Non-Contact Universal Sample Presentation for Room Temperature Macromolecular Crystallography Using Acoustic Levitation.

Macromolecular Crystallography is a powerful and valuable technique to assess protein structures. Samples are commonly cryogenically cooled to minimise radiation damage effects from the X-ray beam, but low temperatures hinder normal protein functions and this procedure can introduce structural artefacts. Previous experiments utilising acoustic levitation for beamline science have focused on Langevin horns which deliver significant power to the confined droplet and are complex to set up accurately. In this work, the low power, portable TinyLev acoustic levitation system is used in combination with an approach to dispense and contain droplets, free of physical sample support to aid protein crystallography experiments. This method facilitates efficient X-ray data acquisition in ambient conditions compatible with dynamic studies. Levitated samples remain free of interference from fixed sample mounts, receive negligible heating, do not suffer significant evaporation and since the system occupies a small volume, can be readily installed at other light sources.

Absolute Differential Positronium-Formation Cross Sections.

The first absolute experimental determinations of the differential cross sections for the formation of ground-state positronium are presented for He, Ar, H2, and CO2 near 0°. Results are compared with available theories. The ratio of the differential and integrated cross sections for the targets exposes the higher propensity for forward emission of positronium formed from He and H2.

First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky.

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5'-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.

Altitude mountain sickness among tourist populations: a review and pathophysiology supporting management with hyperbaric oxygen.

In the mountain climbing community, conventional prevention of altitude mountain sickness (AMS) relies primarily on a formal acclimatization period. AMS symptoms during mountaineering climbs are managed with medication, oxygen and minor recompression (1524-2438 m altitude) using a portable chamber, such as the Gamow Bag. This is not always an acceptable therapy alternative in a predominantly elderly tourist population. The primary problem with reduced pressure at high altitude is hypoxaemia, which causes increased sympathetic activity, induces pulmonary venous constriction, while increasing pulmonary blood flow and regional perfusion. Rapid assents to altitude contribute to an increased incidence of decompression sickness (DCS). The treatment of choice for DCS is hyperbaric oxygenation, thus, treatment of high-altitude induced hypoxaemia using hyperbaric oxygenation (HBO(2)) is logical. Life Support Technologies group and the Center for Investigation of Altitude Medicine (CIMA, in Cusco, Peru) propose a comprehensive and multidisciplinary approach to AMS management. This approach encompasses traditional and advanced medical interventions including the use of a clinical HBO(2) chamber capable of recompression to three times greater than sea level pressure (3 atmosphere absolute (ATA)). The system uses a series of AMS hyperbaric treatment profiles that LST has previously developed to the US military and NASA, and that take greater advantage of vasoconstrictive effects of oxygen under true hyperbaric conditions of 1.25 ATA. These profiles virtually eliminate AMS rebound after the initial treatment often seen in conventional AMS treatment, where the patient is either treated at altitude, or does not recompress back to sea level or greater pressure (1.25 ATA), but returns directly to the same altitude where AMS symptoms first manifested.

Electron-like scattering of positronium.

Positronium (Ps), a hydrogen-like atom composed of an electron and its antimatter partner, the positron, is formed in considerable quantities whenever positrons interact with matter. It has unexpectedly been found to scatter from a wide variety of atoms and molecules in a way very similar to that of a bare electron moving at the same velocity, despite Ps being neutral and twice the mass.

Negative pressure dressings for severe hidradenitis suppurativa (acne inversa): a case report.

Hidradenitis suppurativa (HS) is a frustrating disease to treat for both the patient and the practitioner. In severe cases, aggressive management will often have a more tolerable outcome. We present the case of a 46-year-old gentleman with a long-standing history of severe HS, who was treated successfully with wide surgical excision, followed by a full-thickness skin graft and negative pressure wound therapy (both pre- and post-operatively). A review of the literature revealed few reports of HS treatment using these sequential steps.

Potential for drug interactions involving cytochrome P450 in patients attending palliative day care centres: a multicentre audit.

AIM: To determine the potential for drug interactions involving cytochrome P450 (CYP) in patients receiving palliative day care. METHODS: Drugs used by patients attending four specialist palliative day care centres were reviewed to identify combinations that could result in a pharmacokinetic interaction via any of the five main human forms of CYP. RESULTS: Of 160 patients, 145 (91%) were prescribed at least one drug that was a substrate, inhibitor or inducer of one of the five main CYP isoforms. Twenty-four drug combinations, involving 34 patients, could have given rise to a clinically important interaction. CONCLUSIONS: Prescribers should be aware that in this group of patients, one in five are at risk of a clinically important CYP-mediated drug interaction.

Rapid sequence intubation in Scottish urban emergency departments.

OBJECTIVE: Airway care is the cornerstone of resuscitation. In UK emergency department practice, this care is provided by anaesthetists and emergency physicians. The aim of this study was to determine current practice for rapid sequence intubation (RSI) in a sample of emergency departments in Scotland. METHODS: Two year, multicentre, prospective observational study of endotracheal intubation in the emergency departments of seven Scottish urban teaching hospitals. RESULTS: 1631 patients underwent an intubation attempt in the emergency department and 735 patients satisfied the criteria for RSI. Emergency physicians intubated 377 patients and anaesthetists intubated 355 patients. There was no difference in median age between the groups but there was a significantly greater proportion of men (73.2% versus 65.3%, p=0.024) and trauma patients (48.5% versus 37.4%, p=0.003) in the anaesthetic group. Anaesthetists had a higher initial success rate (91.8% versus 83.8%, p=0.001) and achieved more good (Cormack-Lehane Grade I and II) views at laryngoscopy (94.0% versus 89.3%, p=0.039). There was a non-significant trend to more complications in the group of patients intubated by emergency physicians (8.7% versus 12.7%, p=0.104). Emergency physicians intubated a higher proportion of patients with physiological compromise (91.8% versus 86.1%, p=0.027) and a higher proportion of patients within 15 minutes of arrival (32.6% versus 11.3%, p<0.0001). CONCLUSION: Anaesthetists achieve more good views at laryngoscopy with higher initial success rates during RSI. Emergency physicians perform RSI on a higher proportion of critically ill patients and a higher proportion of patients within 15 minutes of arrival. Complications may be fewer in the anaesthetists' group, but this could be related to differences in patient populations. Training issues for RSI and emergency airway care are discussed. Complication rates for both groups are in keeping with previous studies.

Polio vaccine and retroviruses.

In this paper we consider the main steps in the process of manufacture of oral polio vaccine and assess the probable clearance factor for HIV retrovirus at each step. We conclude that the processes employed would have eliminated retrovirus contamination for all practical purposes.

Comparison of oral and intravenous morphine following acute injury in children.

The objective of this research was to examine the speed of onset and effectiveness of pain relief between oral and intravenous morphine in acutely injured children. An observational study of children aged 3 to 13 years with closed forearm fractures was performed in three accident and emergency departments. The study gathered information on age, gender, body weight, time of arrival, dose, route and time of morphine administration. Pain assessment using a Faces Scale was documented on arrival and repeated at 10, 30 and 60 minutes after morphine was given. Forty-seven children were studied. Of these, 25 were given intravenous morphine, 22 were given oral morphine. There was no statistically significant difference in age, body weight or time until morphine was administered. The change in median pain scores was analysed using the Mann-Whitney U test. This showed that there was a statistically significant reduction in pain score in the intravenous group compared with the oral group between arrival and 10 minutes after giving morphine and between arrival and 60 minutes after giving morphine. Intravenous morphine appears to give more rapid onset and more prolonged pain relief than oral morphine for children with acute injuries. We recommend that in accident and emergency departments where staff are experienced in paediatric cannulation, morphine should be given via the intravenous route in acutely injured children. However we do not advocate inexperienced staff attempting multiple venepunctures in a child resulting in increased anxiety.

A five year study of high falls in Edinburgh.

High falls are a common cause of death and disability. The aim of this study was to obtain an epidemiologically complete picture of all high falls over a 5 year period in Edinburgh, Scotland. Prospectively collected data on hospital survivors and hospital deaths was collected from the Scottish Trauma Audit Group (STAG) database. Data on prehospital deaths was obtained from autopsy reports and detailed police enquiry reports. There were 341 patients in the study, of whom 82% were male. Seventy-four percent survived to hospital discharge. Sixty-three percent of the total deaths appeared to be suicides. Head and chest injuries were responsible for the majority of deaths. Pelvis, limb and vertebral injuries predominated in survivors. In conclusion, prevention may be the most effective method of reducing prehospital deaths. Abdominal injuries were associated with a poor outcome, but survival might improve with immediate surgical exploration in haemodynamically unstable patients.

Categorical perception occurs in newly learned faces, other-race faces, and inverted faces.

On the basis of findings that categorical perception (CP) is possible in complex visual stimuli such as faces, the present study tested for CP on continua between unfamiliar face pairs. Results indicate that CP can be observed for unfamiliar faces, in both familiar (same-race) and unfamiliar (other-race) groups. In addition, significant CP effects were observed in inverted faces. Finally, half-continua were tested where midpoint stimuli became endpoints. This was done to ensure that stimulus artifacts did not account for the observed CP effects. Consistent with the perceptual rescaling associated with CP, half-continua showed a rescaled CP effect. We argue that these CP effects are based on the rapid acquisition of perceptual equivalence classes.

Suicidal high falls.

There are few data on committing suicide by jumping from a height. Information on suicidal high falls in southeast Scotland was prospectively gathered over 7 years (1992-1998). Data sources included ambulance, police, hospital and forensic records. Injuries sustained were scored according to the Abbreviated Injury Scale, generating Injury Severity Scores (ISS). Sixty-three individuals (50 males), appeared to have committed suicide by falling from a height. The backgrounds were diverse, but 44 individuals had known previous psychiatric illness, 18 having attempted suicide before. The most common locations were high bridges, with two accounting for 23 deaths (37%). Only nine individuals (14%) reached hospital alive. ISS range was 16-75, including 22 scores of 75. These individuals had a total of 24 injuries acknowledged to be unsurvivable, comprising 10 thoracic aortic ruptures, eight massive brain/brainstem injuries, four cardiac injuries, and two high spinal cord transections. The high rate of prehospital death reflects the heights of the falls and consequent major injuries. Prevention of suicide is acknowledged to be difficult - these results suggest that hospital treatment of injuries sustained has little to offer in terms of reducing the death rate from suicidal high falls.

Nonprotein amino acids from Cycas revoluta.

Two nonprotein amino acids, cycasindene and cycasthioamide, along with eight known nonprotein amino acids, were isolated from the seeds of Cycas revoluta Thunb. The structures of cycasindene and cycasthioamide were elucidated as 3-[3'-amino-indenyl-2]-alanine (1) and N-[glycinyl-alaninyl-11-thio]-5-one-pipecolic acid (2) by chemical and spectral methods.