Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 269
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
Proc Natl Acad Sci U S A ; 121(42): e2406936121, 2024 Oct 15.
Artigo em Inglês | MEDLINE | ID: mdl-39388269

RESUMO

Kirsten rat sarcoma virus (KRAS) mutation is associated with malignant tumor transformation and drug resistance. However, the development of clinically effective targeted therapies for KRAS-mutant cancer has proven to be a formidable challenge. Here, we report that tripartite motif-containing protein 21 (TRIM21) functions as a target of extracellular signal-regulated kinase 2 (ERK2) in KRAS-mutant colorectal cancer (CRC), contributing to regorafenib therapy resistance. Mechanistically, TRIM21 directly interacts with and ubiquitinates v-myc avian myelocytomatosis viral oncogene homolog (c-Myc) at lysine 148 (K148) via K63-linkage, enabling c-Myc to be targeted to the autophagy machinery for degradation, ultimately resulting in the downregulation of enolase 2 expression and inhibition of glycolysis. However, mutant KRAS (KRAS/MT)-driven mitogen-activated protein kinase (MAPK) signaling leads to the phosphorylation of TRIM21 (p-TRIM21) at Threonine 396 (T396) by ERK2, disrupting the interaction between TRIM21 and c-Myc and thereby preventing c-Myc from targeting autophagy for degradation. This enhances glycolysis and contributes to regorafenib resistance. Clinically, high p-TRIM21 (T396) is associated with an unfavorable prognosis. Targeting TRIM21 to disrupt KRAS/MT-driven phosphorylation using the antidepressant vilazodone shows potential for enhancing the efficacy of regorafenib in treating KRAS-mutant CRC in preclinical models. These findings are instrumental for KRAS-mutant CRC treatment aiming at activating TRIM21-mediated selective autophagic degradation of c-Myc.


Assuntos
Autofagia , Neoplasias Colorretais , Compostos de Fenilureia , Proteínas Proto-Oncogênicas c-myc , Proteínas Proto-Oncogênicas p21(ras) , Piridinas , Ribonucleoproteínas , Neoplasias Colorretais/tratamento farmacológico , Neoplasias Colorretais/metabolismo , Neoplasias Colorretais/genética , Neoplasias Colorretais/patologia , Humanos , Autofagia/efeitos dos fármacos , Compostos de Fenilureia/farmacologia , Animais , Proteínas Proto-Oncogênicas p21(ras)/metabolismo , Proteínas Proto-Oncogênicas p21(ras)/genética , Piridinas/farmacologia , Proteínas Proto-Oncogênicas c-myc/metabolismo , Proteínas Proto-Oncogênicas c-myc/genética , Camundongos , Ribonucleoproteínas/metabolismo , Ribonucleoproteínas/genética , Linhagem Celular Tumoral , Resistencia a Medicamentos Antineoplásicos , Ensaios Antitumorais Modelo de Xenoenxerto , Proteólise/efeitos dos fármacos , Mutação , Camundongos Nus
2.
Langmuir ; 40(18): 9717-9724, 2024 May 07.
Artigo em Inglês | MEDLINE | ID: mdl-38712354

RESUMO

Connectivity isomerization of the same aromatic molecular core with different substitution positions profoundly affects electron transport pathways and single-molecule conductance. Herein, we designed and synthesized all connectivity isomers of a thiophene (TP) aromatic ring substituted by two dihydrobenzo[b]thiophene (BT) groups with ethynyl spacers (m,n-TP-BT, (m,n = 2,3; 2,4; 2,5; 3,4)), to systematically probe how connectivity contributes to single-molecule conductance. Single-molecule conductance measurements using a scanning tunneling microscopy break junction (STM-BJ) technique show ∼12-fold change in conductance values, which follow an order of 10-4.83 G0 (2,4-TP-BT) < 10-4.78 G0 (3,4-TP-BT) < 10-4.06 G0 (2,3-TP-BT) < 10-3.75 G0 (2,5-TP-BT). Electronic structure analysis and theoretical simulations show that the connectivity isomerization significantly changes electron delocalization and HOMO-LUMO energy gaps. Moreover, the connectivity-dependent molecular structures lead to different quantum interference (QI) effects in electron transport, e.g., a strong destructive QI near E = EF leads the smallest conductance value for 2,4-TP-BT. This work proves a clear relationship between the connectivity isomerization and single-molecule conductance of thiophene heterocyclic molecular junctions for the future design of molecular devices.

3.
Helicobacter ; 29(1): e13039, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38036941

RESUMO

BACKGROUND: Recent clinical trials have evaluated the efficacy of vonoprazan-amoxicillin (VA) dual therapy as the first-line treatment for Helicobacter pylori infection in different regions with inconsistent results reported. In this systematic review and meta-analysis, we aimed to evaluate the efficacy of VA dual therapy compared to the currently recommended therapy for eradicating H. pylori. MATERIALS AND METHODS: A comprehensive search of the PubMed, Cochrane, and Embase databases was performed using the following search terms: ("Helicobacter" OR "H. pylori" OR "Hp") AND ("vonoprazan" OR "potassium-competitive acid blocker" OR "P-CAB") AND ("amoxicillin" OR "penicillin") AND ("dual"). The primary outcome was to evaluate the eradication rate according to intention-to-treat and per-protocol analysis. The secondary outcomes were adverse events and compliance. RESULTS: A total of 15 studies involving 4, 568 patients were included. The pooled eradication rate of VA dual therapy was 85.0% and 90.0% by intention-to-treat and per-protocol analysis, respectively. The adverse events rate and compliance of VA dual therapy were 17.5% and 96%, respectively. The efficacy of VA dual therapy was superior to proton pump inhibitors-based triple therapy (82.0% vs. 71.4%, p < 0.01) but lower than vonoprazan-containing quadruple therapy (83.1% vs. 93.3%, p = 0.02). 7-day VA dual therapy showed lower eradication rates than 10-day (χ2 = 24.09, p < 0.01) and 14-day VA dual therapy (χ2 = 11.87, p < 0.01). The adverse events rate of VA dual therapy was lower than vonoprazan triple therapy (24.6% vs. 30.9%, p = 0.01) and bismuth-containing quadruple therapy (20.5% vs. 47.9%, p < 0.01). No significant difference of compliance was observed between VA dual therapy and each subgroup. CONCLUSION: VA dual therapy, a novel regimen, showed high efficacy as the first-line treatment for H. pylori eradication, which should be optimized before application in different regions.


Assuntos
Infecções por Helicobacter , Helicobacter pylori , Humanos , Amoxicilina , Antibacterianos/uso terapêutico , Quimioterapia Combinada , Infecções por Helicobacter/tratamento farmacológico , Inibidores da Bomba de Prótons , Resultado do Tratamento
4.
Environ Geochem Health ; 46(11): 445, 2024 Sep 24.
Artigo em Inglês | MEDLINE | ID: mdl-39316158

RESUMO

Soil contamination of heavy metals in urban greenspaces can exert detrimental impacts on ecological biodiversity and the health of inhabitants through cross-media migration-induced risks. Here, a total of 72 topsoil samples were collected from greenspaces in the popular tourist city of Tianshui, ranging from areas with parks, residential, road, industrial and educational soils. The study aimed to evaluate an integrated source-specific ecological and human health risk assessment of heavy metals. Among the analyzed heavy metals, except Cr (mean), all exceeded the local background values by 1.30-5.67-fold, and Hg, Cd, Pb and As were the metals with large CV values. The Igeo and CF results showed Hg, Cd, As and Pb exhibited significantly high pollution levels and were the primary pollution factors. The mean PLI values indicated moderate pollution in educational (2.21), industrial (2.07), and road (2.02) soils but slight pollution in park (1.84) and residential (1.39) greenspaces. The Igeo, CF, and PLI results also revealing that these heavy metals are more likely to be affected by human activity. Four primary source factors were identified based on PMF model: coal combustion (25.57%), agricultural sources (14.49%), atmospheric deposition (20.44%) and mixed sources (39.50%). In terms of ecological risk, the mean IRI values showed considerable risks in educational soils (287.52) and moderate risks in road (215.09), park (151.27) and residential (136.71) soils. And the contribution ratio of atmospheric deposition for park, residential, road, industrial and educational greenspaces were 57.72%, 65.41%, 67.69%, 59.60% and 75.76%, respectively. In terms of human health risk, the HI (below 1) and CR (below 1.00E-04) for adults from soils of all land use types was negligible. However, children have more significant non-carcinogenic and carcinogenic hazards especially in residential soils, the HI (above 1) and CR (above 1.00E-04) revealed the significance of regarding legacy As contamination from coal combustion when formulating risk mitigation strategies in this area. The proposed method for source and risk identification makes the multifaceted concerns of pollution and the different relevant risks into a concrete decision-making process, providing robust support for soil contamination control.


Assuntos
Cidades , Metais Pesados , Poluentes do Solo , Metais Pesados/análise , China , Humanos , Poluentes do Solo/análise , Medição de Risco , Monitoramento Ambiental
5.
Angew Chem Int Ed Engl ; : e202414867, 2024 Oct 08.
Artigo em Inglês | MEDLINE | ID: mdl-39377463

RESUMO

The recent discovery of frustrated Lewis pairs (FLPs) during the activation of small molecules has inspired extensive research across the full span of chemical science. Owing to the nature of weak interactions, it is experimentally challenging to directly observe and modulate FLP at the molecular scale. Here we design a boron cluster anion building block (B10H82-) and organic amine cations ([NR4]+, R= -CH3, -C2H5) as the FLP to prove the feasibility of controlling their interaction in the electric double layer (EDL) via an electrochemical strategy. In situ single-molecule electrical measurements and Raman monitoring of B10H82--[NR4]+ FLP formed at the positively charged Au(111) electrode surface, in contrast to the free-standing B10H82- near or below the potential of zero charge (PZC). Furthermore, this FLP chemistry leads to a shift in the local density of states of boron clusters towards the EF for enhancing electron transport, providing a new prototype of a reversible single-cluster switch that digitally switches upon controlling FLP chemistry in the electric double layer.

6.
Skeletal Radiol ; 2023 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-37712982

RESUMO

We reported a case of atypical spinal tuberculosis on the posterior elements of lumbar spine in a 52-year-old female. It was easy to be misdiagnosed as spinal tumor due to its imaging characteristics. We performed puncture biopsy to initially consider tuberculosis, and then the patient was accepted surgical treatment. The intraoperative removed specimen was sent to pathological examination, microbial culture, Xpert MTB/RIF and metagenomic next-generation sequencing (mNGS) and then the diagnosis of neural arch tuberculosis was confirmed. After operation, the patient obtained stable effect by anti-tuberculosis drug treatment. In a word, the uncommon case had an important reference significance for the diagnosis of atypical spine tuberculosis and differentiation from spinal tumors. It is critical to make right preliminary diagnosis by appropriate examination as it determined the next diagnosis and treatment in special and rare clinical cases.

7.
Artigo em Inglês | MEDLINE | ID: mdl-37661517

RESUMO

BACKGROUND: Primary non-function (PNF) and early allograft failure (EAF) after liver transplantation (LT) seriously affect patient outcomes. In clinical practice, effective prognostic tools for early identifying recipients at high risk of PNF and EAF were urgently needed. Recently, the Model for Early Allograft Function (MEAF), PNF score by King's College (King-PNF) and Balance-and-Risk-Lactate (BAR-Lac) score were developed to assess the risks of PNF and EAF. This study aimed to externally validate and compare the prognostic performance of these three scores for predicting PNF and EAF. METHODS: A retrospective study included 720 patients with primary LT between January 2015 and December 2020. MEAF, King-PNF and BAR-Lac scores were compared using receiver operating characteristic (ROC) and the net reclassification improvement (NRI) and integrated discrimination improvement (IDI) analyses. RESULTS: Of all 720 patients, 28 (3.9%) developed PNF and 67 (9.3%) developed EAF in 3 months. The overall early allograft dysfunction (EAD) rate was 39.0%. The 3-month patient mortality was 8.6% while 1-year graft-failure-free survival was 89.2%. The median MEAF, King-PNF and BAR-Lac scores were 5.0 (3.5-6.3), -2.1 (-2.6 to -1.2), and 5.0 (2.0-11.0), respectively. For predicting PNF, MEAF and King-PNF scores had excellent area under curves (AUCs) of 0.871 and 0.891, superior to BAR-Lac (AUC = 0.830). The NRI and IDI analyses confirmed that King-PNF score had the best performance in predicting PNF while MEAF served as a better predictor of EAD. The EAF risk curve and 1-year graft-failure-free survival curve showed that King-PNF was superior to MEAF and BAR-Lac scores for stratifying the risk of EAF. CONCLUSIONS: MEAF, King-PNF and BAR-Lac were validated as practical and effective risk assessment tools of PNF. King-PNF score outperformed MEAF and BAR-Lac in predicting PNF and EAF within 6 months. BAR-Lac score had a huge advantage in the prediction for PNF without post-transplant variables. Proper use of these scores will help early identify PNF, standardize grading of EAF and reasonably select clinical endpoints in relative studies.

8.
Anal Chem ; 94(3): 1823-1830, 2022 Jan 25.
Artigo em Inglês | MEDLINE | ID: mdl-35020360

RESUMO

Room-temperature ionic liquids (RTILs) emerged as ideal solvents, and bipyridine as one of the most used ligands have been widely employed in surface science, catalysis, and molecular electronics. Herein, in situ shell-isolated nanoparticle-enhanced Raman spectroscopy (SHINERS) and STM break junction (STM-BJ) technique has been employed to probe the electrochemical process of bipyridine at Au(111)/IL interfaces. It is interestingly found that these molecules undertake a redox process with a pair of well-defined reversible peaks in cyclic voltammograms (CVs). The spectroscopic evidence shows a radical cation generated with rising new Raman peaks related to parallel CC stretching of a positively charged pyridyl ring. Furthermore, these electrochemically charged bipyridine is also confirmed by electrochemical STM-BJ at the single-molecule level, which displays a binary conductance switch ratio of about 400% at the redox potentials. This present work offers a molecular-level insight into the pyridine-mediated reaction process and electron transport in RTILs.

9.
J Transl Med ; 20(1): 461, 2022 10 08.
Artigo em Inglês | MEDLINE | ID: mdl-36209172

RESUMO

Abdominal aortic aneurysm (AAA) represents the serious vascular degenerative disorder, which causes high incidence and mortality. Alpha-ketoglutarate (AKG), a crucial metabolite in the tricarboxylic acid (TCA) cycle, has been reported to exert significant actions on the oxidative stress and inflammation. However, its role in AAA still remains elusive. Herein, we examined the effects of AKG on the formation of AAA. The study established an elastase-induced mouse abdominal aortic aneurysms model as well as a TNF-α-mediated vascular smooth muscle cells (VSMCs) model, respectively. We displayed that AKG pre-treatment remarkably prevented aneurysmal dilation assessed by diameter and volume and reduced aortic rupture. In addition, it was also observed that AKG treatment suppressed the development of AAA by attenuating the macrophage infiltration, elastin degradation and collagen fibers remodeling. In vitro, AKG potently decreased TNF-α-induced inflammatory cytokines overproduction, more apoptotic cells and excessive superoxide. Mechanistically, we discovered that upregulation of vpo1 in AAA was significantly suppressed by AKG treatment. By exploring the RNA-seq data, we found that AKG ameliorates AAA mostly though inhibiting oxidative stress and the inflammatory response. PXDN overexpression neutralized the inhibitory effects of AKG on ROS generation and inflammatory reaction in MOVAS. Furthermore, AKG treatment suppressed the expression of p-ERK1/2, 3-Cl Tyr in vivo and in vitro. ERK activator disrupted the protective of AKG on TNF-α-induced VSMCs phenotypic switch. Conclusively, AKG can serve as a beneficial therapy for AAA through regulating PXDN/HOCL/ERK signaling pathways.


Assuntos
Aneurisma da Aorta Abdominal , Animais , Aneurisma da Aorta Abdominal/induzido quimicamente , Aneurisma da Aorta Abdominal/tratamento farmacológico , Aneurisma da Aorta Abdominal/metabolismo , Colágeno/metabolismo , Citocinas/metabolismo , Desoxirribonucleosídeos , Modelos Animais de Doenças , Elastina/metabolismo , Inflamação/metabolismo , Ácidos Cetoglutáricos , Sistema de Sinalização das MAP Quinases , Camundongos , Camundongos Endogâmicos C57BL , Músculo Liso Vascular/metabolismo , Miócitos de Músculo Liso/metabolismo , Elastase Pancreática/metabolismo , Nucleosídeos de Purina , Espécies Reativas de Oxigênio/metabolismo , Transdução de Sinais , Superóxidos/metabolismo , Ácidos Tricarboxílicos/metabolismo , Fator de Necrose Tumoral alfa/metabolismo
10.
Langmuir ; 38(19): 6209-6216, 2022 May 17.
Artigo em Inglês | MEDLINE | ID: mdl-35508432

RESUMO

Probing the adlayer structures on an electrode/electrolyte interface is one of the most important tasks in modern electrochemistry for clarifying the electrochemical processes. Herein, we have combined cyclic voltammetry and electrochemical shell-isolated nanoparticle-enhanced Raman spectroscopy techniques to explore the potential-dependent adlayer structures on Au(111) in a room-temperature ionic liquid of 1-butyl-3-methylimidazolium hexafluorophosphate (BMIPF6) without or with pyridine (Py). It is clearly found that the BMI+ cations strongly adsorb on the negatively charged surface with a flat-lying orientation, leaving a little space for Py adsorption. Upon increasing the potentials of the electrode, the variations of Raman band intensities and frequencies reveal that the interaction between the BMI+ cations and the Au surface becomes weak; meanwhile, the Py adsorption becomes strong, and its geometry turns from flat, tilted to vertical. Finally, BMI+ cations desorb and leave plenty of surface sites for Py adsorption in bulk solution, and a N-bonded compact Py adlayer is formed on the very positively charged surface. This causes obvious anodic peaks in cyclic voltammograms, and the peak currents increase with the square root of the scanning rate. The present work provides a fair molecular-level understanding of electrochemical interfaces and molecular adsorption of Py in ionic liquids.

11.
Analyst ; 147(7): 1341-1347, 2022 Mar 28.
Artigo em Inglês | MEDLINE | ID: mdl-35244130

RESUMO

The electroreductive cleavage of carbon-halogen bonds has attracted increasing attention in both electrosynthesis and pollution remediation. Herein, by employing the in situ electrochemical shell-isolated nanoparticle-enhanced Raman spectroscopy (SHINERS) technique, we have successfully investigated the electroreductive dehalogenation process of aryl halides with the thiol group on a smooth Au electrode in aqueous solution at different pH values. The obtained potential-dependent Raman spectra directly reveal a mixture of the reduction products 4,4'-biphenyldithiol (BPDT) and thiophenol (TP). The conversion ratios of the C-Cl and C-Br bonds at pH = 7 are 37% and 55%, respectively. Furthermore, quantitative analysis of the intensity variations of ν(C-Cl), ν(C-Br) and aromatic ν(CC) stretching modes suggests electroreductive dehalogenation via both direct electron transfer reduction and electrocatalytic hydrodehalogenation. Molecular evidence for the C-C cross coupling process through TP reaction with benzene free radical intermediates is found at negative potentials, which leads to the increasing selectivity of biphenyl products.

12.
Hepatology ; 71(1): 148-163, 2020 01.
Artigo em Inglês | MEDLINE | ID: mdl-31155734

RESUMO

The oncogene c-Myc is aberrantly expressed and plays a key role in malignant transformation and progression of hepatocellular carcinoma (HCC). Here, we report that c-Myc is significantly up-regulated by tumor necrosis factor receptor-associated factor 6 (TRAF6), an E3 ubiquitin ligase, in hepatocarcinogenesis. High TRAF6 expression in clinical HCC samples correlates with poor prognosis, and the loss of one copy of the Traf6 gene in Traf6+/- mice significantly impairs liver tumorigenesis. Mechanistically, TRAF6 first interacts with and ubiquitinates histone deacetylase 3 (HDAC3) with K63-linked ubiquitin chains, which leads to the dissociation of HDAC3 from the c-Myc promoter and subsequent acetylation of histone H3 at K9, thereby epigenetically enhancing the mRNA expression of c-Myc. Second, the K63-linked ubiquitination of HDAC3 impairs the HDAC3 interaction with c-Myc and promotes c-Myc protein acetylation, which thereby enhances c-Myc protein stability by inhibiting carboxyl terminus of heat shock cognate 70-kDa-interacting protein-mediated c-Myc ubiquitination and degradation. Importantly, TRAF6/HDAC3/c-Myc signaling is also primed in hepatitis B virus-transgenic mice, unveiling a critical role for a mechanism in inflammation-cancer transition. In clinical specimens, TRAF6 positively correlates with c-Myc at both the mRNA and protein levels, and high TRAF6 and c-Myc expression is associated with an unfavorable prognosis, suggesting that TRAF6 collaborates with c-Myc to promote human hepatocarcinogenesis. Consistently, curbing c-Myc expression by inhibition of TRAF6 activity with a TRAF6 inhibitor peptide or the silencing of c-Myc by small interfering RNA significantly suppressed tumor growth in mice. Conclusion: These findings demonstrate the oncogenic potential of TRAF6 during hepatocarcinogenesis by modulating TRAF6/HDAC3/c-Myc signaling, with potential implications for HCC therapy.


Assuntos
Carcinogênese , Carcinoma Hepatocelular/genética , Genes myc/fisiologia , Histona Desacetilases/fisiologia , Neoplasias Hepáticas/genética , Fator 6 Associado a Receptor de TNF/fisiologia , Animais , Regulação Neoplásica da Expressão Gênica , Humanos , Masculino , Camundongos , Estabilidade Proteica , Células Tumorais Cultivadas
13.
Nanotechnology ; 33(9)2021 Dec 09.
Artigo em Inglês | MEDLINE | ID: mdl-34798622

RESUMO

Quantum interference (QI) in single molecular junctions shows a promising perspective for realizing conceptual nanoelectronics. However, controlling and modulating the QI remains a big challenge. Herein, two-type substituents at different positions ofmeta-linked benzene, namely electron-donating methoxy (-OMe) and electron-withdrawing nitryl (-NO2), are designed and synthesized to investigate the substituent effects on QI. The calculated transmission coefficientsT(E) indicates that -OMe and -NO2could remove the antiresonance and destructive quantum interference (DQI)-induced transmission dips at position 2. -OMe could raise the antiresonance energy at position 4 while -NO2groups removes the DQI features. For substituents at position 5, both of them are nonactive for tuning QI. The conductance measurements by scanning tunneling microscopy break junction show a good agreement with the theoretical prediction. More than two order of magnitude single-molecule conductance on/off ratio could be achieved at the different positions of -NO2substituent groups at room temperature. The present work proves chemical substituents can be used for tuning QI features in single molecular junctions, which provides a feasible way toward realization of high-performance molecular devices.

14.
Neurosurg Rev ; 44(1): 423-434, 2021 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-31897885

RESUMO

To evaluate the surgical outcomes and predictors and the impact of surgical timing of patients who suffered a severe hemorrhagic event from brainstem cavernous malformations (CMs). The clinical data of all patients who underwent surgical treatment after a severe bleeding ictus from brainstem CMs between 2011 and 2017 were retrospectively reviewed. The study population consisted of 61 surgical patients (40, 65.6% female). Surgical times of < 3 weeks, ≥ 3-8 weeks, and > 8 weeks since the last bleeding ictus were observed in 23 (37.7%), 24 (39.3%), and 14 (23.0%) patients, respectively. The mean modified Rankin scale (mRS) score evaluated on admission was 4.2. With a mean follow-up of 39.8 months, 39 patients (63.9%) had a favorable outcome (mRS ≤ 2), and the mean mRS score was 2.3. The logistic regression analysis identified age, having disrupted consciousness and/or respiration, and time to surgery from last hemorrhage as significant predictors of long-term outcome. In particular, patients with surgery performed during the acute period (< 3 weeks, P = 0.06) or chronic period (> 8 weeks, P = 0.01) tended to have poor outcomes when compared with those with surgery during the subacute period (≥ 3-8 weeks). Favorable neurological outcomes can be achieved in patients who were surgically treated after a severe hemorrhagic ictus from brainstem CMs, and operation during subacute hemorrhage (≥ 3-8 weeks) could benefit these patients.


Assuntos
Tronco Encefálico/cirurgia , Malformações Vasculares do Sistema Nervoso Central/complicações , Malformações Vasculares do Sistema Nervoso Central/cirurgia , Hemangioma Cavernoso do Sistema Nervoso Central/complicações , Hemangioma Cavernoso do Sistema Nervoso Central/cirurgia , Hemorragias Intracranianas/etiologia , Hemorragias Intracranianas/cirurgia , Procedimentos Neurocirúrgicos/métodos , Adolescente , Adulto , Idoso , Tronco Encefálico/anormalidades , Criança , Serviços Médicos de Emergência , Feminino , Seguimentos , Humanos , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Resultado do Tratamento , Adulto Jovem
15.
Plant Dis ; 2021 May 04.
Artigo em Inglês | MEDLINE | ID: mdl-33944580

RESUMO

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 µm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 µm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 µm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA-ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990),and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus's pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

16.
J Infect Dis ; 221(Suppl 2): S164-S173, 2020 03 16.
Artigo em Inglês | MEDLINE | ID: mdl-32176783

RESUMO

BACKGROUND: Information on possible donor-derived transmission events in China is limited. We evaluated the impacts of liver transplantation from infected deceased-donors, analyzed possible donor-derived bacterial or fungal infection events in recipients, and evaluated the etiologic agents' characteristics and cases outcomes. METHODS: A single-center observational study was performed from January 2015 to March 2017 to retrospectively collect data from deceased-donors diagnosed with infection. Clinical data were recorded for each culture-positive donor and the matched liver recipient. The microorganisms were isolated and identified, and antibiotic sensitivity testing was performed. The pathogens distribution and incidence of possible donor-derived infection (P-DDI) events were analyzed and evaluated. RESULTS: Information from 211 donors was collected. Of these, 82 donors were infected and classified as the donation after brain death category. Overall, 149 and 138 pathogens were isolated from 82 infected donors and 82 matched liver recipients, respectively. Gram-positive bacteria, Gram-negative bacteria, and fungi accounted for 42.3% (63 of 149), 46.3% (69 of 149), and 11.4% (17 of 149) of pathogens in infected donors. The incidence of multidrug-resistant bacteria was high and Acinetobacter baumannii was the most concerning species. Infections occurred within the first 2 weeks after liver transplantation with an organ from an infected donor. Compared with the noninfection recipient group, the infection recipient group experienced a longer mechanical ventilation time (P = .004) and intensive care unit stay (P = .003), a higher incidence of renal dysfunction (P = .026) and renal replacement therapy (P = .001), and higher hospital mortality (P = .015). Possible donor-derived infection was observed in 14.6% of cases. Recipients with acute-on-chronic liver failure were more prone to have P-DDI than recipients with other diseases (P = .007; odds ratio = 0.114; 95% confidence interval, .025-.529). CONCLUSIONS: When a liver recipient receives a graft from an infected deceased-donor, the postoperative incidence of infection is high and the infection interval is short. In addition, when a possible donor-derived, drug-resistant bacterial infection occurs, recipients may have serious complications and poor outcomes.


Assuntos
Infecções Bacterianas/transmissão , Farmacorresistência Bacteriana Múltipla , Transplante de Fígado/efeitos adversos , Micoses/transmissão , Doadores de Tecidos , Adolescente , Adulto , Antibacterianos/uso terapêutico , Infecções Bacterianas/prevenção & controle , Cadáver , China , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Micoses/prevenção & controle , Complicações Pós-Operatórias/microbiologia , Estudos Retrospectivos , Adulto Jovem
17.
Zhongguo Zhong Yao Za Zhi ; 46(19): 4907-4921, 2021 Oct.
Artigo em Zh | MEDLINE | ID: mdl-34738384

RESUMO

Platelet function tests have been increasingly used to assist in the diagnosis of platelet disorders and prethrombotic state, monitoring of the efficacy of antiplatelet therapies, and personalized treatment. On the basis of light transmission aggregometry, new methods for platelet function test have been developed successively. At present, the research and development of platelet function detector is in its infancy in China. The active constituents of antiplatelet Chinese medicines can be classified into terpenoids, flavonoids, saponins, organic acids, lignans, diketones, volatile oils, and stilbenes. The results of dose-antiplatelet effect relationship of Chinese medicines and the active constituents showed that the effective concentration of the extracts or monomers of Chinese medicines was at micromolar level(µmol·L~(-1)), among which salvianolic acid B and ginkgolide K, ginkgolide B, and ginkgolide A had the strongest antiplatelet effect. These results suggest that the antiplatelet effect of Chinese medicine may be weaker than that of chemical drugs and biological products. Therefore, it is necessary to explore the structure-activity relationship of the active constituents in existing Chinese medicines and further improve their efficacy through structure modification. The antiplatelet effect of Chinese medicines and the constituents involves multiple pathways and multiple targets. These research results provide a reference for clinical application of them. However, there is still a lack of large-scale multi-center clinical trials to confirm the efficacy and safety of them. The regularity of the relationship between the structures of various constituents and their corresponding functions is still unknown and the relevant signal transduction pathways and structure-activity relationship need to be further studied. This paper summarized and analyzed the determination methods of platelet functions and the research results of antiplatelet Chinese medicines, which is of reference value for the research of effective and safe antiplatelet Chinese medicines.


Assuntos
Produtos Biológicos , Medicina Tradicional do Leste Asiático , China , Inibidores da Agregação Plaquetária/farmacologia , Testes de Função Plaquetária
18.
Angew Chem Int Ed Engl ; 60(28): 15452-15458, 2021 Jul 05.
Artigo em Inglês | MEDLINE | ID: mdl-33884737

RESUMO

Clarifying interfacial electronic effects on molecular adsorption is significant in many chemical and biochemical processes. Here, we used STM breaking junction and shell-isolated nanoparticle-enhanced Raman spectroscopy to probe electron transport and adsorption geometries of 4,4'-bipyridine (4,4'-BPY) at Au(111). Modifying the surface with 1-butyl-3-methylimidazolium cation-containing ionic liquids (ILs) decreases surface electron density and stabilizes a vertical orientation of pyridine through nitrogen atom σ-bond interactions, resulting in uniform adsorption configurations for forming molecular junctions. Modulation from vertical, tilted, to flat, is achieved on adding water to ILs, leading to a new peak ascribed to CC stretching of adsorbed pyridyl ring and 316 % modulation of single-molecule conductance. The dihedral angle between adsorbed pyridyl ring and surface decreases with increasing surface electronic density, enhancing electron donation from surface to pyridyl ring.

19.
J Am Chem Soc ; 142(2): 715-719, 2020 Jan 15.
Artigo em Inglês | MEDLINE | ID: mdl-31887023

RESUMO

The study of the oxygen reduction reaction (ORR) at high-index Pt(hkl) single crystal surfaces has received considerable interest due to their well-ordered, typical atomic structures and superior catalytic activities. However, it is difficult to obtain direct spectral evidence of ORR intermediates during reaction processes, especially at high-index Pt(hkl) surfaces. Herein, in situ Raman spectroscopy has been employed to investigate ORR processes at high-index Pt(hkl) surfaces containing the [011̅] crystal zone-i.e., Pt(211) and Pt(311). Through control and isotope substitution experiments, in situ spectroscopic evidence of OH and OOH intermediates at Pt(211) and Pt(311) surfaces was successfully obtained. After detailed analysis based on the Raman spectra and theoretical simulation, it was deduced that the difference in adsorption of OOH at high-index surfaces has a significant effect on the ORR activity. This research illuminates and deepens the understanding of the ORR mechanism on high-index Pt(hkl) surfaces and provides theoretical guidance for the rational design of high activity ORR catalysts.

20.
J Nematol ; 52: 1-12, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32330378

RESUMO

Tylenchidae is a widely distributed soil-inhabiting nematode family. Regardless their abundance, molecular phylogeny based on rRNA genes is problematic, and the delimitation of taxa in this group remains poorly documented and highly uncertain. Mitochondrial Cytochrome Oxidase I (COI) gene is an important barcoding gene that has been widely used species identifications and phylogenetic analyses. However, currently COI data are only available for one species in Tylenchidae. In present study, we newly obtained 27 COI sequences from 12 species and 26 sequences from rRNA genes. The results suggest that the COI gene is valid to delimitate Tylenchidae species but fails to resolve phylogenetic relationships.Tylenchidae is a widely distributed soil-inhabiting nematode family. Regardless their abundance, molecular phylogeny based on rRNA genes is problematic, and the delimitation of taxa in this group remains poorly documented and highly uncertain. Mitochondrial Cytochrome Oxidase I (COI) gene is an important barcoding gene that has been widely used species identifications and phylogenetic analyses. However, currently COI data are only available for one species in Tylenchidae. In present study, we newly obtained 27 COI sequences from 12 species and 26 sequences from rRNA genes. The results suggest that the COI gene is valid to delimitate Tylenchidae species but fails to resolve phylogenetic relationships.

SELEÇÃO DE REFERÊNCIAS
Detalhe da pesquisa