Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 94
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
BMC Plant Biol ; 24(1): 340, 2024 Apr 26.
Artigo em Inglês | MEDLINE | ID: mdl-38671402

RESUMO

Astragalus mongholicus is a medicinal plant that is known to decrease in quality in response to continuous cropping. However, the differences in the root-associated microbiome and root exudates in the rhizosphere soil that may lead to these decreases are barely under studies. We investigated the plant biomass production, root-associated microbiota, and root exudates of A. mongholicus grown in two different fields: virgin soil (Field I) and in a long-term continuous cropping field (Field II). Virgin soil is soil that has never been cultivated for A. mongholicus. Plant physiological measurements showed reduced fresh and dry weight of A. mongholicus under continuous cropping conditions (i.e. Field II). High-throughput sequencing of the fungal and bacterial communities revealed differences in fungal diversity between samples from the two fields, including enrichment of potentially pathogenic fungi in the roots of A. mongholicus grown in Field II. Metabolomic analysis yielded 20 compounds in A. mongholicus root exudates that differed in relative abundance between rhizosphere samples from the two fields. Four of these metabolites (2-aminophenol, quinic acid, tartaric acid, and maleamate) inhibited the growth of A. mongholicus, the soil-borne pathogen Fusarium oxysporum, or both. This comprehensive analysis enhances our understanding of the A. mongholicus microbiome, root exudates, and interactions between the two in response to continuous cropping. These results offer new information for future design of effective, economical approaches to achieving food security.


Assuntos
Microbiota , Raízes de Plantas , Rizosfera , Microbiologia do Solo , Raízes de Plantas/microbiologia , Astrágalo/microbiologia , Exsudatos de Plantas/metabolismo , Fungos/genética , Fungos/fisiologia , Produção Agrícola/métodos , Bactérias/genética , Bactérias/metabolismo
2.
Phys Chem Chem Phys ; 26(8): 7224-7229, 2024 Feb 22.
Artigo em Inglês | MEDLINE | ID: mdl-38345781

RESUMO

The damage behavior and defect evolution in Si-doped and Fe-doped ß-Ga2O3 crystals were investigated using an electron irradiation of 1 MeV at a dose of 1 × 1016 cm-2 in conjunction with structural and optoelectronic characterizations. Distinct decline in electron spin resonance (ESR) signal with g = 1.96 and a UV luminesce of 375 nm were observed in Si-doped ß-Ga2O3 due to the capture of free carriers by irradiation defects. As for the Fe-doped sample, both defect-related blue emission and Cr3+ impurity-related red luminescence underwent prominent suppression after electron irradiation, which can be correlated to the creation of VO and VGa defects and the formation of non-radiative recombination. Noticeably, neither VO- nor VGa-related ESR signals were detected in Fe-doped and Si-doped ß-Ga2O3 irrespective of irradiation; g = 2.003 resonance was observed in Mg-doped ß-Ga2O3 and it experienced remarkable augmentation after electron irradiation. We assigned the g = 2.003 peak to the VGa acceptor. Besides, although the Raman mode of 258 cm-1 in Si-doped ß-Ga2O3 has been suggested to be electron concentration dependent, no obvious change in peak intensity was observed before and after electron irradiation.

3.
BMC Bioinformatics ; 24(1): 192, 2023 May 11.
Artigo em Inglês | MEDLINE | ID: mdl-37170221

RESUMO

BACKGROUND: Synaptogyrin-2 (SYNGR2), as a member of synaptogyrin gene family, is overexpressed in several types of cancer. However, the role of SYNGR2 in pan-cancer is largely unexplored. METHODS: From the TCGA and GEO databases, we obtained bulk transcriptomes, and clinical information. We examined the expression patterns, prognostic values, and diagnostic value of SYNGR2 in pan-cancer, and investigated the relationship of SYNGR2 expression with tumor mutation burden (TMB), microsatellite instability (MSI), immune infiltration, and immune checkpoint (ICP) genes. The gene set enrichment analysis (GSEA) software was used to perform pathway analysis. Besides, we built a nomogram of liver hepatocellular carcinoma patients (LIHC) and validated its prediction accuracy. RESULTS: SYNGR2 was highly expressed in most cancers. The high expression of SYNGR2 significantly reduced the overall survival (OS), disease-specific survival (DSS), disease-free interval (DFI), and progression-free interval (PFI) in multiple types of cancer. Also, receiver operating characteristic (ROC) curve analysis demonstrated that SYNGR2 showed high accuracy in distinguishing cancerous tissues from normal ones. Moreover, SYNGR2 expression was correlated with TMB, MSI, immune scores, and immune cell infiltrations. We also analyzed the association of SYNGR2 with immunotherapy response in LIHC. Finally, a nomogram including SYNGR2 and pathologic T, N, M stage was built and exhibited good predictive power for the OS, DSS, and PFI of LIHC patients. CONCLUSION: Overall, SYNGR2 is a critical oncogene in various tumors. SYNGR2 participates in the carcinogenic progression, and may contribute to the immune infiltration in tumor microenvironment. Our study suggests that SYNGR2 can serve as a predictor related to prognosis in pan-cancer, especially LIHC.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , Sinaptogirinas , Microambiente Tumoral , Humanos , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/imunologia , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/imunologia , Instabilidade de Microssatélites , Oncogenes , Microambiente Tumoral/genética , Microambiente Tumoral/imunologia
4.
Plant Dis ; 107(5): 1584-1592, 2023 May.
Artigo em Inglês | MEDLINE | ID: mdl-36383991

RESUMO

Lychnis mottle virus (LycMoV; genus Unassigned, family Secoviridae) infection of Angelica sinensis produces mottle and mosaic symptoms, damaging the host. Early detection of relevant pathogens is the most critical step in preventing the potential transmission of infectious disease. Polyclonal antibodies with high potency and high specificity were prepared using the recombinant LycMoV capsid protein as an antigen. Here, we developed and optimized a rapid colloidal gold immunochromatography assay (GICA) detection system for LycMoV using this antibody. Under optimum conditions, GICA specifically detected (up to 10,000-fold) positive LycMoV samples. A real-time reverse-transcription loop-mediated isothermal amplification (RT-LAMP) system was also established by selecting the primers with high sensitivity and specificity to LycMoV. The RT-LAMP detection threshold was 1.42 fg/µl (291 copies/µl). A GICA-RT-LAMP assay system was further established and optimized. The minimum GICA detection line was calculated at 1.52 × 10-2 ng/µl. Although GICA did not detect positive samples after capturing virus at 2.53 × 10-3 ng/µl, GICA-LAMP and GICA-RT-PCR did, whose sensitivity was comparatively greater than sixfold. This is the first report showing that GICA-RT-LAMP is a cost-effective approach for use in detecting LycMoV without extracting nucleic acids. These sensitive assays will help improve virus disease management in A. sinensis crops.


Assuntos
Lychnis , Vírus de RNA , Coloide de Ouro , Transcrição Reversa , Cromatografia de Afinidade
5.
Plant Dis ; 2023 Jul 01.
Artigo em Inglês | MEDLINE | ID: mdl-37392030

RESUMO

Celery (Apium graveolens L.) is an economically important vegetable crop in China. In recent years, celery has been widely planted in Yuzhong county, Gansu province. From 11 April to 24 May, 2019-2021, basal stem rot of celery was observed with incidences up to 15% in the Yuzhong region (35°49'N, 104°16'E, 1865 m a.s.l.), which caused serious economic losses to local farmers. Typical symptoms of the disease included wilting and darkening of the basal stem, leading to plant death. To identify the cause of the disease, small pieces (5mm×5mm) of the margin of asymptomatic and rotting basal stem tissues were sterilized with 70% ethanol for 30 s and 3% NaClO for 5 min, then placed on potato dextrose agar (PDA) plates, and incubated at 25℃ (Zhao et al. 2021). Twenty-seven single-conidium isolates with morphological characteristics similar to Fusarium spp. were obtained (Ma et al. 2022), which displayed two kinds of colony morphology. On PDA, seven isolates developed white, fluffy aerial mycelium and twenty isolates developed light pink abundant aerial mycelium. Isolate F5 and F55 from each distinct morphological group were cultured on PDA and synthetic low nutrient agar (SNA) for pathogenicity tests, morphological and molecular identification. The macroconidia (18.3 to 29.6 × 3.6 to 5.3 µm, n=50) with 1 to 2 septa and microconidia (7.5 to 11.6 × 2.6 to 3.5 µm, n=50) with 0 to 1 septum were observed in F5. For F55, the size of macroconidia was 14.2 to 19.5 × 3.3 to 4.2 µm (n = 50) with 1 to 2 septa; Microconidia were mostly 0 to 1 septum and measured 7.3 to 12.8 × 2.2 to 4.2 µm (n = 50). To confirm the identity of the isolates, the internal transcribed spacer region (ITS) and the translation elongation factor-1 alpha (TEF-1α) gene were amplified using primers ITS1/ITS4 and EF-1/EF-2 (Uwaremwe et al. 2020), respectively. The sequence similarities of isolate F5 (GenBank No. OL616048 and OP186480) and F55 (GenBank No. OL616049 and OP186481) with the corresponding sequences of F. solani (MT447508 and MN650097) and F. oxysporum (MG461555 and OQ632904) ranged from 99.22% to 100.00%, with matching base pairs of 531/532, 416/416, 511/515 and 394/395, respectively. The voucher samples were deposited in the sample center of Northwest Institute of Ecological Environment and Resources, Chinese Academy of Sciences. Morphological and molecular results confirmed the species of F5 and F55 as F. solani and F. oxysporum, respectively. A pathogenicity test was conducted under greenhouse conditions (19-31°C, avg. 26°C). Conidial suspension (105 spores/mL) of isolates F5 and F55 were poured onto the basal stems of healthy celery seedlings at the age of 1 month and mock-inoculated control treatments with sterile water. Ten plants were inoculated for each treatment. After 21 days, all plants inoculated with both fungal isolates developed symptoms similar to those observed in the field, whereas the mock-inoculated plants remained healthy. The pathogen was successfully reisolated from the inoculated symptomatic plants onto PDA medium and had morphology as described above, confirming Koch's postulates. F. solani and F. oxysporum have been reported to infect many plant species, including carrot (Zhang et al. 2014) and Angelica sinensis (Liu et al. 2022). To our knowledge, this is the first report that F. solani and F. oxysporum cause basal stem rot on celery in China. The identification of pathogens of the observed basal stem rot on celery provides a clear target for the prevention and management of this disease.

6.
Plant Dis ; 2022 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-36109878

RESUMO

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

7.
Plant Dis ; 106(7): 1898-1910, 2022 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-35021867

RESUMO

Root rot is a serious disease in plantations of Angelica sinensis, severely reducing yield and quality and threatening sustainable production. Fusarium isolates (n = 32) were obtained from field samples of root rot tissue, leaves, and infected soil. Isolates were identified by comparison of the sequences of their internal transcribed spacer region and translation elongation factor 1-α to sequences of known species in the National Center for Biotechnology Information database. These Fusarium isolates include Fusarium tricinctum (43.75%), F. equiseti (31.25%), F. solani (9.37%), F. oxysporum (6.25%), F. acuminatum (6.25%), and F. incarnatum (3.12%). For pathogenicity testing under greenhouse conditions, seven isolates were selected based on a phylogenetic analysis, including four strains of F. tricinctum and one strain each of F. solani, F. oxysporum, and F. acuminatum. The seven isolates were all pathogenic but differed in their ability to infect: The four F. tricinctum strains were capable of causing root rot in A. sinensis at 100% incidence and were highly aggressive. Furthermore, the symptoms of root rot induced by those seven isolates were consistent with typical root rot cases in the field, but their disease severity varied. Observed histopathological preparations of F. tricinctum-infected seedlings and tissue slide results showed that this fungal species can penetrate epidermal cells and colonize the cortical cells where it induces necrosis and severe plasmolysis. Plate confrontation experiments showed that isolated rhizosphere bacteria inhibited the Fusarium pathogens that cause root rot in A. sinensis. Our results provide timely information about the use of biocontrol agents for suppression of root rot disease.


Assuntos
Angelica sinensis , Fusarium , Filogenia , Plântula , Virulência
8.
Sensors (Basel) ; 22(19)2022 Sep 27.
Artigo em Inglês | MEDLINE | ID: mdl-36236426

RESUMO

The gamma radiation environment is one of the harshest operating environments for image acquisition systems, and the captured images are heavily noisy. In this paper, we improve the multi-frame difference method for the characteristics of noise and add an edge detection algorithm to segment the noise region and extract the noise quantization information. A Gaussian mixture model of the gamma radiation noise is then established by performing a specific statistical analysis of the amplitude and quantity information of the noise. The established model is combined with the random walk algorithm to generate noise and achieve the prediction of image noise under different accumulated doses. Evaluated by objective similarity matching, there is no significant difference between the predicted image noise and the actual noise in subjective perception. The ratio of similarity-matched images in the sample from the predicted noise to the actual noise reaches 0.908. To further illustrate the spillover effect of this research, in the discussion session, we used the predicted image noise as the training set input to a deep residual network for denoising. The network model was able to achieve a good denoising effect. The results show that the prediction method proposed in this paper can accomplish the prediction of gamma radiation image noise, which is beneficial to the elimination of image noise in this environment.

9.
HPB (Oxford) ; 24(3): 342-352, 2022 03.
Artigo em Inglês | MEDLINE | ID: mdl-34400051

RESUMO

BACKGROUND: This study aimed to investigate the work status of clinicians in China and their management strategy alteration for patients with hepatocellular carcinoma (HCC) during the COVID-19 pandemic. METHODS: A nationwide online questionnaire survey was conducted in 42 class-A tertiary hospitals across China. Experienced clinicians of HCC-related specialties responded with their work status and management suggestions for HCC patients during the pandemic. RESULTS: 716 doctors responded effectively with a response rate of 60.1%, and 664 were included in the final analysis. Overall, 51.4% (341/664) of clinicians reported more than a 60% reduction of the regular workload and surgeons declared the highest proportion of workload reduction. 92.5% (614/664) of the respondents have been using online medical consultation to substitute for the "face-to-face" visits. Adaptive adjustment for the treatment strategy for HCC was made, including the recommendations of noninvasive and minimally invasive treatments such as transcatheter arterial chemoembolization for early and intermediate stage. Targeted therapy has been the mainstay for advanced stage and also as a bridge therapy for resectable HCC. DISCUSSION: During the COVID-19 pandemic, online medical consultation is recommended to avoid social contact. Targeted therapy as a bridge therapy is recommended for resectable HCC considering the possibility of delayed surgery.


Assuntos
COVID-19 , Carcinoma Hepatocelular , Quimioembolização Terapêutica , Neoplasias Hepáticas , Carcinoma Hepatocelular/diagnóstico , Carcinoma Hepatocelular/epidemiologia , Carcinoma Hepatocelular/terapia , Humanos , Neoplasias Hepáticas/diagnóstico , Neoplasias Hepáticas/epidemiologia , Neoplasias Hepáticas/terapia , Pandemias , SARS-CoV-2 , Inquéritos e Questionários
10.
Plant Dis ; 2021 Jun 02.
Artigo em Inglês | MEDLINE | ID: mdl-34077248

RESUMO

Codonopsis pilosula Franch., also known as Dangshen, is an important medicinal plant in China. It is widely cultivated for a major income of local farmers in Dingxi, Gansu Province. Its dried roots have the effects of supplementing vital energy, nourishing spleen and lung, enhancing organic immunity, helping depressurization, and improving microcirculation, etc., for humans. In June to October, 2018-2020, root rot disease was observed on C. pilosula with incidences up to 20% in the Dingxi region. We collected ten diseased and healthy plants from Dingxi (35°06'N, 104°29'E, 2206 m a.s.l.) in October 2019. The rotting root tissues were sterilized with 70% ethanol for 30 s and 3% NaOCl for 5 min and placed on potato dextrose agar (PDA) plates incubated at 25℃to isolate the pathogen (Shang et al. 2014). From the similar fungal cultures isolated after 7 days on PGA, isolate B17 was purified for morphological and molecular characterization. Its colony appeared light purple and produced long aerial hyphae. Slightly curved macroconidia (12.3 to 31.7 × 3.1 to 5.1 µm, n=40) and oval-ellipsoid and cylindrical microconidia (6.1 to 9.9 × 2.8 to 4.5 µm, n=30) were observed. The internal transcribed spacer region (ITS) and the translation elongation factor-1 alpha (TEF-1α) gene were amplified using primers ITS1/ITS4 and EF-1/EF-2 (Uwaremwe et al. 2020), respectively. The 489 bp (ITS) and 631 bp (TEF-1α) sequences were deposited in GenBank (Accession No. MN744360 and MN786974, respectively). The ITS sequence had 100% homology to isolate JJF2 (No. MN626452, ITS) (Ma et al. 2020), and the TEF-1α sequence had 100% homology to isolate Fo353 (No. KM065860) (Koyyappurath et al. 2016) of Fusarium oxysporum Schlecht. emend. Snyder & Hansen, which caused root rot of Panax ginseng and Vanilla planifolia, respectively. A phylogenetic tree was generated using the unweighted pair-group method with arithmetic average in the MycoBank database (O'Donnell et al. 2015), which clustered isolate B17 in the F. oxysporum species complex. Twenty 1-year-old plants of C. pilosula were inoculated with were inoculated by dipping the washed roots in a conidial suspension (2 ×106 conidia/ml added with 0.2% Tween 20) for 20 min before transplanted into pots (16 × 16 × 23 cm) with four plants per pot filled with sterilized peat and soil mixture (2:1 v/v) and grown in a greenhouse at 26oC with >70% humidity and 16 h light. Sterilized water added with 0.2% Tween 20 was used as a control. One week after inoculation, the leaves of pathogen-inoculated plants became yellow, and wilting occurred at the leaf tips 18 days later. Some of the inoculated plants died 45 days after inoculation, and the low part of roots had dark brown to black lesions and became rotting. The control plants did not show symptoms. The pathogenicity test was repeated three times with the same fungus isolated from the infected root tissue. To the best of our knowledge, this is the first report that F. oxysporum causes root rot on C. pilosula in China. F. oxysporum is a serious threat to C. pilosula cultivation, and the finding of this pathogen provides a clear target for root rot control.

11.
Appl Opt ; 59(34): 10739-10745, 2020 Dec 01.
Artigo em Inglês | MEDLINE | ID: mdl-33361893

RESUMO

Careful quantification of the changes in biomechanical properties of the iris can offer insight into the pathophysiology of some ocular diseases. However, to date there has not been much information available regarding this subject because clinical detection for iris elasticity remains challenging. To overcome this limitation, we explore, for the first time to our knowledge, the potential of measuring iris elasticity using acoustic radiation force optical coherence elastography (ARF-OCE). The resulting images and shear wave propagation, as well as the corresponding shear modulus and Young's modulus from ex vivo and in vivo rabbit models confirmed the feasibility of this method. With features of noninvasive imaging, micrometer-scale resolution, high acquisition speed and real-time processing, ARF-OCE is a promising method for reconstruction of iris elasticity and may have great potential to be applied in clinical ophthalmology with further refinement.


Assuntos
Módulo de Elasticidade/fisiologia , Técnicas de Imagem por Elasticidade/métodos , Iris/fisiologia , Tomografia de Coerência Óptica/métodos , Animais , Fenômenos Biomecânicos , Iris/diagnóstico por imagem , Masculino , Imagens de Fantasmas , Coelhos , Som
12.
J Sci Food Agric ; 100(15): 5603-5616, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-32608519

RESUMO

BACKGROUD: The Lanzhou lily (Lilium davidii var. unicolor) is the only Lilium species that is used for both culinary and medicinal purposes in China. Its bulbs contain various bioactive substances, such as polysaccharides, saponins and colchicine. Lanzhou lily polysaccharides are known to have anti-immunity, anti-tumor and anti-oxidation functions. RESULTS: The present study used a Box-Behnken design to optimize the ultrasound-assisted extraction of Lanzhou lily polysaccharides. Compared to other enzymes, trypsin significantly increased the polysaccharide yields, whereas the protein content of polysaccharides extracted with trypsin was the lowest. Monosaccharide mainly includes glucose (> 50%) and mannose (> 10%). 1,1-Diphenyl-2-picrylhydrazyl radical scavenging activity, chelating activity, total antioxidant capacity and hydroxyl radical scavenging activity of Lanzhou lily polysaccharides extracted with trypsin were stronger than those extracted without enzymes (control). Structural characteristics of Lanzhou lily polysaccharides extracted with trypsin and extracted without enzymes were characterized by scanning electron microscopy and nuclear magnetic resonance spectroscopy. When water extracted polysaccharide and trypsin extracted polysaccharide concentrations were 200 µg mL-1 , Raw264.7 proliferation rates were 101.69% and 159.41%, respectively. CONCLUSION: The Lanzhou lily polysaccharide was identified as α-(1 → 6)-d-glucan. Consequently, the effects of both potential antioxidant and proliferative activity of trypsin are significant. © 2020 Society of Chemical Industry.


Assuntos
Antioxidantes/química , Lilium/química , Extratos Vegetais/química , Polissacarídeos/química , Antioxidantes/farmacologia , Linhagem Celular , Proliferação de Células/efeitos dos fármacos , Técnicas de Reprogramação Celular , China , Glucanos/química , Humanos , Extratos Vegetais/farmacologia , Raízes de Plantas/química , Polissacarídeos/farmacologia
13.
J Cell Biochem ; 120(7): 12002-12009, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-30825242

RESUMO

Pristimerin, a triterpenoid isolated from Celastraceae and Hippocrateaceae, is known to induce cytotoxicity in several cancer cell lines. However, whether pristimerin can induce apoptosis in cholangiocarcinoma cells and the underlying mechanism remain unexplored. We assessed the function of human cholangiocarcinoma QBC and RBE cell lines using various experimental methods such as the cell viability assay to elucidate the viability of cells, flow cytometry to detect the death rate of cells, and Western blot analysis to evaluate the expression of cell cycle-related proteins and autophagy-related proteins. Human cholangiocarcinoma QBC cells were transplanted to nude mice to establish an animal model, and the effect of pristimerin on tumor growth in this model was observed. QBC and RBE cell lines treated with pristimerin (0, 5, 10, and 20 µmol/L) demonstrated the induction of apoptosis in a dose-dependent manner. The cell viability assay revealed a reduction in the cell viability with an increase in the pristimerin concentration. Similarly, flow cytometry revealed a gradual increase in the cell death rate with an increase in the pristimerin concentration. In addition, pristimerin significantly lowered the expression of apoptosis-related proteins (Bcl-2, Bcl-xL, and procaspase-3), but increased the Bax expression. Furthermore, pristimerin resulted in the G0/G1 cell-cycle arrest, reducing the expression of cell cycle-related proteins (cyclin E, CDK2, and CDK4), and increased the expression of autophagy-related proteins (LC3) in QBC cell line. Treatment with pristimerin could inhibit tumor growth in the nude mouse model. Overall, this study suggests the potential effect of pristimerin on the cell-cycle arrest and apoptosis in human cholangiocarcinoma cells.

14.
Gut ; 67(11): 2006-2016, 2018 11.
Artigo em Inglês | MEDLINE | ID: mdl-29802174

RESUMO

OBJECTIVE: There is little evidence that adjuvant therapy after radical surgical resection of hepatocellular carcinoma (HCC) improves recurrence-free survival (RFS) or overall survival (OS). We conducted a multicentre, randomised, controlled, phase IV trial evaluating the benefit of an aqueous extract of Trametes robinophila Murr (Huaier granule) to address this unmet need. DESIGN AND RESULTS: A total of 1044 patients were randomised in 2:1 ratio to receive either Huaier or no further treatment (controls) for a maximum of 96 weeks. The primary endpoint was RFS. Secondary endpoints included OS and tumour extrahepatic recurrence rate (ERR). The Huaier (n=686) and control groups (n=316) had a mean RFS of 75.5 weeks and 68.5 weeks, respectively (HR 0.67; 95% CI 0.55 to 0.81). The difference in the RFS rate between Huaier and control groups was 62.39% and 49.05% (95% CI 6.74 to 19.94; p=0.0001); this led to an OS rate in the Huaier and control groups of 95.19% and 91.46%, respectively (95% CI 0.26 to 7.21; p=0.0207). The tumour ERR between Huaier and control groups was 8.60% and 13.61% (95% CI -12.59 to -2.50; p=0.0018), respectively. CONCLUSIONS: This is the first nationwide multicentre study, involving 39 centres and 1044 patients, to prove the effectiveness of Huaier granule as adjuvant therapy for HCC after curative liver resection. It demonstrated a significant prolongation of RFS and reduced extrahepatic recurrence in Huaier group. TRIAL REGISTRATION: NCT01770431; Post-results.


Assuntos
Carcinoma Hepatocelular/tratamento farmacológico , Misturas Complexas/uso terapêutico , Hepatectomia/efeitos adversos , Neoplasias Hepáticas/tratamento farmacológico , Idoso , Carcinoma Hepatocelular/mortalidade , Carcinoma Hepatocelular/cirurgia , Quimioterapia Adjuvante , Misturas Complexas/efeitos adversos , Feminino , Humanos , Fígado/patologia , Fígado/cirurgia , Neoplasias Hepáticas/mortalidade , Neoplasias Hepáticas/cirurgia , Masculino , Pessoa de Meia-Idade , Recidiva Local de Neoplasia/tratamento farmacológico , Análise de Sobrevida , Trametes , Resultado do Tratamento
15.
J Cell Physiol ; 233(10): 6661-6670, 2018 10.
Artigo em Inglês | MEDLINE | ID: mdl-29319182

RESUMO

The long non-coding RNA segment cancer susceptibility candidate 2 (CASC2) has been shown to suppress tumor growth in a variety of cancers, including hepatocellular carcinoma (HCC). However, the mechanism by which CASC2 exerts control over HCC has yet to be established. In the present study, we first demonstrated that CASC2 is downregulated in human HCC tissues and HCC cell lines as compared to adjacent non-tumor tissues (NTTs) and a liver cell line, respectively. After finding that CASC2 knockdown significantly promotes HCC cells migration and invasion as well as that CASC2 overexpression inhibits cell migration and invasion, we identified the microRNA miR-362-5p as an endogenous target of CASC2. Through the use of wild type and mutant CASC2 binding sites inserted into psiCHECK-2 luciferase reporter plasmids, as well as qRT-PCR, we determined that CASC2 overexpression reduces miR-362-5p expression levels, while inhibiting CASC2 activity increases miR-362-5p expression. Past research has shown that miR-362-5p stimulates the NF-κB pathway, which has been implicated in the survival and proliferation of a variety of cancer cells. We therefore investigated the effects of CASC2 expression on NF-κB pathway activity. Ultimately, we determined that CASC2 regulates HCC cell activity by targeting miR-362-5p and thus inhibiting the NF-κB pathway. The present study not only identifies CASC2 as an important HCC cell regulator, but also suggests its mechanism of action. It therefore provides the basis for designing strategies to target CASC2 activity and thereby inhibit HCC growth and progression.


Assuntos
Carcinoma Hepatocelular/genética , Neoplasias Hepáticas/genética , MicroRNAs/genética , RNA Longo não Codificante/genética , Apoptose/genética , Carcinogênese/genética , Carcinoma Hepatocelular/patologia , Movimento Celular/genética , Proliferação de Células/genética , Regulação Neoplásica da Expressão Gênica , Células Hep G2 , Humanos , Neoplasias Hepáticas/patologia , NF-kappa B/genética , Transdução de Sinais , Fator de Transcrição RelA/genética , Proteínas Supressoras de Tumor
16.
J Basic Microbiol ; 58(10): 892-901, 2018 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-30101457

RESUMO

Continuous cropping of lily (Lilium davidii var. unicolor) or any other crop seriously affects yield and quality. In this study, we compared continuous cropping with lily/maize intercropping. We also examined the lily rhizosphere microbes community in both sole lily cropping and lily/maize intercropping systems, by the llumina Miseq platform. Here we refer to data of recent years field experimentation of a lily/maize intercrop system in different planting configurations in the Gaolan Ecological and Agricultural Research Station. Treatments included sole crops of lily and maize, an intercrop consisting of strips of four lily rows alternating with one maize rows. The land equivalent ratio (LER) of intercrops was 1.294. The results showed that compared to sole cropping, the yield of lily in the first year of planting increased when lily was intercropped with maize. The species annotation of the high-throughput sequencing experiment showed that there was no difference in the diversity of the lily rhizosphere soil microbes on phylum taxonomic level, but the relative abundance of some genus changed obviously. The relative abundance of harmful fungus Fusarium spp. and, Funneliformis spp., decreased, and the relative abundance of beneficial bacteria Sphingomonas spp. and, Nitrospira spp., increased. In addition, we found that Lecanicillium spp., appeared only in the intercropping lily rhizosphere soil and sole cropping maize rhizosphere soil. In conclusion, the findings indicated that lily/maize intercropping could change soil microenvironment, and affect the diversity and structure of microorganism community in lily rhizosphere, with further beneficial effect on the yield of lily.


Assuntos
Agricultura/métodos , Produtos Agrícolas/crescimento & desenvolvimento , Produtos Agrícolas/microbiologia , Lilium , Rizosfera , Microbiologia do Solo , Zea mays , Bactérias/classificação , Bactérias/genética , Bactérias/isolamento & purificação , Biodiversidade , Biomassa , China , Fungos/classificação , Fungos/genética , Fungos/isolamento & purificação , Raízes de Plantas/microbiologia , RNA Ribossômico/genética , Solo/química
17.
Int J Mol Sci ; 19(12)2018 Nov 29.
Artigo em Inglês | MEDLINE | ID: mdl-30501023

RESUMO

Bacillus amyloliquefaciens FZB42 is a plant growth-promoting rhizobacteria that stimulates plant growth, and enhances resistance to pathogens and tolerance of salt stress. Instead, the mechanistic basis of drought tolerance in Arabidopsis thaliana induced by FZB42 remains unexplored. Here, we constructed an exopolysaccharide-deficient mutant epsC and determined the role of epsC in FZB42-induced drought tolerance in A. thaliana. Results showed that FZB42 significantly enhanced growth and drought tolerance of Arabidopsis by increasing the survival rate, fresh and dry shoot weights, primary root length, root dry weight, lateral root number, and total lateral root length. Coordinated changes were also observed in cellular defense responses, including elevated concentrations of proline and activities of superoxide dismutase and peroxidase, decreased concentrations of malondialdehyde, and accumulation of hydrogen peroxide in plants treated with FZB42. The relative expression levels of drought defense-related marker genes, such as RD29A, RD17, ERD1, and LEA14, were also increased in the leaves of FZB42-treated plants. In addition, FZB42 induced the drought tolerance in Arabidopsis by the action of both ethylene and jasmonate, but not abscisic acid. However, plants inoculated with mutant strain epsC were less able to resist drought stress with respect to each of these parameters, indicating that epsC are required for the full benefit of FZB42 inoculation to be gained. Moreover, the mutant strain was less capable of supporting the formation of a biofilm and of colonizing the A. thaliana root. Therefore, epsC is an important factor that allows FZB42 to colonize the roots and induce systemic drought tolerance in Arabidopsis.


Assuntos
Arabidopsis/microbiologia , Arabidopsis/fisiologia , Bacillus amyloliquefaciens/fisiologia , Secas , Arabidopsis/metabolismo , Biofilmes/crescimento & desenvolvimento , Regulação da Expressão Gênica de Plantas , Malondialdeído/metabolismo , Peroxidase/metabolismo , Reguladores de Crescimento de Plantas/metabolismo , Proteínas de Plantas/metabolismo , Polissacarídeos Bacterianos/metabolismo , Superóxido Dismutase/metabolismo
18.
Opt Express ; 25(7): 7592-7603, 2017 Apr 03.
Artigo em Inglês | MEDLINE | ID: mdl-28380879

RESUMO

We propose a novel scheme to generate the entanglement between two cavity optomechanical systems (COMSs) via a flying two-level atom. We derive the analytical expressions for the generated entangled states. We find that there exist two processes for generating entanglement: one is the entanglement transfer between the two phonon-modes, and the other is the entanglement swapping-like process among the two photon-modes and the two phonon-modes. We analyze these two kinds of phenomena, respectively, by adjusting the distance between the two COMSs. Then we discuss the verification of the generated entangled states of the two COMSs, and analyze the decoherence of the generated entangled states. Finally, we discuss the experimental feasibility of our proposal.

19.
Cell Biochem Funct ; 35(5): 254-259, 2017 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-28749078

RESUMO

The mechanism of pituitary gland tumour (PGT) is unclear. Aberrant immune tolerance is associated with the pathogenesis of tumour. Vitamin D and vitamin D receptor (VDR) are involved in the immune regulation. Interleukin (IL)-10 is one of the important immune regulatory molecules. This study aims to elucidate the role of VDR in the regulation of IL-10 in peripheral B cells of PGT patients. In this study, the peripheral blood samples were collected from PGT patients and healthy subjects. B cells were purified from the blood samples and analysed by RT-qPCR and Western blotting. The correlation between the expression of IL-10 and VDR in the B cells was assessed. We observed that the serum VitD levels were negatively correlated with IL-10 expression in peripheral B cells of patients with PGT. Low levels of VDR expression were found in peripheral B cells of PGT patients. Exposure to VitD suppressed the expression of IL-10 in B cells. The VDR bounds the transcription factor of IL-10 to interfere with the expression of IL-10 in B cells. The VDR agonists inhibited IL-10 expression in B cells from PGT patients. In conclusion, modulation of the expression of VDR can regulate the expression of IL-10 in peripheral B cells of PGT patients, which may contribute to the treatment of PGT.


Assuntos
Linfócitos B/metabolismo , Interleucina-10/genética , Neoplasias Hipofisárias/genética , Receptores de Calcitriol/genética , Adulto , Linfócitos B/patologia , Calcitriol/administração & dosagem , Feminino , Regulação Neoplásica da Expressão Gênica , Humanos , Interleucina-10/biossíntese , Masculino , Pessoa de Meia-Idade , Neoplasias Hipofisárias/sangue , Neoplasias Hipofisárias/patologia , Receptores de Calcitriol/biossíntese , Receptores de Calcitriol/sangue , Vitamina D/sangue , Vitamina D/genética , Deficiência de Vitamina D/sangue , Deficiência de Vitamina D/genética , Deficiência de Vitamina D/patologia
20.
Sensors (Basel) ; 17(5)2017 May 05.
Artigo em Inglês | MEDLINE | ID: mdl-28475168

RESUMO

Backfill mining is an effective option to mitigate ground subsidence, especially for mining under surface infrastructure, such as buildings, dams, rivers and railways. To evaluate its performance, continual long-term field monitoring of the deformation of backfilled gob is important to satisfy strict public scrutiny. Based on industrial Ethernet, a real-time monitoring system was established to monitor the deformation of waste-rock-backfilled gob at -700 m depth in the Tangshan coal mine, Hebei Province, China. The designed deformation sensors, based on a resistance transducer mechanism, were placed vertically between the roof and floor. Stress sensors were installed above square steel plates that were anchored to the floor strata. Meanwhile, data cables were protected by steel tubes in case of damage. The developed system continually harvested field data for three months. The results show that industrial Ethernet technology can be reliably used for long-term data transmission in complicated underground mining conditions. The monitoring reveals that the roof subsidence of the backfilled gob area can be categorized into four phases. The bearing load of the backfill developed gradually and simultaneously with the deformation of the roof strata, and started to be almost invariable when the mining face passed 97 m.

SELEÇÃO DE REFERÊNCIAS
Detalhe da pesquisa