Teaching medical students hematopathology: a randomized crossover study comparing direct inspection by light microscope versus projected images.

Background: Students' ability to diagnose various blood disorders could be substantially improved by continuously reviewing approaches toward teaching hematology. This study aims to compare the effectiveness of light microscopes and projected images on students' learning and determine medical students' perception of these teaching methods. Methods: A randomized trial was conducted using a crossover design. Two groups, each with 30 students, were subjected to teaching methods based on light microscopes and projected images alternatively. Results: No differences were found in the two study groups' baseline characteristics, such as median age, sex, and prior academic performance, as well as in the pre-test scores. Post-test scores were significantly higher among students subjected to the projection method than in the control group (Mean ± SD = 9.8 ± 1.7 vs. 5.1 ± 1.3, p < 0.001). In the post-cross-over assessment, 85% (n = 51) of students reported their satisfaction for the projected images, and 78% (n = 47) of students were willing to be taught by projection. Students perceived that the projection method facilitated participation and better involvement in discussions, improved learning, provided greater motivation, and eventually increased comprehension and efficiency. Conclusion: The projection-based teaching method is more effective in improving knowledge and achieving intended learning outcomes. Students tend to prefer the projection method over the laboratory-based method and perceive it as an effective method to enhance their learning of hematology.

Evaluation of Medical Students' Satisfaction With Using a Simulation-Based Learning Program as a Method for Clinical Teaching.

Objectives This cross-sectional analytical study aims to evaluate medical students' awareness and satisfaction regarding the utilization of simulation-based learning (SBL) as a method for clinical teaching at King Saud University (KSU) over the past 12 months. It seeks to understand how such learning methods enhance students' self-satisfaction and clinical skills, facilitate the application of learned knowledge, and assess the role of instructors in providing ample practice opportunities in the skills laboratory. Furthermore, the study aims to assess the satisfaction levels of students in both preclinical and clinical years regarding the time allocated for skills laboratory sessions and the integration of high-fidelity technology in simulation-based training programs at KSU. Methods In this cross-sectional study, a total of 306 male and female medical students from the College of Medicine at KSU participated, comprising 196 preclinical students (first, second, and third years) and 110 clinical students (fourth and fifth years). Quantitative data was collected through a structured questionnaire on a 5-point Likert scale that showed degrees of satisfaction. The satisfaction was measured based on a 5-point Likert scale that shows the degree of satisfaction from (very dissatisfied, dissatisfied, neither dissatisfied nor satisfied, satisfied, and very satisfied), and we calculated the p-value based on an independent t-test, and the percentage represented the percentage of students who chose satisfied and very satisfied. Results The results showed overall satisfaction with SBL (mean: 3.98, 71.10%), and it was recognized as a useful and effective method of learning skills. It is reported that it helped the students implement what they learned. At the same time, lower satisfaction was identified in areas with less allocated time for skill labs. Moreover, lack of accessibility and lack of trained staff were reported, and they should be addressed by providing staff with proper training. Conclusion The results of the study will help to understand how students' learning needs should be addressed. Moreover, providing simulation-based training is a pathway compliant with the best educational standards that should be adapted according to each institution's singularities. Besides offering further results, the study presents suggestions for further research.

Correction: Descriptive Characteristics of Multiple Myeloma Patients in King Abdulaziz Medical City National Guard.

[This corrects the article DOI: 10.7759/cureus.52692.].

Descriptive Characteristics of Multiple Myeloma Patients in King Abdulaziz Medical City National Guard.

Background Multiple myeloma (MM) is a hematological malignancy characterized by the production of monoclonal immunoglobulin. It is the second-most common hematological malignancy. The survival rate varies depending on age at diagnosis, comorbidities, and treatment.This study aims to assess the prevalence of clinical and laboratory characteristics among multiple myeloma patients. Methods This is an observational study of multiple myeloma patients who were admitted to King Abdulaziz Medical City - National Guard between January 2015 and December 2020. Patient records were reviewed to derive clinical and laboratory characteristics. Descriptive data analysis and survival analysis were obtained using SPSS. Results Our study included 151 patients, 95 of whom were males and 56 were females, and the mean age of diagnosis with MM was 62.6 (SD = 13.4). Among 151 MM patients, the most common clinical signs were bone lesions and renal disease, with a percentage of 66.9% and 46.4%, respectively. Death rates throughout the time of study conduction were 19.2%, accounting for 29 patients, and the median overall survival was 5.1 years with a 95% confidence level. Testing the association between survival rates and gender showed that death rates in females were significantly higher than in males (p-value = 0.023). Patients with anemia had a significantly higher hazard ratio in both unadjusted and adjusted analyses (aHR = 2.61; 95% CI = 1.21-5.65). Conclusion There was a relationship between survival and gender, which suggests a protective factor favoring the male gender. Clinical and laboratory characteristics, including bone marrow lesions, anemia, and renal disease, were the initial presentation; thus, a detailed history focused on symptoms should be taken when any of these symptoms are reported.

Heat generation/absorption effect on natural convective heat transfer in a wavy triangular cavity filled with nanofluid.

This study is numerically executed to investigate the influence of heat generation or absorption on free convective flow and temperature transport within a wavy triangular enclosure filled by the nanofluid taking the Brownian effect of nanoparticles. The water (H2O) is employed as base fluid and copper (Cu) as nanoparticles for making effective Cu-H2O nanofluids. The perpendicular sinusoidally wavy wall is cooled at low temperature while the horizontal bottom sidewall is heated non-uniformly (sinusoidal). The inclined wall of the enclosure is insulated. The governing dimensionless non-linear PDEs are executed numerically with the help of the Galerkin weighted residual type finite element technique. The numerically simulated results are displayed through average Nusselt number, isothermal contours, and streamlines for the various model parameters such as Hartmann number, Rayleigh number, heat generation or absorption parameter, nanoparticles volume fraction, and undulation parameter. The outcomes illustrate that the temperature transport rate augments significantly for the enhancement of Rayleigh number as well as nanoparticles volume fraction whereas reduces for the increment of Hartman number. The heat transfer is significantly influenced by the size, shape, and Brownian motion of the nanoparticles. The rate of heat transport increases by 20.43% considering the Brownian effect for 1% nanoparticle volume. The thermal performance increases by 8.66% for the blade shape instead of the spherical shape of nanoparticles. In addition, heat transfer is impacted by the small size of nanoparticles. The thermal transport rate increases by 35.87% when the size of the nanoparticles reduces from 100 to 10 nm. Moreover, the rate of heat transmission increases efficiently as the undulation parameter rises. It is also seen that a crucial factor in the flow of nanofluids and heat transmission is the heat generation/absorption parameter that influences temperature distribution, heat transfer rates, and overall thermal performance.

Computational investigation of magnetized hybrid nanofluids heat transport and flow through elongational surface with thermal radiation and wall slip.

The improved thermal performance of recently discovered hybridized nanofluids has become essential in large scale thermal processes. In fact, this is highly efficient technique to introduce the thermal efficiency of tranditional heat transferring fluids. The behavior of the nanofluid can be significantly impacted by the unsteady heating and magnetic field effects that may be present in many applications. Therefore, the current study investigat the unsteady magnetized flow of hybrid nanofluid with heat transport characteristics subject to thermal radiation and slip at the surface wall. The shrinking/stretching surface is chosen as a flow source, which is frequently occure in polymer technology, which deals with the deformability of elastic sheets, and in metallurgy, where continued strips are cooled. The novel form of shrinking surface flow is fundamentally a reverse flow and exhibits physical characteristics that differ significantly from the channel flow scenario. The distinctive features of this scruinity is the use of empirical relations to approximate the optimum thermophysical attributes of a Cu-Al2O3/ water hybrid nanofluid in order to model the 2-dimensional flow past a flat shrinking/stretching sheet under the action of radiation, Lorentz forces and realastic boundary condition responses. The governing system of modelled equation are assembled using the Tiwari-Das model in conjunction with a hybrid mass-based nanofluid model. The bvp4c algorithm is employed within the computer MATLAB programme. The hybrid nanofluid flow shows conclusive improvement in the frictional coefficient and heat transport performance. However, the effectiveness the unsteadiness parameter deteriorates the heat transmission. In the contiguity of a suction parameter, multiple outcomes appear to arise for both stretched and shrinking instances. The coefficient of energy transport improves as the magnetic factor is augmented, however the skin coefficient of friction exhibits dual behavior for the second solutions. A time-dependence investigation is undertaken to figure out the reliability of the twin solutions, and it is discovered that merely one of them remains stable and aesthetically credible.

Awareness of healthcare providers on environment-friendly practices in operating rooms in selected hospitals in Riyadh, Saudi Arabia.

Climate change will have a great impact on humanity in upcoming years and will affect the health of all living creatures. Hospitals play a significant role in climate change due to their substantial waste production and they are considered a profound pollution source, with the Operating Theater as a main contributor. This study was aimed to examine the level of knowledge among healthcare professionals in Saudi Arabia concerning the proper implementation of operating room (OR) environmental procedures and efficient management of hospital waste. This is a cross sectional study performed across 3 hospitals in Riyadh, Saudi Arabia. The hospitals included are Prince Sultan military hospital, National guard hospital and King Salman hospital. The study included all the staff and health workers in OR (operating room), excluding all staff and health workers not in OR. The study took place between September 1 and November 1, 2022. None of the study participants mentioned that their institute or hospital fully engaged in Greenhealth Greening the OR initiative. Almost 1 to 3rd of the study participants (38.1%) mentioned that endorsement and participation in the practice of Greenhealth Greening the OR initiative was not implemented at all, and 45% of the participants were completely unaware of such an initiative. The study's findings suggest that healthcare providers in Saudi Arabia are not fully aware of environmentally friendly practices. Further, the current initiatives undertaken by the hospital administration fall short in attaining environmentally sustainable benchmarks.

Salvageable Intra-stent Coil Embolization Treatment for Spinal Dural Arteriovenous Fistula in a Child.

Spinal dural arteriovenous fistulae (SDAVF) are rare diseases that exhibit abnormal connections between arteries and veins. They are even rarer in the pediatric population and pose diagnostic and treatment challenges for physicians. Its presentation varies depending on the site and size of the SDAVF. Multiple management options are available, which are usually tailored depending on the patient's condition. Here, we present a rare case of SDAF in a four-year-old girl who initially presented with bilateral lower limb weakness. The patient was then treated successfully using primary major fistula point stenting and intra-stent coiling, with complete closure achieved. Full recovery was achieved over the course of follow-ups. The deep analysis of SDAVF, its classification, and the utilization of the best available endovascular tools by a dedicated neurovascular team offer the best outcome in dealing with complex spinal neurovascular pathologies.

Basal Cell Adenoma of the Parotid Gland: A Rare Disease Entity.

Neoplasms of the salivary glands are of rare incidence, have a vague presentation, and follow a complex long-term clinical course. Both minor and major salivary glands have been implicated in dysplastic transformation, with parotid gland tumors being the most notable. Most of these tumors are benign in nature and are typically diagnosed and classified based on their histopathological presentation. In this report, we exhibit a rare case of basal cell adenomas (BCA), localized to the right parotid gland, in a 69-year-old male patient. Volume acquisition computed tomography (CT) imaging of the region was obtained with and without contrast, with relative reconstruction in both the coronal and axial planes. A soft tissue mass of 5 cm in diameter was detected in the superficial lobe of the right parotid gland. Fine needle aspiration (FNA) with ultrasound guidance revealed a population of basaloid cells that is monomorphic with minimal nuclear atypia and scattered fibrillary matrix. Thereafter, the patient was treated with partial excision of the right parotid gland under general anesthesia, and the post-operative pathology report confirmed the diagnosis of basal cell adenoma. The patient was doing well post-operatively with no complaints and maintained routine clinic follow-ups.

Basal Cell Adenoma of the Minor Salivary Glands in the Buccal Mucosa: A Rare Entity Arising in an Unusual Location.

One of the rare tumors of the salivary gland is known as basal cell adenoma (BCA). Only a small percentage of salivary gland tumors affect the minor salivary gland of the oral cavity while the majority are found in the parotid gland. We present a rare case of BCA involving the left buccal mucosa of a 45-year-old female. Magnetic resonance imaging (MRI) showed well defined solid mass measuring 1.9 x 1.5 cm in the left buccal space inseparable from the buccinator muscle. The T2-weighted image demonstrates a hyperintense signal post-contrast. Ultrasound-guided fine needle aspiration cytology revealed cellular basaloid neoplasm of uncertain malignant potential. Thereafter excision of the mass was performed through a transoral approach under general anesthesia. Histopathology of the mass showed encapsulated basal cell neoplasm in favor of BCA. The patient was doing well after the surgery and has intact facial nerve and adjacent nerves such as the auriculotemporal nerve and great auricular nerve with no complications then she kept on routine clinic follow-ups, and the surgical site recovered successfully. Therefore, we conclude that MRI and biopsy provide useful information to differentiate between benign adenoma and malignant adenocarcinoma. BCA should be considered in a differential diagnosis of an isolated neck mass. Surgical excision demonstrates an excellent prognosis.

Thyroid Disorders Spectrum in Pediatric Endocrine Clinic; Seven-Year Experience of a Teaching Hospital in Saudi Arabia.

Thyroid disorders constitute one of the major endocrine disorders in pediatric service. It includes a range of congenital versus acquired anatomic and/or functional thyroid diseases in growing children that has a spectrum of severity from severe intellectual disability effect to subclinical mild pathologies. This study was designed to analyze the demographic characteristics, clinical pattern, and severity of thyroid disorders in the pediatric endocrine clinic patients at the teaching hospital of the university over a 7-year duration. A total number of 148 patients with thyroid disorders were seen in pediatric Endocrine clinic during the time between January 2015 and December 2021. Female patients constitute 64% of them. Acquired Hypothyroidism was the commonest disorder; 34% of the cases followed by the congenital hypothyroidism (CH), then Hashimoto's thyroiditis, and 5.8% for others. While a very small percentage was acquired hyperthyroidism. The majority of referrals were from dermatology and other service for the screening of thyroid disease as association with other autoimmune diseases with percentage of 28.3%. Next was neck swelling manifestation in 22.6%. Thyroid disorders in children, both congenital and acquired, constitute an important medical issue for pediatricians to be aware of its variable presentations, and its potential serious health consequences on the affected children if not diagnosed and treated earlier. Acquired hypothyroidism constitutes more percentage of the thyroid disorders followed in the pediatric endocrinology outpatient clinics. Congenital hypothyroidism is the second most common thyroid disorder in the outpatient unit, having the most potential complications. These results support the international studies with the female predominance in most of thyroid disorders.

Hybrid MWCNT and TiO2 Nanoparticle-Suspended Waste Tyre Oil Biodiesel for CI Engines.

Nowadays, scarcity arises in almost all our basic needs, including water, fuel, and food. Recycling used and scrapped things for a valuable commodity is highly appreciable for compensating for the globally fast-growing demand. This paper aims to investigate waste tyre oil for preparing biodiesel for CI engines by enhancing their performance with hybrid nanoparticles for preparing nanofuel and hybrid nanofuel. The nanoparticles (30-40 nm) of MWCNT and TiO2 were utilized to prepare nanofuels with nanoparticle concentrations of MWCNT (300 ppm) and TiO2 (300 ppm), respectively. In the case of hybrid nanofuel, the nanoparticle concentration of MWCNT (150 ppm) and TiO2 (150 ppm) was preferred. The performance of the proposed nanofuel and hybrid nanofuel with pure diesel was evaluated. The proposed fuel performance outperforms the combustion performance, has higher engine efficiency, and has fewer emissions. The best performances were noticed in hybrid nanofuel that has 32% higher brake thermal efficiency than diesel and 24% and 4% lower BSFC and peak pressure than diesel, respectively. The emission performance is also 29%, 50%, and 13% lower in CO, HC, and CO2 emissions than that in pure diesel.

Ulnar artery access for intracranial mechanical thrombectomy procedure: A salvage option after failed trans-femoral and trans-radial access.

84 years old gentle man with past medical history of hypertension and diabetes presented with sudden onset right sided weakness and aphasia for two hours. Initial neurological assessment revealed National Institute of Health Stroke Scale (NIHSS) 17. Computed tomography (CT) scan demonstrated minimal early ischemic changes along left insular cortex with occlusion of left middle cerebral artery (MCA). Based on clinical and imaging findings, decision was made to perform mechanical thrombectomy procedure. Initially, right common femoral artery approach was utilized. However, due to unfavorable type-III bovine arch, left internal carotid artery could not be engaged via this approach. Subsequently, access was switched to right radial artery. Angiogram revealed small caliber radial artery, with larger caliber ulnar artery. Attempt was made to advance the guide catheter through the radial artery, however significant vasospasm was encountered. Subsequently, ulnar artery was accessed and successful thrombolysis in cerebral infarction (TICI) III left MCA reperfusion was achieved with a single pass of mechanical thrombectomy via this approach. Post procedure neurological examination demonstrated significant clinical improvement. Doppler ultrasound 48 hours after the procedure demonstrated patent flow in radial and ulnar arteries with no evidence of dissection.

Effect of Kaolin Clay and ZnO-Nanoparticles on the Radiation Shielding Properties of Epoxy Resin Composites.

The use of radiation is mandatory in modern life, but the harms of radiation cannot be avoided. To minimize the effect of radiation, protection is required for the safety of the environment and human life. Hence, inventing a better shield than a conventional shielding material is the priority of researchers. Due to this reason, this current research deals with an innovative shielding material named EKZ samples having a composition of (epoxy resin (90-40) wt %-kaolin clay (10-25) wt %-ZnO-nano particles (0-35) wt %). The numerous compositional variations of (epoxy resin, kaolin clay, and ZnO-nano particles on the prepared EKZ samples varied the density of the samples from 1.24 to 1.95 g/cm3. The radiation shielding parameter of linear attenuation coefficient (LAC), half value layer (HVL), tenth value layer (TVL), and radiation protection efficiency (RPE) were measured to evaluate the radiation diffusion efficiency of newly made EKZ samples. These radiation shielding parameters were measured with the help of the HPGe detector utilizing the three-point sources (Am-241, Cs-137, and Co-60). The obtained results exposed that the value of linear attenuation coefficient (LAC) and radiation protection efficiency (RPE) was maximum, yet the value of half value layer (HVL), and tenth value layer (TVL), were minimum due to the greater amount of kaolin clay and ZnO-nanoparticles, whereas the amount of epoxy resin was lesser. In addition, it has been clear that as-prepared EKZ samples are suitable for low-dose shielding applications as well as EKZ-35 showed a better shielding ability.

Knowledge and Practices of Child Eye Healthcare Among Parents in Aseer Region, Saudi Arabia.

BACKGROUND: The majority of causes of childhood blindness are preventable and treatable. There are an estimated 1.4 million blind children worldwide, with roughly three-quarters of them living in developing countries. In most low-income countries, school-age children account for 20%-30% of the total population. AIM: To evaluate parents' knowledge, attitudes, and practices related to pediatric eye medical services in Saudi Arabia's Aseer region. METHODOLOGY: A descriptive cross-sectional approach was used targeting all parents in the Aseer region. Data were collected using a structured questionnaire developed by the study investigators. The questionnaire included parents' sociodemographic data and a family history of blindness or visual disability. Parents' awareness regarding pediatric eye care was assessed using relevant items. The parents' practices and attitudes regarding eye care were also assessed within the questionnaire. RESULTS: The study included 899 parents who replied to the online questionnaire in its entirety. Some 54% of the responding parents were aged 30-50 years, and 51.2% were males. Of the parents, 46.2% had a university-level education, and 48.5% accompanied their children for eye examinations. About 65% of the parents knew about clinics for eye examinations, and 63.3% of them knew that blind children could learn. In total, more than one-third of the parents were aware of pediatric eye care. CONCLUSIONS AND RECOMMENDATIONS: The study found that parents were aware of pediatric eye health and sought eye care for their children. More effort should be put forth through planned awareness programs to educate parents and assist them in overcoming the fears and barriers that keep them from seeking eye care for their children.

Pontine Infarction and Vertebral Artery Dissecting Aneurysm as the First Presentation of Behçet's Disease: A Case Report.

Behçet's disease (BD) is a systemic disease of inflammatory origin that appears most often in the third or fourth decade of life. Behçet's disease is hallmarked predominantly by mucocutaneous lesions and ocular involvement. Vertebral artery dissection and neurological manifestations are rare complications in Behçet's disease. We examine the case of a medically free 33-year-old male who was admitted to the emergency department complaining of sudden-onset dizziness, vomiting, and tinnitus. Neurological examination revealed fluctuating consciousness, multiple gaze nystagmus, motor deficit in the upper and lower limbs, bilateral Babinski sign, and truncal ataxia. Magnetic resonance imaging (MRI) showed a right pontine hyperintense lesion on T2-weighted images (T2WI). A right vertebral angiogram four months after the incident showed a dissection in the mid-cervical third of an anomalous duplicated origin arm of the right vertebral artery. This case describes an uncommon form of initial presentation of Behçet's disease via a pontine infarction triggered by a dissecting aneurysm in an anatomically rare variant of the vertebral artery.

Laparoscopic sleeve gastrectomy as day-case surgery versus conventional hospitalization: results of the DAYSLEEVE randomized clinical trial.

BACKGROUND: Laparoscopic sleeve gastrectomy (LSG) is an effective bariatric intervention with short operative time and low morbidity and mortality. However, ambulatory sleeve gastrectomy is underutilized. OBJECTIVE: This clinical trial compares feasibility, perioperative outcomes, and weight loss of patients undergoing ambulatory LSG with same-day discharge versus conventional hospitalization with next-day discharge. SETTING: Hospital and ambulatory surgery center. METHODS: Patients who satisfied low-acuity criteria were randomized to undergo day-case LSG in the ambulatory surgery center with same-day discharge (DC LSG) or LSG with conventional hospitalization and next-day discharge (CH LSG) between December 2018 and December 2020. The primary outcomes were 30-day adverse events, hospitalizations, reoperations, and readmissions, and the secondary outcome was weight loss during the first year. RESULTS: Of 2541 screened patients, 1544 patients were randomized in the study. Mean age and body mass index were 31.7 ± 9.1 years versus 31.8 ± 9.2 years and 39.6 ± 5.8 kg/m2 versus 40.0 ± 5.7 kg/m2 in the DC LSG group (n = 777) and in the CH LSG group (n = 777), respectively. Eighteen patients (2.3%) in the DC LSG were transferred to the hospital for overnight stay. Additionally, 13 patients (1.7%) requested additional stay without a medical indication for a total overnight stay rate of 4%. One DC LSG patient (.1%) was readmitted, and 2 CH LSG patients (.3%) stayed for an extra day. Seventeen percent of DC LSG patients had unscheduled consultations during the first postoperative week compared with 6% of CH LSG patients (P < .001). Those 2 groups were similar in baseline characteristics. There were no reoperations or mortality in either group, and weight loss results were similar; At 1-year follow-up, DC LSG percent excess weight loss was 87% ± 17% compared with 85% ± 17% in the CH LSG group. The follow-up rate was 100%. CONCLUSION: LSG is feasible as a day-case procedure with comparable outcomes to conventional hospitalization.

Dosimetric effects of embolization material artefacts in arteriovenous malformations stereotactic radiosurgery on treatment planning calculation.

Background and Purpose: Stereotactic Radiosurgery (SRS) is a specialized radiotherapy treatment technique for Arteriovenous Malformations (AVM) in which Computed Tomography (CT) images are used for dose calculations. The purpose of this study was to investigate CT image distortions caused by embolic agents and quantify the influence of these distortions on dose calculations. Methods: Eight AVM patients administered embolic agents prior to SRS were included. Original plans were compared to new recalculated plans using two sets of images. The first set was created by masking the embolic material and artefacts, the second was the diagnostic CT images. In addition, treatment plans were created for an anthropomorphic phantom with water inserts, then with known volumes of embolic materials to study the dosimetric effect of each material. Results: Relative to patients' original plans, maximum Monitor Unit (MU) difference was -4.4% with whole brain masking, -1.3% with artefact masking, -4.1% with embolic masking, and -4.5% with artefact-free diagnostic images. Calculated dose differences were within ± 3.5% for all plans. In phantom, Gamma pass rate was 96% for both embolic agents with conformal fields and 99.9% with dynamic arcs. Dose and MU differences in phantom plans were negligible. Conclusion: Relative dose differences between the original plans and the corrected ones were not clinically remarkable. We recommend evaluating the effect of embolic materials on individual patients' plans. The whole brain corrected planning CT images or diagnostic CT images could be utilized to calculate the magnitude of dose reduction caused by embolic materials and correct it if necessary.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.