diseases of wheat is Fusarium head blight (FHB). This disease can be caused by several different Fusarium species with known differences in aggressiveness and mycotoxin-production potential, with the trichothecene toxin deoxynivalenol (DON) and its derivatives being of particular concern. In North America, the most predominant species causing FHB is F. graminearum, which has two distinct sub-populations that are commonly classified into two main chemotypes/genotypes based on their propensity to form trichothecene derivatives, namely 15-acetyldeoxynivalenol (15-ADON) and 3-acetyldeoxynivalenol (3-ADON). Materials and methods: We used a panel of 13 DNA markers to perform species and ADON genotype identification for 55, 444 wheat kernels from 7, 783 samples originating from across Canada from 2014 to 2020. Results and discussion: Based on single-seed analyses, we demonstrate the relationships between Fusarium species and trichothecene chemotype with sample year, sample location, wheat species (hexaploid and durum wheat), severity of Fusarium damaged kernels (FDK), and accumulation of DON. Results indicate that various Fusarium species are present across wheat growing regions in Canada; however, F. graminearum is the most common species and 3-ADON the most common genotype. We observed an increase in the occurrence of the 3-ADON genotype, particularly in the western Prairie regions. Our data provides important information on special-temporal trends in Fusarium species and chemotypes that can aid with the implementation of integrated disease management strategies to control the detrimental effects of this devastating disease.