RESUMO
DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2-4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development.
Assuntos
Pesos e Medidas Corporais , Polimorfismo de Nucleotídeo Único , Bovinos/genética , Animais , Genótipo , Haplótipos , RNA Mensageiro/genética , RNA Mensageiro/metabolismoRESUMO
Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding.
Assuntos
Mutação INDEL , Polimorfismo Genético , Animais , Genótipo , Mutação INDEL/genética , Coativador 1-alfa do Receptor gama Ativado por Proliferador de Peroxissomo/genética , Fenótipo , Polimorfismo Genético/genética , Ovinos/genéticaRESUMO
PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.
Assuntos
Mutação INDEL , Animais , Peso Corporal , Bovinos/genética , Expressão Gênica , Genótipo , Mutação INDEL/genética , FenótipoRESUMO
MicroRNAs (miRNAs) have been determined to participate in the process of oestradiol production. Generally, there are two pathways by which oestradiol levels change, one being the state of cells (i.e. the status of enzymes involved in the synthesis of hormones such as oestradiol) and the other being the number of cells that secrete oestradiol. It is known that oestrogens are the main steroids produced by granulosa cells (GCs) of mature ovarian follicles. In this study we explored the function of miR-18b in rabbit GCs by overexpressing or inhibiting its activity. We found that miR-18b silencing promoted the secretion of oestradiol by significantly affecting the expression of steroidogenesis-related genes. Thus, miR-18b may act as a negative regulator of the production of enzymes related to oestradiol synthesis and affect oestradiol production. Furthermore, the effects of miR-18b on the proliferation, cell cycle and apoptosis of GCs were investigated using a cell counting kit (CCK-8) proliferation assay, detection of annexin V-fluorescein isothiocyanate apoptosis, flow cytometry and quantitative polymerase chain reaction. The results showed that miR-18b upregulated GC apoptosis (miR-18b overexpression decreases cell growth and stimulates apoptosis). These findings suggest that miR-18b and the oestrogen receptor 1 (ESR1) gene may be attractive targets to further explore the molecular regulation of GCs. The miR-18b may also explain, in part, the abnormal folliculogenesis in mammals caused by conditions such as polycystic ovary syndrome, primary ovarian insufficiency, and others.
Assuntos
Células da Granulosa/fisiologia , MicroRNAs/fisiologia , Animais , Apoptose , Ciclo Celular , Proliferação de Células , Células Cultivadas , Epigênese Genética/genética , Estradiol/biossíntese , Estradiol/genética , Receptor alfa de Estrogênio/genética , Feminino , Expressão Gênica , Inativação Gênica , MicroRNAs/genética , Coelhos , TransfecçãoRESUMO
TGF-ß signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-ß signaling pathway. LTBP1 binds to TGF-ß, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-ß pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-ß signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding.
Assuntos
Ovinos/crescimento & desenvolvimento , Ovinos/genética , Transdução de Sinais/genética , Fator de Crescimento Transformador beta/genética , Animais , Genótipo , Mutação INDEL , Proteínas de Ligação a TGF-beta Latente/genética , Proteínas de Ligação a TGF-beta Latente/metabolismo , Reação em Cadeia da Polimerase , Transdução de Sinais/fisiologia , Proteína Smad4/genética , Proteína Smad4/metabolismo , Trombospondina 1/genética , Trombospondina 1/metabolismoRESUMO
The hormone-like polypeptide, fibroblast growth factor 21 (FGF21), is a major modulator of lipid and glucose metabolism and an exploratory treatment strategy for obesity related metabolic disorders. The costs of recombinant FGF21 and mode of delivery by injection are important constraints to its wide therapeutic use. The stimulation of endogenous FGF21 production through diet is being explored as an alternative approach. To that end, we examined the mechanism(s) by which serum manipulation and lipoic acid (a dietary activator of FGF21) induce FGF21 in human hepatocellular carcinoma HepG2 cells. Serum withdrawal markedly induced FGF21 mRNA levels (88 fold) and FGF21 secreted in the media (19 fold). Lipoic acid induced FGF21 mRNA 7 fold above DMSO-treated control cells and FGF21 secretion 3 fold. These effects were several-fold greater than those of PPARα agonist, Wy14643, which failed to induce FGF21 above and beyond the induction seen with serum withdrawal. The use of transcription inhibitor, actinomycin D, revealed that de novo mRNA synthesis drives FGF21 secretion in response to serum starvation. Four previously unrecognized loci in FGF21 promoter were nucleosome depleted and enriched in acetylated histone H3 revealing their role as transcriptional enhancers and putative transcription factor binding sites. FGF21 did not accumulate to a significant degree in induced HepG2 cells, which secreted FGF21 time dependently in media. We conclude that lipoic acid cell signaling connects with the transcriptional upregulation of FGF21 and it may prove to be a safe and affordable means to stimulate FGF21 production.
Assuntos
Fatores de Crescimento de Fibroblastos/genética , Regiões Promotoras Genéticas , Soro/fisiologia , Ácido Tióctico/farmacologia , Células Hep G2 , Histonas/metabolismo , Humanos , Ácido Tióctico/análogos & derivadosRESUMO
DNA repair pathways maintain genomic integrity and stability, and dysfunction of DNA repair leads to cancer. We hypothesize that functional genetic variants in DNA repair genes are associated with risk of lung cancer. We performed a large-scale meta-analysis of 123,371 single nucleotide polymorphisms (SNPs) in 169 DNA repair genes obtained from six previously published genome-wide association studies (GWASs) of 12160 lung cancer cases and 16838 controls. We calculated odds ratios (ORs) with 95% confidence intervals (CIs) using the logistic regression model and used the false discovery rate (FDR) method for correction of multiple testing. As a result, 14 SNPs had a significant odds ratio (OR) for lung cancer risk with P FDR < 0.05, of which rs3115672 in MSH5 (OR = 1.20, 95% CI = 1.14-1.27) and rs114596632 in GTF2H4 (OR = 1.19, 95% CI = 1.12-1.25) at 6q21.33 were the most statistically significant (P combined = 3.99×10(-11) and P combined = 5.40×10(-10), respectively). The MSH5 rs3115672, but not GTF2H4 rs114596632, was strongly correlated with MSH5 rs3131379 in that region (r (2) = 1.000 and r (2) = 0.539, respectively) as reported in a previous GWAS. Importantly, however, the GTF2H4 rs114596632 T, but not MSH5 rs3115672 T, allele was significantly associated with both decreased DNA repair capacity phenotype and decreased mRNA expression levels. These provided evidence that functional genetic variants of GTF2H4 confer susceptibility to lung cancer.
Assuntos
Predisposição Genética para Doença , Neoplasias Pulmonares/genética , Polimorfismo de Nucleotídeo Único , Fator de Transcrição TFIIH/genética , Proteínas de Ciclo Celular/genética , Reparo do DNA , Variação Genética , Estudo de Associação Genômica Ampla , Humanos , Neoplasias Pulmonares/etiologia , RiscoRESUMO
Mink are susceptible to viruses such as SARS-CoV-2, H1N1 and H9N2, so they are considered a potential animal model for studying human viral infections. Therefore, it is important to study the immune system of mink. Immunoglobulin (Ig) is an important component of humoral immunity and plays an important role in the body's immune defense. In this study, we described the gene locus structure of mink Ig germline by genome comparison, and analyzed the mechanism of expression diversity of mink antibody library by 5'RACE and next-generation sequencing (NGS). The results were as follows: the IgH, Igκ and Igλ loci of mink were located on chromosome 13, chromosome 8 and chromosome 3, respectively, and they had 25, 36 and 7 V genes, 3, 5 and 7 J genes and 10 DH genes, respectively. Mink Ig heavy chains preferred the IGHV1, IGHD2 and IGHJ4 subgroups, κ chains mainly use the IGKV1, IGKJ1 and IGHL4 subgroups, and λ chains mainly use the IGLV3 and IGLJ3 subgroups. Linkage diversity analysis revealed that N nucleotide insertion was the main factor affecting the linkage diversity of mink Igs. On the mutation types of mink Ig Somatic Hypermutation (SHM), the high mutation types of heavy chain were mainly G>A, C>T, T>C, A>G, C>A, G>T, A>C, and T>G; the high mutation types of κ-chain were G>A and T>C; and the high mutation types of λ-chain were G>A and A>G. The objective of this study was to analyze the locus structure and expression diversity of Ig in mink. The results contribute to our comprehension of Ig expression patterns in mink and were valuable for advancing knowledge in mink immunogenetics, exploring the evolution of adaptive immune systems across different species, and conducting comparative genomics research.
RESUMO
Immunoglobulin is an essential component of the body's defense against pathogens, aiding in the recognition and clearance of foreign antigens. Research concerning immunoglobulin gene and its diversity of expression across different breeds within the same species is relatively scarce. In this study, we employed RACE (Rapid Amplification of cDNA Ends) technology, prepared DNA libraries, performed high-throughput sequencing, and conducted related bioinformatics analysis to analyze the differences in immunoglobulin gene diversity and expression at different periods in Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens. The study found that the composition of chicken immunoglobulin genes is relatively simple, with both the light chain and heavy chain having a functional V gene. Additionally, the mechanisms of immunoglobulin diversity generation tended to be consistent among different breeds and periods of chickens, primarily relying on abundant junctional diversity, somatic hypermutation (SHM), and gene conversion (GCV) to compensate for the limitations of low-level V(D)J recombination. As the age increased, the junctional diversity of IgH and IgL tended to diversify and showed similar expression patterns among different breeds. In the three chicken breeds, the predominant types of mutations observed in IGHV and IGLV SHM were A to G and G to A transitions. Specifically, IGLV exhibited a preference for A to G mutations, whereas IGHV displayed a bias toward G to A mutations. The regions at the junctions between framework regions (FR) and complementarity-determining regions (CDR) and within the CDR regions themselves are typically prone to mutations. The locations of GCV events in IGLV and IGHV do not show significant differences, and replacement segments are concentrated in the central regions of FR1, CDR, and FR2. Importantly, gene conversion events are not random occurrences. Additionally, our investigation revealed that CDRH3 in chickens of diverse breeds and periods the potential for diversification through the incorporation of cysteine. This study demonstrates that the diversity of immunoglobulin expression tends to converge among Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens, indicating that the immunoglobulin gene expression mechanisms in different breeds of chickens do not exhibit significant differences due to selective breeding.
Immunoglobulins play a key role in the organism's defense against pathogens, and their diverse expression allows the body to generate a wide array of antibodies. This diversity serves as a critical safeguard for the immune system against various pathogens. Natural geographical variances and artificial breeding and selection can potentially lead to different immune responses in distinct populations of the same species when confronted with the same pathogen. In this study, we investigated the diversity of immunoglobulin gene expression in the natural state of different chicken breeds (Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens) and at different periods from the perspective of immunoglobulin gene expression mechanism. We analyzed the diversity of immunoglobulin based on the results of high-throughput sequencing by extracting Fabricius bursa RNA, RACE (Rapid Amplification of cDNA Ends) technique, and constructing DNA libraries. Our study reveals that the junctional diversity, somatic hypermutation, CDR3 diversity, and gene conversion expression of immunoglobulins in Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens converge during the same time period. This indicates that the immunoglobulin gene expression mechanisms in different chicken breeds do not exhibit significant variations as a result of selective breeding.
Assuntos
Galinhas , Animais , Galinhas/genética , Galinhas/imunologia , Feminino , Imunoglobulinas/genética , Imunoglobulinas/metabolismo , Genes de Imunoglobulinas/genéticaRESUMO
The effective combination of semen cryopreservation and artificial insemination has a positive effect on the conservation of germplasm resources, production and breeding, etc. However, during the process of semen cryopreservation, the sperm cells are very susceptible to different degrees of physical, chemical, and oxidative stress damage. Oxidative damage is the most important factor that reduces semen quality, which is affected by factors such as dilution equilibrium, change of osmotic pressure, cold shock, and enzyme action during the freezing-thawing process, which results in the aggregation of a large amount of reactive oxygen species (ROS) in sperm cells and affects the quality of semen after thawing. Therefore, the method of adding antioxidants to semen cryoprotective diluent is usually used to improve the effect of semen cryopreservation. The aim of this experiment was to investigate the effects of adding five antioxidants (GLP, Mito Q, NAC, SLS, and SDS) to semen cryoprotection diluent on the cryopreservation effect of semen from Saanen dairy goats. The optimal preservation concentrations were screened by detecting sperm viability, plasma membrane integrity, antioxidant capacity, and acrosomal enzyme activities after thawing, and the experimental results were as follows: the optimal concentrations of GLP, Mito Q, NAC, SLS, and SDS added to semen cryopreservation diluent at different concentrations were 0.8 mg/mL, 150 nmol/L, 0.6 mg/mL, 0.15 mg/ mL, 0.6 mg/mL, and 0.15 mg/mL. The optimal concentrations of the five antioxidants were added to the diluent and analyzed after 1 week of cryopreservation, and it was found that sperm viability, plasma membrane integrity, and mitochondrial activity were significantly enhanced after thawing compared with the control group (P < 0.05), and their antioxidant capacity was significantly enhanced (P < 0.05). Therefore, the addition of the above five antioxidants to goat sperm cryodilution solution had a better enhancement of sperm cryopreservation. This study provides a useful reference for exploring the improvement of goat semen cryoprotection effect.
Assuntos
Antioxidantes , Criopreservação , Crioprotetores , Cabras , Preservação do Sêmen , Animais , Masculino , Criopreservação/métodos , Criopreservação/veterinária , Antioxidantes/farmacologia , Preservação do Sêmen/métodos , Preservação do Sêmen/veterinária , Crioprotetores/farmacologia , Espermatozoides/efeitos dos fármacos , Sobrevivência Celular/efeitos dos fármacos , Sêmen/efeitos dos fármacos , Motilidade dos Espermatozoides/efeitos dos fármacos , Estresse Oxidativo/efeitos dos fármacos , Análise do Sêmen , Membrana Celular/efeitos dos fármacosRESUMO
We report on the characterization of lipogenic tissue transcriptional networks that support physiological responses of obese rats to a lipid-lowering bioactive food compound, R-α-lipoic acid (LA). Nine-week-old male Zucker diabetic fatty (fa/fa) rats were fed a chow diet supplemented with 3 g LA per kg diet or pair fed for 2 wk. At the end of the trial, high-quality RNA was extracted from the liver and epididymal fat and subjected to transcriptome analysis by RNA-Seq technology. Results showed a substantially higher number of differentially expressed genes [DEG, false discovery rate adjusted P ≤ 0.05 and absolute log2 (fold change) ≥ 1] in the liver (110 genes) vs. epididymal fat (10 genes). Most epididymal fat DEG were also differentially expressed in liver and shared directionality of change. Gene Ontology (GO) analysis of these transcripts revealed significant enrichment of GO categories related to immune response, stress response, lipid metabolism, and carboxylic acid metabolic processes. Of interest, interferon-related genes involved in defense against microorganisms and innate immune response were induced by LA. Lipid metabolism-related transcript changes observed in LA-fed animals included downregulation of lipogenic genes (Pnpla3, Pnpla5, Elovl6, Acly, Gpam, and Aacs) and concomitant upregulation of short-, medium-, and long-chain fatty acid metabolic processes (Acot1, Acot2, Acsf2, and Crat). Transcriptional changes were accompanied by the lowering of abdominal adiposity and blood triacylglycerol levels. We conclude that LA dietary supplementation induces prominent gene expression changes in liver in support of significant improvement of whole-body lipid status.
Assuntos
Tecido Adiposo/metabolismo , Regulação da Expressão Gênica/efeitos dos fármacos , Fígado/metabolismo , Ácido Tióctico/farmacologia , Animais , Análise por Conglomerados , Biologia Computacional , Suplementos Nutricionais , Perfilação da Expressão Gênica , Ontologia Genética , Sequenciamento de Nucleotídeos em Larga Escala , Metabolismo dos Lipídeos/genética , Masculino , Ratos , Ratos Zucker , Reação em Cadeia da Polimerase em Tempo Real , Análise de Sequência de RNARESUMO
Controlling elevated blood triacylglycerol translates into substantial health benefits. The present study aimed to evaluate the triacylglycerol-lowering properties of (R)-α-lipoic acid (LA) once circulating triacylglycerol levels have become elevated, and identify the molecular targets of LA. Nine-week old male ZDF (fa/fa) rats were fed a chow diet supplemented with 3g LA per kg diet or pair fed for two weeks (8 rats per treatment). We determined changes in blood triacylglycerol, insulin, non-esterified fatty acids, and ketone bodies concentrations. We analyzed the expression of genes and proteins involved in fatty acid and triacylglycerol metabolism in liver, epididymal fat, and skeletal muscle. Feeding LA to ZDF rats (a) corrected severe hypertriglyceridemia, (b) lowered abdominal fat mass, (c) raised circulating fibroblast growth factor-21 and Fgf21 liver gene expression, (d) repressed lipogenic gene expression of ATP-citrate synthase (Acly), acetyl-coA carboxylase 1 (Acaca), fatty acid synthase (Fasn), sn-glycerol-3-phosphate acyltransferase 1 (Gpam), adiponutrin (Pnpla3) in the liver and adipose tissue, (e) decreased hepatic protein levels of ACC1/2, FASN and 5'-AMP-activated protein kinase catalytic subunit α (AMPKα), (f) did not change phospho-AMPKα/AMPKα and phospho-ACC/ACC ratios, (g) stimulated liver gene expression of PPARα target genes carnitine O-palmitoyltransferase 1ß (Cpt1b) and acyl-CoA thioesterase 1 (Acot1) but not carnitine O-palmitoyltransferase 1α (Cpt1a). This is evidence that short-term LA feeding to obese rats reverses severe hypertriglyceridemia. FGF21 may mediate the beneficial metabolic effects of LA.
Assuntos
Hipertrigliceridemia/dietoterapia , Hipertrigliceridemia/etiologia , Obesidade/complicações , Ácido Tióctico/uso terapêutico , Animais , Peso Corporal , Ácidos Graxos/sangue , Ácidos Graxos/genética , Ácidos Graxos/metabolismo , Regulação da Expressão Gênica , Hipertrigliceridemia/sangue , Hipertrigliceridemia/genética , Insulina/sangue , Corpos Cetônicos/sangue , Masculino , Ratos , Ratos Zucker , Triglicerídeos/sangue , Triglicerídeos/genética , Triglicerídeos/metabolismoRESUMO
As important livestock in Qinghai-Tibet Plateau, yak provides meat and other necessities for Tibetans living. Plateau yak has resistance to diseases and stress, yet is nearly unknown in the structure and expression mechanism of yak immunoglobulin loci. Based on the published immunoglobulin genes of bovids (cattle, sheep and goat), the genomic organization of the yak immunoglobulin heavy chain (IgH) and immunoglobulin light chain (IgL) were described. The assemblage diversity of IgH, Igλ and Igκ in yak was similar to that in bovids, and contributes little to the antibody lineage compared with that in humans and mice. Somatic hypermutation (SHM) had a greater effect on immunoglobulin diversity in yak than in goat and sheep, and in addition to the complementarity-determining region (CDR), some loci in the framework region (FR) also showed high frequency mutations. CDR3 diversity showed that immunological lineages in yak were overwhelmingly generated through linkage diversity in IgH rearrangements. The emergence of new high-throughput sequencing technologies and the yak whole genome (2019) publication have greatly improved our understanding of the immune response in yaks. We had a more comprehensive analysis of yak immunoglobulin expression diversity by PE300, which avoided the disadvantage of missing low-frequency recombination in traditional Sanger sequencing. In summary, we described the schematic structure of the genomic organization of yak IgH loci and IgL loci. The analysis of immunoglobulin expression diversity showed that yak made up for the deficiency of V(D)J recombinant diversity by junctional diversity and CDR3 diversity. In addition, yak, like cattle, also had the same ultra-long IgH CDR3 (CDR3H), which provided more contribution to the diverse expression of yak immunoglobulin. These findings might provide a theoretical basis for disease resistance breeding and vaccine development in yak.
Assuntos
Cruzamento , Genoma , Animais , Bovinos , Cabras , Cadeias Pesadas de Imunoglobulinas/genética , Camundongos , Fenótipo , OvinosRESUMO
With high fecundity and short production cycle, poultry is one of the important sources of meat. During the embryonic and post-hatch period, the higher death rate caused huge economic losses in poultry production. Our previous study showed that chick subcutaneous adipose tissue is an important energy supply tissue besides yolk. Therefore, the metabolic mechanism of subcutaneous adipose tissue in chicks could provide a new perspective of brooding. The objectives of the current study were to evaluate the differences between chick subcutaneous adipose tissue and abdominal adipose tissue before and after hatching and reveal the cross-talk of different cells within the chick subcutaneous adipose tissue. The results of RNA-seq and weighted gene co-expression network analysis (WGCNA) of chick subcutaneous and abdominal adipose tissues showed that the function of chick subcutaneous tissue was related to immunoreaction, and macrophage could be the major immune infiltration cell type in chicken subcutaneous adipose tissue, which were also verified by qPCR, HE stain, and IHC. The results of free fatty acids (FFAs)-induced the cross-talk between macrophages and adipocytes showed that FFAs-Ccl2 (chicken CCL26) axis could have an important role in lipid transportation in adipose tissue. The results of Oil Red O and Nile red stain demonstrated that macrophages have the ability to absorb FFAs quickly. Interestingly, according to the genomic organization of CCL family with representative vertebrate species, we found that chicken CCL26 could be the major chemokine in chicken adipocyte as the status of CCL2 in mammal adipocyte. In conclusion, we demonstrate that FFA-induced Ccl2 (chicken CCL26) secretion is crucial in determining fat depot-selective adipose tissue macrophage (ATM) infiltration, which could be an important medium of lipid transportation in chicken subcutaneous adipose tissue. These findings may have multiple important implications for understanding macrophage biology with chick subcutaneous adipose tissue and provide theoretical basis for lipid metabolism in poultry brooding.
Assuntos
Adipócitos , Galinhas , Adipócitos/metabolismo , Animais , Galinhas/genética , Perfilação da Expressão Gênica , Lipídeos , Macrófagos/metabolismo , Mamíferos/genética , RNA-Seq , Gordura SubcutâneaRESUMO
The tRNA modification gene in eukaryotes is relatively conservative. As an important modification gene, the TRDMT1 gene plays an important role in maintaining tRNA structural maintenance and reducing mistranslation of protein translation by methylation of specific tRNA subpopulations. Mouse and zebrafish TRDMT1 knockout experiments indicate that it may mediate growth and development through tRNA modification. However, there are no systematic reports on the function of tRNA-modified genes in livestock. In this study, Qinchuan cattle DNA pool sequencing technology was used. A G > C mutation in the - 1223 â¯bp position upstream of the TRDMT1 translation initiator codon was found. At this locus, the dual-luciferase assay indicated that different genotypes cause differences in transcriptional activity ( P < 0.05 ). Our experiment detected a natural genetic variation of a tRNA modification gene TRDMT1, which may provide potential natural molecular materials for the study of tRNA modification.
RESUMO
Transportation is a crucial phase in the beef cattle industry, and the annual losses caused by beef cattle transport stress are substantial. Because of its huge economic losses, such as lower growth rate and even death, long-distance transportation stress has attracted more attention from beef production practitioners because of its huge economic losses. Compared with the long-distance transportation stress, the short-distance transportation stress was ignored for the reason of no obvious symptoms in cattle. Our previous study showed that the disorder of B cell function could be a potential health risk after short-distance transportation. However, the transcriptome details of the changes in the cattle blood after short-distance transportation and the molecular mechanisms for the regulation of the developmental process are not clearly known. In this study, a total of 10 Qinchuan cattle were used to compare the molecular characteristics of blood before and after short-distance transportation. The miRNA-seq showed that 114 differentially expressed miRNAs (DEMs) were found (40 upregulated and 74 downregulated) between two groups before and after transportation. Furthermore, more than 90% of the miRNAs with counts of more than 10 were used to construct a co-expression network by weighted correlation network analysis (WGCNA), and four independent modules were identified. According to their relationship with 30 hub genes, the turquoise module was the key module in this study. The regulator network of hub genes and miRNAs in the turquoise module was constructed by miRNAs targeting genes predicting, and the miRNAs had targeting sites within hub genes that could be identified as hub-miRNAs. Further, it showed that CD40 and ITPKB had the same targeting miRNAs (miR-339a/b), and the newly discovered hub miRNAs filled the gaps in our previous study about the relationship between hub genes in short-distance transportation stress and provided the potential utility for predicting and treatment of short-distance transportation stress in beef cattle.
RESUMO
Since excess abdominal fat is one of the main problems in the broiler industry for the development of modern broiler and layer industry, the importance of subcutaneous adipose tissue has been neglected. However, chick subcutaneous adipose tissue appeared earlier than abdominal adipose tissue and more than abdominal adipose tissue. Despite a wealth of data, detailed information is lacking about the development and function of chick subcutaneous adipose tissue during the embryonic and posthatch period. Therefore, the objective of the current study was to determine the developmental changes of adipocyte differentiation, lipid synthesis, lipolysis, fatty acid ß-oxidation, and lipid contents from E12 to D9.5. The results showed that subcutaneous adipose tissue was another important energy supply tissue during the posthatch period. In this stage, the mitochondrial copy number and fatty acid ß-oxidation level significantly increased. It revealed that chick subcutaneous adipose tissue not only has the function of energy supply by lipidolysis but also performs the same function as brown adipose tissue to some extent, despite that the brown adipose tissue does not exist in birds. In addition, this finding improved the theory of energy supply in the embryonic and posthatch period and might provide theoretical basis on physiological characteristics of lipid metabolism in chicks.
RESUMO
The transportation is a crucial phase in beef cattle industry, and the annual losses caused by beef cattle transport stress are substantial. Several studies have described the effect of long distance transportation stress on animal health, such as disorder in nervous, endocrine, immune, and metabolic system. However, molecular mechanisms underlying short distance transportation stress is still poorly understood. Present study aims to investigate the effect of short distance transportation by measuring the hematological indices and transcriptomic analysis. In this study, a total 10 Qinchuan cattle were used to compare the molecular characteristics of blood before and after transportation. We have found that a stress-related marker "white blood cell count (WBC)" increased significantly after transportation. The decrease in triglyceride (TG), cholestenone (CHO), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) showed that energy expenditure was increased after transportation, but not enough to activate fatty decomposition. Intriguingly, the decrease of malondialdehyde (MDA) showed that cattle were more resilience to oxidative stress. The RNA-seq showed that 1,092 differentially expressed genes (DEGs) were found (329 up-regulated and 763 down-regulated) between group before and group after. The GO and KEGG enrichment showed that the metabolic pathway and B cell function related pathways were enriched. Furthermore, median absolute deviation (MAD) top 5,000 genes were used to construct a co-expression network by weighted correlation network analysis (WGCNA), and 11 independent modules were identified. Combing with protein-protein interaction (PPI) analysis, the verification of quantitative real-time PCR (qPCR) and the correlation of B cell function, structural maintenance of chromosomes 3 (SMC3), jun proto-oncogene (JUN), and C-X-C motif chemokine ligand 10 (CXCL10) were suggested as potential molecular markers in identification of short distance transportation. Collectively, the blood RNA-seq analysis and WGCNA indicated that the disorder of B cell differentiation, proliferation, survival, and apoptosis were the potential molecular mechanism in short distance transportation stress. In conclusion, our results provide the novel insight about potential biomarkers for short distance transportation stress, which may serve as for diagnosing and preventing this condition in beef industry.
RESUMO
The GH growth axis plays an important role in the growth and development of animals and runs through the whole life of animals. Many studies have shown that molecular mutations in key genes of the GH axis will affect the growth and development of animals. The purpose of this study was to explore the distribution characteristics of InDels of GHR, GHRH, and GHRHR in seven Chinese sheep populations, and to further explore the relationship between InDels and sheep growth traits. GHR showed high variation in Chinese sheep, and GHR-53 showed the highest minimum allele frequency (MAF). There was only one InDel mutation site in both GHRH and GHRHR. The genotype frequencies of Hu sheep (HS), Tong sheep (TS), and Lanzhou fat-tail sheep (LFTS) were quite different from other breeds. The association between GHR, GHRH, and GHRHR InDels and body size traits in seven varieties were analyzed. The results showed that there was no significant relationship between GHRH and body size traits in the seven sheep populations. There was a positive association between GHR-21 and hip height of LFSH (p < 0.05). GHR-43 reduced body height and chest depth of Small tail han sheep (STHS) and hip width of TS. GHR-44 significantly affected the body weight of HS, the body height of STHS and the head depth of TS. GHR-53 significantly reduced cannon girth of HS, chest of STHS and forehead width of TS. GHRHR-2 significantly reduced the body weight of LFHS. To sum up, this study revealed the effects of GHR, GHRH, and GHRHR InDels on sheep phenotypic traits, which indicated their potential application prospects in the genetic improvement of mutton sheep.
RESUMO
The purpose of this study was to explore functional variants in the prosaposin (PSAP) three prime untranslated region (3' UTR) and clarify the relationship between the variants and morphological traits. Through Sanger sequencing, 13 variations were identified in bovine PSAP in four Chinese cattle breeds, with six of them being loci in 3' UTR. In particular, Nanyang (NY) cattle had a special genotype and haplotype distribution compared to the other three breeds. NY cattle with ACATG and GCGTG haplotypes had higher morphological traits than GTACA and GTACG haplotypes. The results of dual-luciferase reporter assay showed that ACATG and GCGTG haplotypes affected the morphological traits of NY cattle by altering the secondary structure of PSAP 3' UTR rather than the miR-184 target sites. The findings of this study could be an evidence of a complex and varying mechanism between variants and animal morphological traits and could be used to complement candidate genes for molecular breeding.