Fast detection of Southern tomato virus by one-step transcription loop-mediated isothermal amplification (RT-LAMP).

Southern tomato virus (STV) is a double stranded RNA (dsRNA) virus belonging to genus Amalgavirus (family Amalgamaviridae) which has been detected in tomato plants showing stunting, fruit discoloration and size reduction. A one-step reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the detection of STV in total RNA or sap extracts (obtained just by grinding in buffer) from STV-infected tomato plants by using a set of three primers pairs which were designed to the sequence of the STV putative coat protein. Amplification products were visualized by gel electrophoresis or direct staining of DNA. The sensitivity of RT-LAMP was identical to that of the conventional RT-PCR and less affected by the presence of polymerase inhibitors. STV was detected by RT-LAMP in different tomato tissues, i.e. leaves, roots, fruits and seeds. Also the virus was successfully detected by RT-LAMP from sap extracts obtained from field tomato plants whereas conventional RT-PCR did not. Results of this work show that RT-LAMP is a specific, rapid and cheap procedure to detect STV and it could be implemented on field surveys and sanitation programs.

First Report of Pepper vein yellows virus Infecting Hot Pepper in Sudan.

In two successive winters (2009 and 2010), 14 hot pepper (Capsicum annuum) samples showing unusual symptoms were surveyed in permanently irrigated seasonal vegetable gardens along the Blue Nile in central Sudan (specifically in Gezira State). Symptoms included leaf curling, leaf deformation, reduced leaf size, leaf puckering, interveinal yellowing, vein clearing, or yellow patches. Total RNA was extracted from symptomatic leaves and analyzed by reverse transcription (RT)-PCR with degenerate primer pairs that amplify different viral species within the family Luteoviridae (1). Amplification of a 340-bp fragment of the coat protein gene (CP) was obtained in all the collected samples analyzed. The amplified fragments were purified and sequenced (Accession Nos. KC685313 to 26), showing 99, 97, and 95 to 99% nucleotide identities to Pepper yellows virus (PYV, accession no. FN600344 from Turkey), Pepper vein yellows virus (PeVYV, AB594828 from Japan) and Pepper yellow leaf curl virus (PYLCV, HM439608 from Israel), respectively. These three viruses belong to the genus Polerovirus and are considered synonyms of the same virus species PeVYV described with those names in different countries (3). Two samples were also tested by RT-PCR with the general Polerovirus primer pair Pol-G-F and Pol-G-R, which amplified a 1.1-kb product spanning the 3' half of the RNA-dependent RNA polymerase (RdRp) to the 5' half of CP and movement protein (2). The amplified fragments (KC692834 and KC692833) showed 97, 96, and 95% nt identity with PYV (FN600344), PeVYV (JX427533), and PYLCV (HM439608), respectively. The presence of the recently described Polerovirus PeVYV is the first report of detection in pepper in Sudan. PeVYV has recently been identified in seven other countries (India, Indonesia, Mali, the Philippines, Spain, Taiwan, and Thailand) and on one new host, Solanum nigrum, which suggests this new Polerovirus species poses a potentially wide geographical distribution and a global threat for pepper crops (3,4). References: (1) A. D. Abraham et al. Afr. J. Biotechnol. 7:414, 2008. (2) D. Knierim et al. Plant Pathol. 59:991, 2010. (3) D. Knierim et al. Arch. Virol. 158:1337, 2013. (4) F. Villanueva et al. Plant Dis. 97:1261, 2013.

First Report of Olpidium bornovanus and O. virulentus on Melon in Italy.

A survey for the presence of Olpidium spp. on melon (Cucumis melo L.) was conducted during the beginning of 2013 in central Italy in an unheated greenhouse, located in the melon-producing coastal area of north Latium (central Italy, Viterbo Province) (42°23'09.31″N, 11°30'46.10″E) with a history of monosporascus root rot and vine decline (MRRVD). For this aim, 10 soil samples were collected adjacent to the roots of plants symptomatic of MRRVD, represented by root lesions and rots and loss of smaller feeder roots. Olpidium was baited from collected infested soil by growing melon (cv. Dinero) plants for 45 days. Bait plants grown in sterilized soil were used as negative controls. All the baited melon roots were analyzed by morphological and molecular methods. For the morphological analysis, feeder roots were clarified in a 1.5% KOH solution for 24 h (2) and observed under a light microscope to record the presence or absence of sporangia and resting spores of Olpidium spp., which were observed in baited melon plants grown in infested soil and not in control roots. In particular, stellate resting spores were referred to as O. virulentus because this species cannot be distinguished from O. brassicae, which does not colonize melon. O. bornovanus had smooth-walled resting spores with a honeycomb-like pattern (2). For molecular analysis, DNA was extracted from 21 melon roots and tested by multiplex PCR to confirm Olpidium spp. identification (2). Based on molecular identification, O. virulentus was identified in 40% of samples, and O. bornovanus was identified in 10%. There were no mixed infections in the same sample. Two amplified PCR products, corresponding to O. bornovanus and O. virulentus expected fragment sizes of 977 and 579 bp respectively, were sequenced (GenBank Accession Nos. KF661295 and KF661296). BLAST analysis of the sequences showed 99% nucleotide identity with O. bornovanus isolate CH from Japan collected in melon roots (AB205215) and O. virulentus isolate HY-1 from Japan collected in lettuce roots as reported by Sasaya and Koganezawa (3) (AB205204, formerly O. brassicae). At the end of the experiment, the root systems of all inoculated plants appeared brown, whereas neither symptoms nor sporangia and resting spores were observed in roots of control plants. Olpidium spp. are root-infecting plant pathogens of melon (4), acting as vectors of Melon necrotic spot virus (MNSV) and other destructive plant viruses (1). Moreover, they are directly involved in the induction of germination of ascospores of Monosporascus cannonballus, the causal agent of MRRVD of cucurbits (4). To our knowledge, this is the first report of O. virulentus and O. bornovanus on melon in Italy. References: (1) A. Alfaro-Fernández et al. J. Phytopathol. 91:1250, 2009. (2) J. A. Herrera-Vásquez et al. Mycol. Res. 113:602, 2009. (3) T. Sasaya and H. Koganezawa. J. Gen. Plant Pathol. 72:20, 2006. (4) M. E. Stanghellini and I. J. Misaghi. Phytopathology 101:794, 2011.

First Report of Pepper vein yellows virus Infecting Sweet Pepper in Spain.

In November 2012, unusual symptoms were observed in plants of sweet pepper (Capsicum annuum L.) grown in commercial greenhouses of Almería Province, southeastern Spain. Symptoms included interveinal yellowing, upward leaf curling, and internode shortening, and were more evident in the upper part of the plant. Abnormal ripening of fruits was observed in symptomatic plants, with fruits remaining orange in the red varieties and yellow in the orange varieties, thus reducing their marketability. During December 2012 and January 2013, severe outbreaks of this disease syndrome occurred, with many greenhouses exhibiting almost 100% incidence. The symptoms observed were similar to those reported for isolates of Pepper vein yellows virus (PeVYV, genus Polerovirus, family Luteoviridae) (previously also named Pepper yellow leaf curl virus [PYLCV] and Pepper yellows virus [PYV]) (2,4). Twenty five symptomatic leaf and/or fruit samples (some of them supplied by Zeraim Ibérica, S.A.), each from a different greenhouse, were analyzed and all reacted positively in double-antibody sandwich-ELISA with an antiserum against the polerovirus Cucurbit aphid-borne yellows virus (CABYV) (Sediag, Longvic, France), known to cross-react with PeVYV (2). Total RNA was extracted by TRIsure reagent (Bioline, London, United Kingdom) from symptomatic leaves and analyzed by reverse transcription (RT)-PCR with primers Pol-G-F (5'-GAYTGCTCYGGYTTYGACTGGAG-3') and Pol-G-R (5'-GATYTTATAYTCATGGTAGGCCTTGAG-3') designed for universal detection of poleroviruses by amplifying the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) partial genes (3). DNA fragments of the expected size (1.1 kbp) were amplified supporting a polerovirus infection in all the analyzed samples. The PCR product obtained from one sample (Almería-1) was extracted from agarose gel with a QIAquick gel extraction kit (Qiagen, Hilden, Germany), cloned in pGEM-T Easy vector (Promega, Madison, WI), and one clone was sequenced (Macrogen Inc., Seoul, South Korea). The PCR products amplified from three other samples (2-13, 7-13, and 8-13) were directly sequenced. The nucleotide identity between the amplified fragments (GenBank Accession Nos. KC769487, KC839992 to 94), calculated after alignment with ClustalW, was 99.7 to 100%. The highest nucleotide identity of the Spanish sequences was with a PeVYV isolate from Turkey (FN600344, named as PYV) (98.5 to 98.7%). The spread of PeVYV in Spain is additional evidence of the emergence of this virus as a global threat for pepper crops after its first detection in Japan in 1995 and recent reports from the Mediterranean Basin (1,2). References: (1) N. Buzkan et al. Arch. Virol. 158:881, 2013. (2) A. Dombrovsky et al. Phytoparasitica 38:477, 2010. (3) D. Knierim et al. Plant Pathol. 59:991, 2010. (4) R. Murakami et al. Arch. Virol. 156:921, 2011.

'Candidatus Liberibacter solanacearum' Associated with Bactericera trigonica-Affected Carrots in the Canary Islands.

In 2009 and 2010, commercial carrot (Daucus carota L.) fields located in Tenerife (Canary Islands, Spain) showed symptoms of curling, yellow, bronze, and purple discoloration of leaves, stunting of shoots and tap roots, and proliferation of secondary roots. A large population of the psyllid Bactericera trigonica was noted in those fields. Similar symptoms were reported previously in carrot-production areas of the Canary Islands and mainland Spain that were associated with stolbur and aster yellows (1997 and 1998) (2) and Spiroplasma citri and phytoplasmas (2009 and 2010) (1). These symptoms were also reported in southern Finland in 2008 and associated with 'Candidatus Liberibacter solanacerum' (4). Studies were conducted to investigate whether these pathogens and the psyllid B. trigonica were associated with the observed symptoms in carrot in Tenerife. A total of 18 petiole samples of symptomatic carrots were collected (13 samples in 2009 and 5 samples 2010). Five asymptomatic plants were also sampled. Three samples of psyllids (five individuals grouped) collected from one affected field in 2010 were also included in the assay. Total DNA was extracted with the DNeasy Plant Mini Kit (Qiagen, Valencia, CA), and analyzed by nested-PCR assays using primer pairs P1/P7 and R16F2n/R16R2n for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 for S. citri detection as described previously (3). PCR was performed using primer pairs OA2/OI2c and CL514F/R to amplify a portion of 16S rDNA and rplJ/rplL ribosomal protein genes, respectively, for 'Ca. L. solanacearum' (4). S. citri and phytoplasmas were not detected in any of the studied samples. However, a 1,168-bp 16S rDNA fragment and a 669-bp rplJ/rplL fragment were amplified from DNA from 16 symptomatic carrot samples and three psyllid grouped samples using specific primers for 'Ca. L. solanacearum'. No DNA was amplified from the asymptomatic samples. These results indicate the presence of 'Ca. L. solanacearum' in the affected carrot and psyllid samples collected in Tenerife (Canary Islands). Four and one PCR products obtained from DNA of carrot and psyllid samples, respectively, with both primer pairs were sequenced. BLAST analysis of the 16S rDNA sequences obtained from infected carrots (GenBank Accession Nos. HQ454312, HQ454313, HQ454314, and HQ454315) and psyllids (HQ454316) showed 99% identity to those of 'Ca. L. solanacearum' amplified from carrot in Finland (GU373049) and B. cockerelli (EU812557). The rplJ/rplL nucleotide sequences obtained from infected carrots (Accession Nos. HQ454317, HQ454318, HQ454319, and HQ454320) and psyllid (HQ454321) were 98% identical to the analogous rplJ/rplL 'Ca.L. solanacearum' ribosomal protein gene from carrot (GU373051) in Finland and tomato (EU834131) from New Zealand. To our knowledge, this is the first report of 'Ca. L. solanacearum' associated with psyllid-affected carrots in the Canary Islands (Tenerife, Spain) and also the first report of this plant pathogen associated with B. trigonica. References: (1) M. C. Cebrián et al. Plant Dis. 94:1264, 2010. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:405, 1999. (3) I.-M. Lee et al. Plant Dis. 90:989, 2006. (4) J. E. Munyaneza et al. Plant Dis. 94:639, 2010.

First Report of 'Candidatus Liberibacter solanacearum' in Carrot in Mainland Spain.

In the summer of 2008, symptoms of leaf curling with yellow, bronze, and purple discoloration, twisting of petioles, stunting of shoots and tap roots, and proliferation of secondary roots were observed in 18 commercial carrot (Daucus carota L.) fields (~62 ha) severely infested with psyllids (mainly Bactericera sp.) from 52 fields (297 ha) located in Alicante and Albacete provinces of Spain. Incidence of symptomatic plants was variable among fields. Similar symptoms were observed in 2009, 2010, and 2011. Symptoms resembled those associated with phytoplasma, spiroplasma, or the bacterium 'Candidatus Liberibacter solanacearum' infections in carrot (1-4). Aster yellows and stolbur phytoplasmas and Spiroplasma citri have previously been reported from carrot in mainland Spain but liberibacter infection has not been documented in this region (1). Studies were conducted to determine if 'Ca. L. solanacearum' was associated with the symptoms. Petiole samples of symptomatic carrot plants were collected in 2009 (25 from 9 fields in Alicante and Albacete provinces) and early 2010 (21 from 8 fields in Alicante, Albacete, and Valencia provinces) from symptomatic fields where incidence ranged from 50 to 90%. In addition, one sample collected in 2008 in Alicante was included in the assay. Also, samples were collected from five asymptomatic carrot plants. Total DNA was extracted from 0.5 g of petiole tissue of each sample with the CTAB extraction buffer method (3,4). DNA extractions were analyzed by PCR assay using primer pairs OA2/OI2c and CL514F/R to amplify a portion of 16S rDNA and rplJ/rplL ribosomal protein genes, respectively, of 'Ca. L. solanacearum' (3,4). DNA samples were also tested for phytoplasmas and S. citri by nested-PCR assays using primer pairs P1/P7 followed by R16F2n/R16R2n and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2, respectively (2). A 1,168-bp fragment of 16S rDNA was detected in DNA extracted from 1, 12, and 12 symptomatic samples collected in 2008, 2009, and 2010, respectively, suggesting the presence of 'Ca. L. solanacearum' in the carrot samples. A 669-bp rplJ/rplL fragment also was amplified from DNA of the same samples. Liberibacter was not detected in asymptomatic plants. Eight and two samples were infected with S. citri and aster yellows phytoplasmas, respectively. Three samples were infected with S. citri and 'Ca. L. solanacearum' and one sample was infected with all three pathogens. Three amplicons obtained from the PCR assays with both primer pairs from carrot samples collected in 2009 and 2010 were sequenced directly. BLAST analysis of the 16S rDNA sequences (GenBank Nos. HQ454302, HQ454303, and HQ454304) showed 99% nucleotide identity to those of 'Ca. L. solanacearum' amplified from carrot in Finland (GU373049). The rplJ/rplL nucleotide sequences (HQ454305, HQ454306, and HQ454307) were 97% identical to sequences of the analogous rplJ/rplL 'Ca. L. solanacearum' ribosomal protein gene from carrot in Finland (GU373051). To our knowledge, this is the first report of 'Ca. L. solanacearum' in carrot in mainland Spain and also the first evidence of mixed infections of S. citri, 'Ca. L. solanacearum', and phytoplasmas in carrot. References: (1) M. C. Cebrián et al. Plant Dis. 94:1264, 2010. (2) I.-M. Lee et al. Plant Dis. 90:989, 2006. (3) J. E. Munyaneza et al. J. Econ. Entomol. 103:1060, 2010. (4) J. E. Munyaneza et al. Plant Dis. 94:639, 2010.

Genetic variability and evolutionary analyses of the coat protein gene of Tomato mosaic virus.

Tomato mosaic virus (ToMV), a member of the genus Tobamovirus, infects several ornamental and horticultural crops worldwide. In this study, the nucleotide sequences of the coat protein gene of worldwide ToMV isolates were analyzed to estimate the genetic structure and diversity of this virus and the involved evolutionary forces. The phylogenetic analysis showed three clades with high bootstrap support: Clade I contained three ToMV isolates from Brazil collected from pepper, Clade II comprised one Brazilian ToMV isolate from pepper, and Clade III was composed of ToMV isolates collected from different plant hosts (pepper, tomato, eggplant, lilac, camellia, dogwood, red spruce, etc.) and water (from melting ice, lakes and streams) from different countries: USA, Brazil, Korea, Germany, Spain, Denmark (Greenland), China, Taiwan, Malaysia, Iran, and Kazakhstan. With the exception of Brazil, nucleotide diversity within and between different geographic regions was very low, although statistical analyses suggested some gene flow between most of these regions. Our analyses also suggested a strong negative selection which could have contributed to the genetic stability of ToMV.

First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain.

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5' TATGCGAGAATTGGGAGTGGGTAGT 3') and EMDV-R (5' CATTGTTATCCCGGGAAGTATTT 3') targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

First Report of Spiroplasma citri in Carrot in Europe.

In 2008 and 2009, symptoms of curling, yellow and purple discoloration of leaves, stunting of shoots and tap roots, and formation of bunchy, fibrous secondary roots were observed in commercial carrot (Daucus carota L.) fields located in several production areas of Spain (Alicante, Albacete, Segovia, and Valladolid). Incidence of this disease was almost 100% in individual affected fields. Similar symptoms were reported from 1997 to 1998 in various carrot production areas of Spain (the Canary Islands, Segovia, and Madrid) and were associated with infection of stolbur and aster yellows phytoplasmas (2). Moreover, the observed symptoms resembled those caused by Spiroplasma citri in carrots affected by the carrot purple leaf disease recently reported in the United States (4). Studies were conducted to investigate whether S. citri and phytoplasmas were associated with the observed carrot symptoms. Total DNA was extracted from 0.5 g of phloem tissue of 13 symptomatic and 3 asymptomatic plants with DNeasy Plant Mini Kit (Qiagen, Valencia, CA). DNA samples were analyzed by nested-PCR assays using primers pair P1/P7 (1) and R16F2n/R16R2n (3) for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 (4) for S. citri detection. DNA of a known strain of S. citri (Sediag, Longvic, France) was used as a positive control of the assay. Analyses revealed that 8 of the 13 symptomatic plants tested positive for S. citri; the plants were collected from three different provinces of Spain, namely, Alicante, Valladolid, and Segovia. Two symptomatic plants were double infected by S. citri and a phytoplasma strain belonging to the Aster yellows group (16SrI), subgroup 16SrI-A. However, none of the symptomatic plants presented single infection with phytoplasmas. S. citri identity was determined by sequencing two nested PCR products (1.1 kb) that yielded identical sequences deposited in the GenBank database (Accession Nos. HM124555 and HM124556). BLAST analysis showed 100% nt identity with a sequence of S. citri from carrot (Accession No. DQ112019) associated with the new carrot disease referred to as 'carrot purple leaf reported in Washington State (4). To our knowledge, this is the first report of S. citri associated with carrot in Europe. References: (1) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:415, 1999. (3) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (4) I. M. Lee et al. Plant Dis. 90:989, 2006.

First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama.

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5'-CCTCCGCGGATGCTAACTT-3' and CMV-R 5'-CGGAATCAGACTGGGAGCA-3') and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tomato torrado virus Infecting Tomato in Hungary.

During the growing seasons of 2007 and 2008, in commercial greenhouses of tomato crops (Solanum lycopersicum L.) located in Szeged, Öcsöd, and Csongrád (southeastern regions of Hungary), unusual disease symptoms were observed, including necrotic spots in defined areas at the base of the leaflet, necrosis in the stems, and necrotic lines on the fruits surface. Affected plants appeared inside the greenhouses with a random distribution and the incidence recorded was at least 40%. These symptoms resembled those described for Tomato torrado virus (ToTV) infection in Spain (1) and Poland (3). To verify the identity of the disease, three symptomatic plants from commercial greenhouses of each geographic location were selected and analyzed by double-antibody sandwich-ELISA using polyclonal antibodies specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted and tested by reverse transcription (RT)-PCR with three pair of specific primers: one pair used to amplify the coat protein (CP) gene of PepMV (2) and the other two pairs specific to ToTV that amplify 580 bp of the polyprotein (4) and a fragment of 574 bp in the CP Vp23 (3). Nonisotopic dot-blot hybridization using a digoxygenin-labeled RNA probe complementary to the aforementioned fragment of the polyprotein was also performed. Tomato samples were negative for all the viruses tested by serological analysis and for PepMV by RT-PCR. However, all three samples were positive for ToTV by molecular hybridization and RT-PCR. RT-PCR products were purified and directly sequenced. The amplified fragments of the three Hungarian isolates, ToTV-H1, ToTV-H2, and ToTV-H3, for the polyprotein (GenBank Accession Nos. EU835496, FJ616995, and FJ616994, respectively) and the CP Vp23 (GenBank Accession Nos. FJ616996, FJ616997, and FJ616998, respectively) showed 99 to 98% nt identity with the polyprotein and the coat protein regions of ToTV from Spain and Poland (GenBank Accession Nos. DQ3888880 and EU563947, respectively). Whiteflies, commonly found in Hungarian greenhouses, have been reported to transmit ToTV (3), although the efficiency of transmission is unknown. To our knowledge, this is the first report of ToTV in Hungary. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization. WO/2006/085749, 2006.

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia.

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5' GATGAAGCTGAACAACATTTC 3' and PepTGB-R: 5' GGAGCTGTATTRGGATTTGA 3'). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

First Report of Alfalfa mosaic virus in Viburnum lucidum in Spain.

Viburnum sp. is an ornamental shrub widely used in private and public gardens. It is common in natural wooded areas in the Mediterranean Region. The genus includes more than 150 species distributed widely in climatically mild and subtropical regions of Asia, Europe, North Africa, and the Americas. In January 2007, yellow leaf spotting in young plants of Viburnun lucidum was observed in two ornamental nurseries in the Mediterranean area of Spain. Symptoms appeared sporadically depending on environmental conditions but normally in cooler conditions. Leaf tissue from 24 asymptomatic and five symptomatic plants was sampled and analyzed by double-antibody sandwich (DAS)-ELISA with specific polyclonal antibodies against Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany) and Alfalfa mosaic virus (AMV) (SEDIAG S.A.S, Longvic, France). All symptomatic plants of V. lucidum were positive for Alfalfa mosaic virus (AMV). The presence of AMV was tested in the 29 samples by one-step reverse transcription (RT)-PCR with the platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) using primers derived from a partial fragment of the coat protein gene of AMV (2). The RT-PCR assays produced an expected amplicon of 700 bp in the five symptomatic seropositive samples. No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR assays. One PCR product was purified (High Pure PCR Product Purification Kit; Roche Diagnostics, Mannheim, Germany) and directly sequenced (GenBank Accession No. EF427449). BLAST analysis showed 96% nucleotide sequence identity to an AMV isolate described from Phlox paniculata in the United States (GenBank Accession No. DQ124429). This virosis has been described as affecting Viburnum tinus L. in France (1). To our knowledge, this is the first report of natural infection of Viburnum lucidum with AMV in Spain, which might have important epidemiological consequences since V. lucidum is a vegetatively propagated ornamental plant. References: (1) L. Cardin et al. Plant Dis. 90:1115, 2006. (2) Ll. Martínez-Priego et al. Plant Dis. 88:908, 2004.

First Report of Pea enation mosaic virus Infecting Pea and Broad Bean in Spain.

During the spring of 2007, pea plants (Pisum sativum L.) (cvs. Utrillo and Floreta) showing virus-like symptoms were observed in several commercial fields in the southern and eastern regions of Catalonia, Spain. Incidence of symptomatic plants ranged from 5 to 15% and was distributed in both small and large patches. Infected plants exhibited yellow mosaic leaf symptoms that later became translucent. Leaves gradually curled and in some cases developed enations near the veins on the abaxial surface. Plants were "bushy" and had shortened internodes. Infection prior to pod formation resulted in pods that were distorted and stunted (1). The infected leaves and pods were tested by indirect-ELISA with a potyvirus-specific antibody (Agdia, Elkhart, IN) and double-antibody sandwich (DAS)-ELISA with antibodies specific to Pea enation mosaic virus (PEMV), Broad bean wilt virus 1 (BBWV-1), Beet western yellow virus (BWYV), Bean yellow mosaic virus (BYMV), Alfalfa mosaic virus (AMV), and Tomato spotted wilt virus (TSWV) (Loewe Biochemica GmbH, Sauerlach, Germany). PEMV was detected in all 24 symptomatic samples that were collected from 10 locations between March 2007 and March 2008. Thirteen of these samples also tested positive for BWYV, but no differences in symptom expression were observed in plants infected with both viruses or PEMV alone. PEMV was also identified in seven broad bean plants (Vicia faba L.) from three additional locations. These plants expressed interveinal yellow mosaic on leaves and deformed pods. The genomic sequence of PEMV-1 (GenBank Accession No. L04573) was used to design primers to amplify a 451-nt segment of the polymerase gene by reverse transcription (RT)-PCR; PEMV-D (5'-TGACCATGAGTCCACTGAGG-3'), PEMV-R (5'-AGTATCTTCCAACAACCACAT-3'). One ELISA-positive sample was analyzed and the expected size amplicon was generated. Direct sequencing (GenBank Accession No. EU652339) revealed that PEMV-1 and our pea isolate have nucleotide sequence identities of 95%. To our knowledge, this is the first report of PEMV in Spain, which might cause important economical losses since PEMV is an important viral disease of pea and other legumes worldwide. Reference: (1) J. S. Skaf and G. A. Zoeten. No. 372 (No. 257 revised) in: Description of Plant Viruses. AAB, Kew, Surrey, England, 2000.

First Report of Tomato torrado virus on Weed Hosts in Spain.

Tomato torrado virus (ToTV) is a recently identified Picorna-like virus that causes "torrado disease" in tomatoes (4). Typical symptoms of "torrado disease" seen in tomato crops (Solanum lycopersicum L. formerly Lycopersicon esculentum L.) were initially defined as yellow areas at the base of the leaflet that later developed into necrotic spots that sometimes abscised, leaving holes in the leaflet. Other plants showed extensive necrosis progressing from the base to the tip of the leaflet. Fruits were distorted with necrotic lines on the surface that often cracked. Affected plants had a burnt-like appearance and the production was seriously reduced. These symptoms have been observed in tomato crops in Murcia (Spain) and the Canary Islands (Spain) (1). To identify possible alternative hosts that may serve as virus reservoirs, samples of 72 different common weed species were collected in greenhouses in Murcia and the Canary Islands where "torrado disease" symptoms were observed in tomatoes. Forty-seven showed virus-like symptoms and 25 were asymptomatic. Symptoms included mild mosaic, blistering, vein clearing, interveinal yellowing, yellow spots, necrosis, leaf distortion, and curling. Samples were analyzed by one-step reverse transcription (RT)-PCR using primers specific for ToTV to amplify 580 bp of the polyprotein region of RNA2 (3) and dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the same portion of the ToTV genome. Twenty-two of the 72 weed samples belonging to Amaranthus sp. (Amaranthaceae); Spergularia sp. (Caryophyllaceae); Atriplex sp., Chenopodium ambrosioides L., Chenopodium sp., and Halogetum sativus (Loef. ex L.) Moq. (Chenopodiaceae); Senebiera didyma Pers. (Cruciferae); Malva sp. (Malvacae); Polygonum sp. (Polygonaceae); and Nicotiana glauca Graham and Solanum nigrum L. (Solanaceae) were positive for ToTV by molecular hybridization (10 samples) and RT-PCR (22 samples, including the samples positive by molecular hybridization). PCR products obtained from Atriplex sp. (Canary Islands) and S. didyma (Murcia) were sequenced (GenBank Accessions EU090252 and EU090253). BLAST analysis showed 99% identity to ToTV RNA2 sequence (GenBank Accession DQ388880). Two tomato plants were positive for ToTV by RT-PCR after mechanical back-inoculation, although no symptoms were observed. This study showed ToTV infects common weeds present in Spanish tomato crops. Recently, Trialeurodes vaporariorum has been reported to transmit ToTV (2), although the efficiency of transmission is unknown. The vector-assisted transmission of ToTV could explain the infection of weeds in affected greenhouses. To our knowledge, this is the first report of natural infection of weeds by ToTV. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (3) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization WO/2006/085749, 2006. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tomato torrado virus in Tomato in the Canary Islands, Spain.

In 2003, greenhouse-grown tomato crops (Lycopersicon esculentum Mill.) in the Canary Islands (Spain) were observed showing an initial yellowing in defined areas at the base of the leaflet that later developed into necrotic spots or an extensive necrotic area progressing from the base to tip. Fruits were also affected, showing necrotic areas and often developing cracking. Generally, the plants that were affected seemed to be burnt, their growth was reduced, and the production level was seriously damaged. Similar symptoms have been observed in Murcia (Spain) since 2001, which have been recently associated with Tomato torrado virus (ToTV) infection (2). Twenty-two tomato samples showing "torrado disease" symptoms were collected from different greenhouses between 2003 and 2006 in Las Palmas (Canary Islands, Spain). To verify the identity of the disease, double-antibody sandwich (DAS)-ELISA was performed on leaf and fruit extracts of symptomatic plants using polyclonal antibodies specific to Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from the 22 tomato samples with the RNAwiz Extraction kit (Ambion, Huntingdon, United Kingdom) and tested using one-step reverse-transcription (RT)-PCR with the SuperScript Platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) with primers specific to PepMV (1) and ToTV (2). All analyses included healthy tomato plants as negative controls. Five of the twenty-two tomato samples were positive for PepMV and negative for the other viruses tested by serological analysis. However, all 22 samples were positive in RT-PCR performed with the primers specific to ToTV segment RNA2. The RT-PCR assay to detect ToTV produced an amplicon of the expected size (580 bp). No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR reaction. The ToTV RT-PCR product was purified (High Pure PCR Product Purification kit, Roche Diagnostics, Mannheim, Germany) and sequenced. BLAST analysis of one sequence (GenBank Accession No. EF436286) showed 99% identity to ToTV RNA2 sequence (GenBank Accession No. DQ388880). To our knowledge, this is the first report of ToTV in the Canary Islands. References: (1) I. Pagán et al. Phytopathology 96:274, 2006. (2) M. Verbeek et al. Online Publication. doi:10.1007/s00705-006-0917-6. Arch. Virol., 2007.

First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in Spain.

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. The first report of IYSV in Spain was from Albacete in 2003 (1) followed by the Canary Islands in 2005. In November of 2006, disease symptoms suspected to be caused by IYSV were observed on the central and outer leaves of commercial leeks plants (cvs. Asthow, Edison, and Shelton) from Alicante, Spain. Symptoms consisted of dry, white-to-straw-colored, spindle-shaped, irregular chlorotic and necrotic lesions on the leaves. Tissue from symptomatic leaves was sampled and analyzed by a double-antibody sandwich (DAS)-ELISA with specific polyclonal antibodies against Onion yellow dwarf virus (OYDV), Leek yellow stripe virus (LYSV) (Biorad Phyto-Diagnostics, Marnes-La Coquette, France), IYSV, and Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany). Five of seven leek samples belonging to the three cultivars tested were positive for IYSV. All samples were negative for the other viruses tested. The presence of IYSV was verified in the positive samples by reverse transcription (RT)-PCR using primers derived from the nucleocapsid (N) gene of IYSV (1). RT-PCR gave a PCR amplicon of expected size (approximately 790 bp) from symptomatic leek plants. The product of one of the positive leek samples was purified and sequenced (GenBank Accession No. EF427447). Nucleotide sequence analysis confirmed the identity of the amplicon as that of the IYSV N gene. Sequence comparisons showed 99% identity with the sequence of the IYSV Spanish isolate available in GenBank (Accession No. EF419888). Thrips tabaci is the primary vector of IYSV. Although the vector is present in Spain, the efficiency of the Mediterranean ecotype in transmitting the virus is not known. Leek has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, Australia, and the United States (2). To our knowledge, this is the first report of natural infection of leek with IYSV in Spain. References: (1) C. Córdoba-Sellés et al. Plant Dis. 89:1243, 2005. (2) H. F. Schwartz et al. Plant Dis. 91:113, 2007.