Induction of endogenous Bcl-xS through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides.

Resistance to apoptosis, which plays an important role in tumors that are refractory to chemotherapy, is regulated by the ratio of antiapoptotic to proapoptotic proteins. By manipulating levels of these proteins, cells can become sensitized to undergo apoptosis in response to chemotherapeutic agents. Alternative splicing of the bcl-x gene gives rise to two proteins with antagonistic functions: Bcl-xL, a well-characterized antiapoptotic protein, and Bcl-xS, a proapoptotic protein. We show here that altering the ratio of Bcl-xL to Bcl-xS in the cell using an antisense oligonucleotide permitted cells to be sensitized to undergo apoptosis in response to ultraviolet B radiation and chemotherapeutic drug treatment. These results demonstrate the ability of a chemically modified oligonucleotide to alter splice site selection in an endogenous gene and illustrate a powerful tool to regulate cell survival.

Effects of RNA secondary structure on cellular antisense activity.

The secondary and tertiary structures of a mRNA are known to effect hybridization efficiency and potency of antisense oligonucleotides in vitro. Additional factors including oligonucleotide stability and cellular uptake are also thought to contribute to antisense potency in vivo. Each of these factors can be affected by the sequence of the oligonucleotide. Although mRNA structure is presumed to be a critical determinant of antisense activity in cells, to date little direct experimental evidence has addressed the significance of structure. In order to determine the importance of mRNA structure on antisense activity, oligonucleotide target sites were cloned into a luciferase reporter gene along with adjoining sequence to form known structures. This allowed us to study the effect of target secondary structure on oligonucleotide binding in the cellular environment without changing the sequence of the oligonucleotide. Our results show that structure does play a significant role in determining oligonucleotide efficacy in vivo. We also show that potency of oligonucleotides can be improved by altering chemistry to increase affinity for the mRNA target even in a region that is highly structured.

Fully modified 2' MOE oligonucleotides redirect polyadenylation.

Many genes have been described and characterized that have alternative polyadenylation signals at the 3'-end of their pre-mRNAs. Many of these same messages also contain destabilization motifs responsible for rapid degradation of the mRNA. Polyadenylation site selection can thus determine the stability of an mRNA. Fully modified 2'-O:-methoxy ethyl/phosphorothioate oligonucleotides that hybridize to the 3'-most polyadenylation site or signal of E-selectin were able to inhibit polyadenylation at this site and redirect it to one of two upstream cryptic sites. The shorter transcripts produced after antisense treatment have fewer destabilization sequences, increased mRNA stability and altered protein expression. This study demonstrates that antisense oligonucleotides can be successfully employed to redirect polyadenylation. This is the first demonstration of the use of oligonucleotides to increase, rather than decrease, abundance of a message.

Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity.

Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent.

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

Strategies for rapid deconvolution of combinational libraries: comparative evaluation using a model system.

Synthesis and testing of complex mixtures maximize the number of compounds that can be prepared and tested in a combinatorial library. When mixtures of compounds are screened, however, the identity of the compound(s) selected may depend on the deconvolution procedure employed. Previously, we developed a model system for evaluation of deconvolution procedures and used it to compare pooling strategies for iterative and noniterative deconvolution [Freier et al. J. Med. Chem. 1995, 38, 344-352]. We have now extended the model studies to include simulations of procedures with overlapping subsets such as subtractive pooling [Carell et al. Angew, Chem., Int. Ed. Engl. 1994, 33, 2061-2064], bogus coin pooling [Blake and Litzi-Davis. Bioconjugate Chem. 1992, 3, 510-513], and orthogonal pooling [D'Prez et al. J. Am. Chem. Soc. 1995, 117, 5405-5406]. These strategies required synthesis and testing of fewer subsets than did the more traditional nonoverlapping iterative strategies. The compounds identified using simulations of these strategies, however, were not the most active compounds in the library and were substantially less active than those identified by simulations of more traditional strategies.

Deconvolution of combinatorial libraries for Drug discovery: theoretical comparison of pooling strategies.

Synthesis and testing of mixtures of compounds in a combinatorial library allow much greater throughput than synthesis and testing of individual compounds. When mixtures of compounds are screened, however, the possibility exists that the most active compound will not be identified. The specific strategies employed for pooling and deconvolution will affect the likelihood of success. We have used a nucleic acid hybridization example to develop a theoretical model of library deconvolution for a library of more than 250,000 compounds. This model was used to compare various strategies for pooling and deconvolution. Simulations were performed in the absence and presence of experimental error. We found iterative deconvolution to be most reliable when active molecules were assigned to the same subset in early rounds. Reliability was reduced only slightly when active molecules were assigned randomly to all subsets. Iterative deconvolution with as many as 65,536 compounds per subset did not drastically reduce the reliability compared to one-at-a-time testing. Pooling strategies compared using this theoretical model are compared experimentally in an accompanying paper.

Deconvolution of combinatorial libraries for drug discovery: a model system.

Iterative synthesis and screening strategies have recently been used to identify unique active molecules from complex synthetic combinatorial libraries. These techniques have many advantages over traditional screening methods, including the potential to screen large numbers of compounds to identify an active molecule while avoiding analytical separations and structural determination of unknown compounds. It is not clear, however, whether these techniques identify the most active molecular species in the mixtures and, if so, how often. Two key factors which may affect success of the selection process are the presence of many active compounds in the library with a range of activities and the chosen order of unrandomization. The importance of these factors has not been previously studied. Moreover, the impact of experimental errors in determination of subset activities or in randomization during library synthesis is not known. We describe here a model system based on oligonucleotide hybridization that addresses these questions using computer simulations. The results suggested that, within achievable experimental and library synthesis error, iterative deconvolution methods generally find either the best molecule or one with activity very close to the best. The presence of many active compounds in a library influenced the profile of subset activities, but did not preclude selection of a molecule with near optimal activity.

Deconvolution of combinatorial libraries for drug discovery: experimental comparison of pooling strategies.

An experimental evaluation of several different pooling strategies for combinatorial libraries was conducted using a library of 810 compounds and an enzyme inhibition assay (phospholipase A2). The library contained compounds with varying degrees of activity as well as inactive compounds. The compounds were synthesized in groups of three and pooled together in various formats to realize different pooling strategies. With one exception, all iterative deconvolution strategies and position scanning resulted in identification of the same compound. The results are in good agreement with the predicted outcome from theoretical and computational methods. These data support the tenet that active compounds for pharmaceutically relevant targets can be successfully identified from combinatorial libraries organized in mixtures.

Structure-activity relationships of novel 2-substituted quinazoline antibacterial agents.

High-throughput screening of in-house compound libraries led to the discovery of a novel antibacterial agent, compound 1 (MIC: 12-25 microM against S. pyogenes). In an effort to improve the activity of this active compound, a series of 2-substituted quinazolines was synthesized and evaluated in several antibacterial assays. One such compound (22) displayed improved broad-spectrum antibacterial activity against a variety of bacterial strains. This molecule also inhibited transcription/translation of bacterial RNA, suggesting a mechanism for its antibiotic effects. Structure-activity relationship studies of 22 led to the synthesis of another 24 compounds. Although some of these molecules were found to be active in bacterial growth assays, none were as potent as 22. Compound 22 was tested for its ability to cure a systemic K. pneumonia infection in the mouse and displayed moderate effects compared with a control antibiotic, gentamycin.

Synthesis and purification of large amounts of RNA oligonucleotides.

Biophysical studies of RNA oligonucleotides require milligram amounts of RNA of specific length and sequence. Transcription from synthetic DNA templates using T7 RNA polymerase is a convenient method for synthesis of RNA oligonucleotides ranging in size from 9 to about 45 nucleotides. Here we present methods that make the large-scale synthesis of RNA oligonucleotides practical. This paper describes a rapid method for isolating T7 RNA polymerase free from RNases for use in transcription reactions. Protocols are also described for purification of the desired RNA oligonucleotide from the other products of transcription.

Potent and specific inhibition of HIV envelope-mediated cell fusion and virus binding by G quartet-forming oligonucleotide (ISIS 5320).

We have previously reported identification of a phosphorothioate oligonucleotide TTGGGGTT (ISIS 5320) as a potent inhibitor of HIV infection in vitro. The oligonucleotide forms a parallel-stranded, tetrameric guanosine quartet (G-quartet) structure that specifically binds to the HIV envelope glycoprotein (gp120) and inhibits both cell-to-cell and virus-to-cell infection at submicromolar concentrations. In the current study we demonstrate that the tetramer inhibits the infection of laboratory-derived isolates of HIV-1 and HIV-2 in a variety of phenotypically distinct, established human cell lines and a panel of biologically diverse clinical isolates in fresh human peripheral blood lymphocytes and macrophages. The compound was also active against all drug-resistant virus isolates tested. In combination with AZT, ISIS 5320 exhibits additive to slightly synergistic anti-HIV activity. Cell-based mechanism of action studies demonstrate that the compound inhibits the binding of infectious virus and virus-infected cells to uninfected target cells by binding to the cationic V3 loop of the envelope glycoprotein. The G-quartet structure is a potential candidate for use in anti-HIV chemotherapy.

Cost utility of the multichannel cochlear implants in 258 profoundly deaf individuals.

Cost utility analysis is a method of cost-effectiveness analysis which provides results in terms of cost per quality-adjusted life-year (QALY). Cost utility for the multichannel cochlear implant was calculated using Ontario Health Utilities Index data from 229 Nucleus 22-channel implant users and 32 cochlear implant candidates awaiting surgery. The health utility of the implanted group was greater than that of the candidate group by 0.204 (P<.0001). Use of this figure in a cost utility calculation indicates that cochlear implantation costs approximately $15,928 per QALY provided. Sensitivity analysis, a technique which systematically varies the assumptions underlying the calculations, suggests a range for the true value of between $12,000 and $30,000. This compares very favorably with other medical interventions. It is concluded that profound hearing loss has a significant effect on quality of life, and measurement of the changes that result from cochlear implant use indicates that this technology provides significant improvements and is quite cost-effective.

Recent trends in utilization of procedures in otolaryngology-head and neck surgery.

The development of minimally invasive techniques and increasing performance of surgery in outpatient settings have had a major influence on otolaryngology-head and neck surgery (OLHNS), but little is known about the extent to which these forces have affected the overall distribution and total rate of performance of OLHNS procedures. The aims of this study were to determine whether there has been a change in the total number of people undergoing OLHNS procedures between 1989 and 1992 in Maryland and to identify those procedures for which there has been a significant change in utilization. Data were obtained on 171,579 patients undergoing OLHNS procedures between 1989 and 1992 in Maryland's nonfederal, acute care hospitals, hospital-based outpatient centers, and freestanding multispecialty surgical centers. Age-adjusted annual surgical rates were calculated by direct standardization using 1990 Maryland census data, and changes in rates over time were examined using linear regression. From 1989 to 1992, there was no significant change in the total age-adjusted annual rate of performance of the most commonly performed OLHNS procedures (P>0.05), yet there was a significant increase (P<0.05) in the rates of ethmoidectomy from 37/100,000 to 73/100,000, intranasal antrotomy from 25/100,000 to 44/100,000, and septoplasty from 70/100,000 to 89/100,000, and a significant decrease (P>0.05) in the rate of rhinoplasty from 44/100,000 to 36/100,000. The data show an annual average decrease in inpatient surgery of 5.2% (P=0.006), and a corresponding increase in outpatient surgery of 5.1% (P=0.005). Maryland surgery rates for commonly performed procedures in OLHNS remained stable overall, except for an increase in sinus surgery and septoplasty rates and a decrease in rhinoplasty rates.

Cost-effectiveness of the diagnostic evaluation of vertigo.

OBJECTIVE: To evaluate the cost-effectiveness of several diagnostic tests used in the evaluation of vertigo. STUDY DESIGN: Cost-effectiveness analysis, using data from retrospective case review. METHODS: Charts and test results were reviewed from 192 outpatients seen in an academic tertiary referral center for evaluation of vertigo. Cost-effectiveness analysis was performed using decision analysis software, data from office and hospital charges, and expert-based estimations of the utility of different test outcomes. Sensitivity analysis was performed using standard algorithms and wide variable ranges. RESULTS: We found that audiologic testing, posturography, and electronystagmography were the most cost-effective tests, and that magnetic resonance imaging and blood tests had the lowest cost-effectiveness. The analysis was sensitive to the effects of financial costs of tests but, with a few exceptions, was typically not sensitive to the utility of test outcomes or the distribution of test results. CONCLUSIONS: The use of cost-effectiveness analysis, the estimation of utility of test outcomes, and techniques of sensitivity analysis should help guide the clinician's decision making on appropriate testing for patients with vertigo.

Trends in educational placement and cost-benefit considerations in children with cochlear implants.

OBJECTIVES: To study the effect of cochlear implantation on the use of educational resources by profoundly hearing-impaired children and to determine trends in educational cost vs benefit. DESIGN: Retrospective study and cost-benefit analysis. SETTING: Outpatient pediatric cochlear implant program in an academic institution (The Listening Center at Johns Hopkins University School of Medicine, Baltimore, Md), in collaboration with public schools in Maryland and surrounding states. PATIENTS OR OTHER PARTICIPANTS: School-aged children with profound prelingual hearing impairment without other clearly defined disabilities. Thirty-five children with multiple-channel cochlear prostheses and a comparison group of 10 children without implants from 'total communication' programs in the Maryland public school system. INTERVENTIONS: Multiple-channel cochlear implantation and at least 1 year of a systematic auditory skill development program at the Listening Center, compared with standard educational management of children with conventional amplification. MAIN OUTCOME MEASURES: Classroom placement and number of hours of special educational support used. RESULTS: A correlation was observed between the length of cochlear implant experience and the rate of full-time placement in mainstream classrooms (r = 0.10; P= .04). There was also a negative correlation between the length of implant experience and the number of hours of special educational support used by fully mainstreamed children (Pearson product moment correlation = -0.10; P = .03). Children with greater than 2 years of implant experience were mainstreamed at twice the rate or more of age-matched children with profound hearing loss who did not have implants. They were also placed less frequently in self-contained classrooms and used fewer hours of special education support. A cost-benefit analysis based on conservative estimates of educational expenses from kindergarten to 12th grade shows a cost savings of cochlear implantation and appropriate auditory (re)habilitation that ranges from $30000 to $200000. CONCLUSIONS: Cochlear implantation accompanied by aural (re)habilitation increases access to acoustic information of spoken language, leading to higher rates of mainstream placement in schools and lower dependence on special education support services. The cost savings that results from a decrease in the use of support services indicates an educational cost benefit of cochlear implant (re)habilitation for many children.

A prospective study of the cost-utility of the multichannel cochlear implant.

CONTEXT: Prior clinical studies have indicated that cochlear implantation provides benefits to individuals with advanced sensorineural hearing loss who are unable to gain effective speech recognition with hearing aids. OBJECTIVE: To determine the cost per quality-adjusted life-year (QALY) for adults receiving multichannel cochlear implants. DESIGN: Prospective 12-month multicenter study using preference-based quality-of-life measures and total cost determinations, comparing profoundly hearing-impaired adult subjects with and without cochlear implants. SETTING: Hospital-based and patient-resource clinics. PATIENTS: Severely to profoundly hearing-impaired adult recipients of a cochlear implant and adults eligible for the device who had not yet received it. MAIN OUTCOME MEASURE: Clinical assessment of implant participants included medical and audiologic (speech understanding) data at the time of enrollment, 6 months, and 12 months. All participants' health-utility was assessed at the time of enrollment, 6 months, and 12 months using the Health Utility Index. One-year medical resource utilization and cost data included bills related to implants, patient diaries, charge estimates from clinical sites, and published literature. A decision model was developed to determine cost per QALY. RESULTS: Of the 84 enrolled adults, 62 (75%) completed the study. Mean health-utility scores at the time of enrollment were identical between groups. The marginal 12-month health-utility gain for implant recipients was 0.20; 90% of this improvement was achieved within 6 months. For patients with a mean 22-year life expectancy, the marginal cost per QALY was $14,670. CONCLUSIONS: Overall, multichannel cochlear implants significantly improved recipients' performance on measures of speech understanding and ratings of health-utility within 6 months of implantation. The multichannel cochlear implant yielded a very favorable cost per QALY.

A model of educational resource use by children with cochlear implants.

We have tracked patterns of use of educational and rehabilitative resources as part of an initial assessment of cost-benefit ratios of cochlear implants in children. Forty-two children with cochlear implants in the Listening Center at Johns Hopkins program of aural rehabilitation have served as our study cohort to develop the measures to be assessed. An educational resource matrix stratifies school setting (residential vs special education vs non-specialized "mainstream" setting) and levels of rehabilitative support (speech and language therapy and interpreter use) to map past and current use of these services. Initial cost-benefit projections based on observed advancement toward educational independence in the educational resource matrix indicate an extremely favorable net present value of the implant (cost savings minus cost). These cost-benefit projections will need to be supplemented with measures of the impact on quality of life and future educational and vocational options to determine the overall cost-effectiveness of cochlear implants in children.